SEQUENCE ANALYSIS OF HUMAN CYTOMEGALOVIRUS PROMOTERS
A THESIS SUBMITTED TO THE COLLEGE OF SCIENCE, UNIVERSITY OF SULAIMANI IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE IN MICROBIOLOGY / MOLECULAR VIROLOGY
By
Paywast Jamal Jalal Ali B.Sc. in Biology - 2003 Higher Diploma in Clinical Microbiology - 2007
Supervised by
Asst. Prof. Dr. Farhad M. Barzinji
August 2010
Gelawezh 2710 Kurdish
بسم هللا الرحمن الرحيم سماء ماء فأخرجنا ألم تَ َر أنَّ هللا أنز َل من ال َّ به ثمرات ُم ْختلفا ألوانُها ومن الجبال ُج َد ٌد سود ٌٌ ٌ بيض وحم ٌر مختلفٌ ألوانُها وغرابيب ُ )(27 َّواب واألنعام ُمختلفٌ ومن النَّاس والد ِّ ألوانُهُ كذلك إنَّما يَخشى هللا من عباده )(28 العلما ُء إنَّ هللا عزي ٌز غفور صدق هللا العظيم سورة فاطر آية ( )72 – 72
I certify that this thesis was prepared under my supervision in the College of Science, University of Sulaimani, as partial requirements for the degree of Master of Science in ″Microbiology / Molecular Virology″
Signature: Name: Asst. Prof. Dr. Farhad M. Barzinji Date: 8 / 5 /2010
In view of the available recommendation, I forward this thesis for debate by the examining committee.
Signature: Name: Dr. Raza Hasan Hussain The Head of Biology Department Date: 18 / 6 /2010
We certify that we have read this thesis and as Examining Committee, examined the student in its contents and in our opinion it is adequate as partial fulfillment of the requirements for the degree of Master of Science in Microbiology / Molecular Virology
Signature:
Signature:
Name: Dr. Aumaid U. Uthman
Name: Dr. Adel K. Khider
Professor
Asst. Professor
Date: 8 / 8 / 2010
Date: 8 / 8 / 2010
“Chairman”
“Member”
Signature:
Signature:
Name: Dr. Gaza F. Salih
Name: Dr. Farhad M. Barzinji
Lecturer Date: 8 / 8 / 2010
Asst. Professor Date: 8 / 8 / 2010
“Member”
Approved by the Council of the College of Science.
Signature: Name: Dr. Bakhtiar Q. Aziz “Acting Dean” Date: 29 / 8 / 2010
“Supervisor-Member”
LINGUISTIC EVALUATION CERTIFICATION
I hereby certify that this thesis has been read and checked and after indicating all the grammatical and spelling mistakes; the thesis was given again to the candidate to make the adequate corrections. After the second reading, I found that the candidate corrected the indicated mistakes. Therefore, I certify that this thesis is free from mistakes.
Name: Sara K. Othman Signature: Date:
17 / 6 / 2010
English Department / College of Languages / Sulaimani University
Dedication To the four pillars of my life: God, my husband, and my parents, my brothers and sister. Without you, my life would fall apart. I might not know where the life’s road will take me, but walking with You, God, through this journey has given me strength. Khattab, you are everything for me, without your love and understanding I would not be able to make it. Mom, you have given me so much, thanks for your faith in me, and for teaching me that I should never surrender. Daddy, you always told me to “reach for the stars.” I think I got my first one. Thanks for inspiring my love for transportation. Halwest, Daban, Dastan, you are my backbone in this life. Pasand, you are my breath. We made it…
Paywast
ACKNOWLEDGMENTS My thanks are due to the Kurdistan Regional Government, Ministry of Higher Education and the Presidency of Sulaimani University for providing me the opportunity and support to accomplish this work. I would also like to offer my thanks to the Deanery of the College of Science and Biology department for their helps and facilities required for this research. I am enormously indebted to my supervisor Dr. Farhad M. Barzinji for his help and patience during the time of being M.Sc. student in his center KMRC (Kurdistan Medical Research Center). I should acknowledge his untiring efforts to go through my drafts keenly and providing me feedbacks in no time to finish everything in time. I am also grateful to current members of the Veterinary Central Laboratory in KRGErbil for their much help. My deepest thanks are extended to my husband, Dr. Khattab A. Shekhany, who believed in my project, supported me and he has been long-suffering during my absence. Also my special thanks go to others in my family who supported and encouraged me in completing this work. A very special thank must go to Dr. Shwan K. Rachid in Pharmaceutical Biotech. Institute/ Saarland University for his appreciated cooperation, his guidance and
support
was
matched
only
by
his
enthusiasm
for
science.
Also
I
would like to thank Dr. Khanda who helped me in early day of my work during the process of taking sample and all other labs in the Hospitals of Sulaimani city, in Kurdistan – Iraq. Words fail to express hearty thanks to my dear friends Mr. Sardar Sabah and Mr. Zana Jamal who were always ready to help, encourage and support me whatever the cost it took, I could not have wished for a kinder or more considerate colleague. Finally, I feel indebted to whoever has helped me with my work and whose name I have not mentioned here…………
Paywast
Abstract
ABSTRACT
The serological tests are currently the only methods widely available in this country. However, specific genome detection by PCR is now named as golden way for detection even in early stages was no significant antigen detected. The result showed that from 130 serum samples which were detected by ELISA and showed different seropositivity for both Immunoglobulins, by PCR 57.70% of these samples´ genome were detected. 46 samples which were detected by ELISA and showed positivity for both IgM or IgG, by PCR 80.43% of these samples showed positive genome detection; and from those samples which have +ve IgM, by PCR 83.33% of these samples´ genome were detected; While from 33 samples –ve by ELISA, 18 samples (54.54%) by PCR showed +ve product. PCR amplification and cloning on pJET1.2/Blunt vector of six promoters from different loci of UL and US regions were performed; then sequences of amplified promoters from local HCMV isolates and compared to the published sequences showed many variations in the different local isolated promoters comparing to the published strains. Two newly constructed vectors were formed by cloning and subcloning of the HCMV promoters on different vectors, one on pTZ57R vector and the other on pBR322 vector after deletion of the tet gene from this vector. The aim of these constructions was to determine whether orientation of the expression cassette within the viral vector has an effect on gene expression, and to examine variations in expression associated with different vectors in vitro. These constructed vectors were used in β-galactosidase assay but the data was not shown here, because the results showed that the CMV promoters were transcriptionally active and able to drive LacZ gene expression in prokaryotic cell with the aid of high and low copy number vectors, based on these results more work needs to confirm the results so the data not shown here.
I
List of Contents
List of Contents Abstract
I
List of Contents
II
List of Tables
VI
List of Figures
VII
List of Abbreviations
X
1. Introduction
1
2. Literature Review
3
2.1 The Herpesviridae………………………..…………………………..……
3
2.2 Human Cytomegalovirus (HCMV)……………………………….….…..
6
2.3 Genome Organization of HCMV……………………………..…………..
7
2.3.1 Genome Content of HCMV…….…………...………………………..
7
2.3.2 Promoters of HCMV …………..………………………………….…..
10
2.4 Replication of HCMV………………………………………….……………
12
2.4.1 Entry ……………………………………………………………………
13
2.4.2 CMV Gene Expression and Regulation …………..………………..
14
2.4.2.1 Immediate Early Gene Expression ………..……………….
15
2.4.2.2 Early Gene Expression …………………………………...…
16
2.4.2.3 Late Gene Expression ……………………..………………..
16
2.4.3 DNA Replication and Packaging ………………………………..…..
17
2.4.4 Egress of Viral Progeny ……………………………..……...……….
18
2.5 Transmission of HCMV……………………………………………………
19
2.6 Pathogenesis and Infection of HCMV……..……………………………
19
2.7 Latency and Reactivation ………………………………………………..
21
2.8 Treatment of HCMV ………………………………………………...……..
22
2.9 Laboratory Diagnosis of HCMV………………………………...………..
24
II
List of Contents
2.10 Molecular Methods………………………………………………………
26
2.10.1 Genome Extraction…………………..………………………………
26
2.10.2 Polymerase Chain Reaction (PCR)……….……………………….
27
2.10.3 Cloning and Subcloning……….…………………………………….
29
2.10.4 DNA Sequencing…..….…………………………………………….
30
2.10.5 Sequence Alignment………………………………………………..
31
3. MATERIALS AND METHODS
33
3.1 Viruses…………………….…………………………………………………
33
3.1.1 Sample Collection………..……..…………………………………..…
33
3.1.2 Extraction of the Viral DNA……………….…………………………..
33
3.1.3 Amplification of Promoters by PCR…………….………….…………
34
3.1.4 Agarose Gel Electrophoresis…………………………………...…….
37
3.1.5 Purification of DNA…………………………………………………….
37
3.1.6 Purification of PCR Product…………………………………………..
39
3.1.7 Ethanol Precipitation………………….………...……………………..
39
3.1.8 Determination of DNA Concentration and Purity……………….…..
40
3.2 Bacterial hosts and plasmid…………...………………………….……..
41
3.2.1 Media for Bacterial Culture…………………..……………………….
44
3.2.2 Preparation of Bacterial Culture……………………………..…..…..
44
3.3 Plasmid DNA Isolation by Mini Prep….....………………….………….
44
3.4 Cloning…………………….…...……………………………………..…….
46
3.4.1 Restriction Enzyme Digestion………………………………….…….
46
3.4.2 Preparation of Insert and Vector……………………………………..
47
3.4.3 Ligation…………………………………………………………….……
47
3.5 Transformation……………….………………….………………….……..
48
3.5.1 Preparation of Chemically Competent Cells…..……………………
48
3.5.2 Transformation of Plasmid DNA into Competent Cells…….……..
49
III
List of Contents
3.6 Sequencing………………………………………………………….….…..
49
3.7 Sequence Alignment and Bioinformatics……………………………..
50
3.8 Subcloning…………………………………………………………….……
50
4. RESULTS
52
4.1 Sample Collection……….….………………………………………….…
52
4.2 PCR Amplification of Promoters………...………………………………
53
4.3 Cloning…………..……………….…………………………...……………..
56
4.3.1 PCR Confirmation of Cloned Promoter on pJET1.2………………
58
4.3.2 Confirmation of Cloned Insert (Promoter) on pJET1.2 by Restriction Digestion…...…………………………..…………………
60
4.3.3 Sequencing of Cloned Promoter on pJET1.2………….………….
61
4.3.4 Confirmation of Cloned Promoter on pTZ57R by Restriction Digestion………………………………………………………………..
72
4.3.5 PCR Amplification of LacZ gene-HCMV Promoters Cassettes from pTZ57R………………………………..………….………………
77
4.4 Confirmation of tet gene Deletion from pBR322 by Restriction Digestion………….…………………………………………………………
79
4.5 Subcloning of LacZ gene-HCMV Promoters Cassettes on ∆tet pBR322 and its Confirmation by PCR and Restriction Digestion..
83
5. Discussion
87
5.1 Detection Analysis of HCMV by ELISA……..…………………….
87
5.2 DNA Extraction and Amplification..………...…………………….
88
5.3 Sequencing Analysis……………………….……………………….....
89
5.4 Construction of HCMV Promoters Regions on pTZ57R and ∆tet pBR322……….…………………….………………………..............
90
IV
List of Contents
5.5 β-galactosidase Assay.....................................................................
91
Conclusions
94
Recommendations
95
References
96
Abstract Arabic
أ
Abstract Kurdish
ب
V
List of Contents
List of Tables
Table 2-1: Properties of Herpesvirus…………………………………………
4
Table 2-2: Sequenced members of the β-herpesvirus subfamily………….
5
Table 3-1: Primers used in this study…………………………………………
36
Table 4-1: The results of ELISA and PCR…………………………………...
52
Table 4-2: Promoters size and there region on published HCMV…………
53
VI
List of Contents
List of Figures
Figure 2-1:
Structure of CMV virion……………………………………………...
6
Figure 2-2:
Schematic representation of HCMV genomes……………………
8
Figure 2-3:
Genomic arrangement of clinical HCMV strains………………….
9
Figure 2-4:
The human cytomegalovirus major immediate early enhancer and divergent promoters…………………………………………….
21
Figure 2-5:
Model for HCMV entry……………………………………………….
24
Figure 2-6:
HCMV life cycle………………………………………………………
27
Figure 3-1:
Promoters position on schematic HCMV genomes………………
35
Figure 3-2:
Ultrafree -DA filter tube for Purification of DNA from Gel………..
38
Figure 3-3:
NanoDrop spectrophotometer………………………………………
40
Figure 3-4:
Map of the pBR322 vector………………………………………….
41
Figure 3-5:
Map of the pTZ57R vector………………………………………….
42
Figure 3-6:
Map of the pJET1.2 vector…………………………………………
43
Figure 4-1:
Amplified PCR product of MIE region using MIE primer sets…..
54
Figure 4-2:
Amplified PCR products of IE region using IE primer sets………
54
Figure 4-3:
PCR amplification of promoters using specific primer……………
55
Figure 4-4:
Transformed cloning promoter on pJET1.2……………………….
56
Figure 4-5:
Blue – White screening……………………………………………..
57
Figure 4-6:
PCR confirmation of the correct integration of the promoters into the pJET1.2 plasmids…………………………………………..
59
Figure 4-7:
Restriction Digestion by Nco I and Kpn 21 confirm the cloning result on pJET1.2…………………………………………………….
60
VII
List of Contents
Figure 4-8:
Multiple Sequence Alignment between Sequenced MIE promoter with the published HCMV wild type 3301 and 3157 and Lab strain AD169………………………………………………..
62
Figure 4-9:
Multiple Sequence Alignment between Sequenced IE promoter with the published HCMV wild type 3301 and 3157 and Lab strain AD169………………………………………………………….
64
Figure 4-10:
Multiple Sequence Alignment between Sequenced E1 promoter with the published HCMV wild type 3301 and 3157 and Lab strain AD169………………………………………………………….
66
Figure 4-11:
Multiple Sequence Alignment between Sequenced E2 promoter with the published HCMV wild type 3301 and 3157 and Lab strain AD169………………………………………………………….
67
Figure 4-12:
Multiple Sequence Alignment between Sequenced L promoter with the published HCMV wild type 3301 and 3157 and Lab strain AD169………………………………………………………….
68
Figure 4-13:
Multiple Sequence Alignment between Sequenced US promoter with the published HCMV wild type 3301 and 3157 and Lab strain AD169………………………………………………………….
70
Figure 4-14:
Restriction Map of sequenced promoters………….……………..
71
Figure 4-15:
Restriction digestion of pTZ57R by Eco RV………………………
72
Figure 4-16:
Confirmation by single restriction digestion Xba I of the size of promoter on pTZ57R…………………………………………………
73
Figure 4-17:
Cloning confirmation by restriction digestion using Mva 12691 and Pae I………………………………………………………………
74
Figure 4-18:
Cloning confirmation by double restriction digestion…………….
76
Figure 4-19:
PCR amplification of the LacZ gene with promoter regions cassettes………………………………………………………………
78
Figure 4-20:
tet gene deletion from pBR322 vector by PCR and Restriction Digestion using Hind III and Mva12691……………………………
80
Figure 4-21:
Screening of the transformation of pBR322 and ∆tetpBR322 on LB-Agar supplemented by ampicillin and tetracycline……………
81
Figure 4-22:
Confirmation of ∆tet pBR322 by restriction digestion…………….
82
Figure 4-23:
Subcloning confirmation of the LacZ gene on ∆tet pBR322……..
83
VIII
List of Contents
Figure 4-24:
Subcloning confirmation of the LacZ gene - promoter cassette on ∆tet pBR322……………………………………………………….
84
Figure 4-25:
Direction confirmation of the subcloning LacZ gene - promoter cassette on ∆tet pBR322 by double restriction digestion………..
86
IX
List of Abbreviations
LIST OF ABBREVIATIONS
A AD169 AIDS BAC bHLH BLAST BM bp C CAT CCMV cDNA CMV CREB CBP ddH2O dGTP DNA dsDNA E1p E2p EDTA EGFR Egr-1 ELISA F G gB GCV gH gL GM-Ps gO HCMV HF cell hr HSPG IEp IgG IgM IPTG IR ISH kbp kDa Lp L LATs LB M
Adenine Laboratory strain of Cytomegalovirus Acquired Immuno Deficiency Syndrome Bacterial Artificial Chromosome basic Helix-Loop-Helix Basic Local Alignment Search Tool Bone Marrow Base pair Cytosine Chloramphenicol Acetyl Transferase Chimpanzes Cytomegalovirus complementary DNA Cytomegalovirus cAMP Response Element-Binding CREB-binding protein Double distilled water Deoxy Guanosine Tri Phosphate Deoxyribonucleic acid Double strand DNA Early 1 promoter Early 2 promoter Diamine Tetra acetic acid Epidermal Growth Factor Receptor Early growth response factor-1 Enzyme Linked Immunosorbent Assay Forward primer Guanine Glycoprotein B Gancyclovir Glycoprotein H Glycoprotein L Granulocyte Macrophage Progenitors Glycoprotein O Human Cytomegalovirus Hollow Fiber Cell culture hour Heparan Sulphate Proteoglycans Immediate Early promoter Immunoglobulin G Immunoglobulin M Isopropyl β-D-1-thiogalactopyranoside Inverted Repeat In situe hybridization Kilo base pair kilo Dalton late promoter Liter Latency Associated Transcripts Luria Beratni medium Marker
X
List of Abbreviations
MCMV MCS MIEp miRNA mRNA MW NASBA NC NCBI NCS NEB NFκ-B PCR Q-PCR RT-PCR nQC-PCR nt ORF PE R RCMV recDB RhCMV RNA RT SP1 T TBE Tef-1 TR UL USp US UV +ve -ve µl W/V X-Gal β-galactosidase
Murine Cytomegalovirus Multiple Cloning Site Major immediate-early promoter Micro RNA Messenger RNA Molecular Weight Nucleic Acid Sequence Based Amplification Negative Control National Center of Biotechnology information Negative Control Sample New England Biolab nuclear factor kappa-light-chain-enhancer of activated B cells Polymerase Chain Reaction Quantitative-PCR Real Time-PCR Nested Quantitative Competitive-PCR Nucleiotide Open Reading Fram Protein Extraction buffer Reverse primer Rat cytomegalovirus recombinant subviral Dense Bodies Rhesus Cytomegalovirus Ribonucleic acid Reverse Transcriptase a human transcription factor Thiamine Tris Borate EDTA Transcription Enhancer Factor-1 Terminal Repeat Unique Long Unique Short promoter Unique Short Ultra Violet Positive Negative Microliter Weight/Volume 5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside Beta-galactosidase
XI
Introduction
1. INTRODUCTION Human Cytomegalovirus (HCMV) is the vernacular name of human herpes virus 5, a highly host-specific virus of the Herpesviridae family (Mocarski and Courcelle, 2001) in the subfamily Beta Herpesvirinae. HCMV is the largest virus in the family and morphologically indistinguishable from the other human herpes viruses. The virion consists of icosahedral capsid surrounded by tegument or matrix, which is further surrounded by lipid-protein envelop. They are distributed in humans and other mammals, but possess a high degree of host specificity (Haaheim et al., 2002). Human infections may be asymptomatic, or cause severe and generalized disease. HCMV like all other herpes viruses, undergoes latency and reactivation in the host, also infect a broad spectrum cells invivo like human fibroblast which are fully permissive for viral replication (Sinzger et al., 1995). HCMV is a ubiquitous virus, with seroprevalence varying from 40-100% between different countries. Primary infection occurs early during childhood, by transmission through breast-milk or saliva which is usually mild, while when the infection occurs during lifelong it may cause mononucleosis. If the restraint of viral load fails in individuals with a defective or compromised immune system, such as transplant recipients or AIDS patients, HCMV can cause life threatening disease also it is the most common cause of congenital defects (Landolfo et al., 2003). HCMV is a linear double-stranded DNA virus and the size of the genome is approximately 230-235kbp encoding ~ 140-200 proteins. The viral genome is divided into two unique components, Unique Long (UL) and Unique Short (US) regions which are flanked by terminal repeat (TR) and inverted repeat (IR) sequences, UL by TRL and IRL, and US by TRS and IRS, respectively. Protein expression during replication can be divided into immediate early (IE), early (E) and late (L) phases (Mocarski and Courcelle, 2001; Prichard et al., 2001; Varnum et al., 2004; Tomasec et al., 2005; Murphy and Shenk, 2008). 1
Introduction
After virus entry, immediate early (IE) genes are transcribed independently of any viral gene expression. Transcription is mediated by the CMV major immediateearly promoter (MIEp) which is located downstream from a strong enhancer and this promoter utilizes host cell RNA polymerase II (Meier and Stinski, 1996; Stenberg, 1996). E gene transcription region lies in a proximal vicinity to the IE transcription sites, which include DNA polymerase, helicase, primase and the associated proteins required for DNA synthesis (Anders and McCue, 1996; Stenberg and Kerry, 1995). Late gene set which produces viral structure proteins and E gene products activate the promoter of L gene facilitating the expression of these genes (Stenberg and Kerry, 1995).
Aim of the study There is currently a wide epidemic of HCMV infection especially in women and neonates due to the poverty in health education; On the other hand, there are only few studies in the field of virology and particularly in molecular virology in Kurdistan region, thus the aims of the present study are: 1. To compare the -ve results in ELISA with +ve results of the same samples by PCR. 2. Sequencing promoter regions of Human Cytomegalovirus and comparing with the published wild CMV and lab strains. 3. Construction of new vectors by clone and subclone of HCMV promoters insert on high and low copy number vectors, to examine the relative potency of prokaryotic expression vectors in order to express β-galactosidase enzyme under the control of different HCMV promoters. 4. Using the more powerful promoter in DNA vaccine.
2
Literatures Review
2. LITERATURES REVIEW
2.1 The Herpesviridae Cytomegalovirus belongs to the family Herpesviridae comprising more than one hundred viruses. These viruses have some features in common: host restriction, nuclear replication, damage of host cell and latency. Biological criteria, such as host range and growth kinetics, were used to assign the herpes viruses to three different subfamilies α-, β- and γ-herpes viruses. These groupings have proven to accurately reflect the diversity in organization and gene content of herpes virus genomes as well. Herpes viruses that infect mammals populate each of the subfamilies. The members of α-herpesvirinae have some unique features; they have the smallest genome which can infect a wide range of hosts, they have short reproductive cycles, are capable of spreading rapidly in cultures, can efficiently destroy infected cells and can produce latent infections in sensory ganglia (Mocarski and Courcelle, 2001). Viruses belonging to the subfamily β-herpesvirinae have a large genome and a restricted host range. Their reproductive cycles are prolonged, when replication occurs slowly in tissues culture and the infected cells become enlarged (cytomegalia). Cytomegalovirus belongs to this subfamily. The virus is maintained in a latent state in a variety of tissues including secretory glands and kidneys (Murphy and Shenk, 2008). Members of the last subfamily, the γ-herpesvirinae, are also host specific. They replicate in cells of lymphoblastoid origin and sometimes also cause lytic reactions in epithelial and fibroblastic cells. The members of this family have specificity for either T or B lymphocytes (Mocarski and Courcelle, 2001; Streblow et al., 2006; Murphy and Shenk, 2008). Table 2-1 illustrates the properties of the human herpes virus family member.
3
4
8
Kaposi´s sarcoma-associated herpes virus (KSHV)
Human herpes virus-8 (HHV-8)
Human herpes virus-7 (HHV-7)
7
Epstein-Barr virus (EBV)
4
Herpes lymphotropic virus
Varicella Zoster virus (VSV)
3
6
Herpes simplex-2 (HSV-2)
2
Cytomegalovirus (CMV)
Herpes simplex-1 (HSV-1)
1
5
Common name
Human herpes type
Monocytes, lymphocytes and possibly others
T lymphocyte and others
T lymphocyte and others
B lymphocyte, epithelia Epithelia, monocytes, lymphocytes
T lymphocyte and others
T lymphocyte and others
γ-herpesvirinae
β-herpesvirinae
β-herpesvirinae
β-herpesvirinae
Endothelial cells
B lymphocyte
Mucoepithelia
α-herpesvirinae
γ-herpesvirinae
Neurons
Mucoepithelia
α-herpesvirinae
Unknown
Neurons
Neurons
Mucoepithelia
α-herpesvirinae
Site of latency
Target cell type
subfamily
Exchange of body fluids
Unknown
Contact, respiratory route
Contact, blood transfusions, transplantation, congenital
Saliva
Contact or respiratory route
Close contact, usually sexual
Close contact
Mode of transmission
Literatures Review
Table 2-1: Properties of Herpesvirus. (Haaheim et al., 2002; Crough and Khanna, 2009).
Literatures Review
The β-herpesvirus subfamily includes three genera: cytomegaloviruses, muromegalovirus and roseloviruses. Cytomegaloviruses include human (HCMV), chimpanzee (CCMV) and rhesus cytomegalovirus (RHCMV); muromegaloviruses include mouse (MCMV) and rat cytomegalovirus (RCMV); and the more distantly related roseoloviruses include human herpes viruses 6A, 6B and 7 (HHV-6A, HHV-6B and HHV-7) (Table 2-2). The genome size of this subfamily ranged from ~ 241kbp for CCMV to ~145kbp for the HHV-7 roseolovirus; the HCMV genome is approximately 235kbp (Sinzger et al., 1995; Landolfo et al., 2003; Pellet and Roizman, 2006; Murphy and Shenk, 2008). Table 2-2: Sequenced members of the β-herpesvirus subfamily. The table by Murphy and Shenk (2008) and the type of genome sequence arrangement by (Pellet and Roizman, 2006). Virus
Genus
Genome
Gene bank
type/size (kbp)
accession number
Viruses of humans Human herpes virus-5
cytomegalovirus
~235
AD169:X17403 AC146999
(human cytomegalovirus)
Towne:AC146851 Towne:AY315197 Toledo:AC146904 Merlin:AY446894
Human herpes virus-6A
Roselovirus
~165
X83413
Human herpes virus-6B
Roselovirus
~165
AB021506 AF157706
Human herpes virus-7
Roselovirus
~145
AF037218 U43400
Viruses of nonhuman particles Chimpanzee cytomegalovirus
Cytomegalovirus
~241
AF480884
Rhesus cytomegalovirus
Cytomegalovirus
~221
AY186194 DQ120516
Tree shrew herpesvirus
Unassigned
~196
AF281817
Mouse cytomegalovirus
Muromegalovirus
~235
U68229
Rat cytomegalovirus
Muromegalovirus
~230
AF232689
Viruses of rodents
5
Literatures Review
2.2 Human Cytomegalovirus (HCMV) The general characteristics of the CMV virion can be summarized as follows. The HCMV virion is approximately 230nm in diameter and is composed of nucleocapsid, surrounded by a less structural tegument layer, and bounded by a trilaminate membrane envelope (Figure 2-1). The HCMV genome composed of a linear, double stranded DNA molecules (235kbp in wild type virus), and the largest among the human herpes viruses (Gibson, 1996, 2006; Eickmann et al., 2006; Murphy and Shenk, 2008). The icosahedral capsid is about 110nm in diameter, and composed of four integral protein species pUL46, pUL80.5, pUL85, pUL140 that are organized into 162 capsomer (150 hexamers plus 12 pentamers) and 230 triplexes are located between capsomers (Chan et al., 2002; Loveland et al., 2007). The tegument region is approximately 50nm thick and includes seven relatively abundant virus-encoded protein species which are phosphorylated. The virion envelop is about 10nm thick and contains at least ten abundant protein species. Both the tegument and envelop contain additional less abundant virus-encoded and host-cell proteins, as well as phospholipids, polyamines, and small RNAs (Kalejta, 2008). A
B
Figure 2-1: Structure of CMV virion. A: schematic structure of CMV from Brennan, 2001. B: Particles in cytoplasm of CMV- infected cells which show by electron micrograph, the virion with DNA, capsid, tegument, and envelop indicated by arrows (Gibson, 2008).
6
Literatures Review
2.3 Genome Organization of HCMV 2.3.1 Genome Content of HCMV: The herpes viruse genomes are linear when isolated from the virions, also HCMV genome like β-herpesviruse contains unpaired base at each end (Tamashiro and Spectro, 1986) which facilitates circularization of the genome at the start of the next round of infection (Murphy and Shenk, 2008). Human cytomegalovirus is isolate routinely in different laboratories and several strains such as AD169, Towne and Toledo have been propagated in tissue culture for several generations (Mocarski and Courcelle, 2001). These HCMV strains have 90-95% similarities in their genome organization. The genome size was approximately 230-235 Kbp (Chee et al., 1990; Murphy and Shenk, 2008) and consisted of a total of 208 ORFs, some of which may produce spliced products. At the same time, they also suggested that some ORFs might not actually encode proteins. Davison and colleagues (2003) refined this analysis and recognized 164-167 ORFs and G+C content 57.2% in the genome of HCMV. HCMV has a linear, double stranded DNA. It has two covalently linked unique segments, one long (UL) and the other short (US). Each of the unique regions is flanked by inverted repeats (TRL and IRL, TRS and IRS) (Mocarski and Courcelle, 2001) (Figure 2-2). The UL region is 166,972bp in size and contains 132 ORFs while, in the US region, there are 36 ORFs of 35,418bp in size. The terminal repeat long (TRL) resides at the 5’ end of the UL region and at its 3’ end, the inverted repeat long (IRL), collectively known as repeat long (RL) of 11,247bp containing 14 ORFs. The inverted repeat short (IRS) region and the terminal repeat short (TRS) are together designated as repeat short (RS) of 2,524bp with one ORF in the orientation opposite to the terminal long in the ends. “a” sequence of 578bp is found at both termini of the genome which is the part of RL and RS (Chee et al., 1990; Bale et al., 2001).
7
Literatures Review
IRL 1-11247
UL
TRL IRS
11248-179150
179151- 189821190398 192444
US
TRS
192444-227764
227765230288
HCMV Figure 2-2: Schematic representation of HCMV genomes. Abbreviations: IRL, Inverted Repeat Long; UL, Unique sequence Long; TRL, Terminal Repeat Long; IRS, Inverted Repeat Short; US, Unique sequence Short; TRS, Terminal Repeat Short, and HCMV, Human Cytomegalovirus (Mocarski and Courcelle, 2001).
Murphy and colleagues (2003) sequenced two HCMV laboratory strains (AD169 and Towne) and four HCMV clinical isolates (Toledo, FIX, PH and TR) and identified a total of 252 ORFs with potential to encode proteins that are conserved in all four clinical isolates. Dolan and colleagues (2004) sequenced the 235,645 bp genome of a low passage strain (Merlin). Comparative analyses with the published genome sequence of a high passage strain (AD169) showed that Merlin accurately reflects the wild-type complement of 165 genes. A master map was generated containing all ORFs that were conserved in all five clinical isolates (Figure 2-3). It contains a total of 232 potentially functional ORFs. Color-coding is used to distinguish ORFs that are known to be essential (red), augmenting, i.e., are required for an optimal yield (yellow), or nonessential for replication in fibroblasts (green) (Dunn et al., 2003; Yu et al., 2003). The 15 gray ORFs have not been tested for a role in replication. The 173 red, yellow, green and gray ORFs are present in all five HCMV genomes and the CCMV genome. The 59 ORFs shown in white are present in the five clinical isolates, but are not found in the CCMV genome. Finally, 20 microRNAs (miRNAs), predicted to be encoded by HCMV (Dunn et al., 2005; Grey et al., 2005; Pfeffer et al., 2005), are identified as orange pins, which in a recent study by Grey (2007 )indicates regulate multiple viral gene.
8
Literatures Review
Figure 2-3: Genomic arrangement of clinical HCMV strains. HCMV ORFs that are conserved in the five sequenced HCMV strains (FIX, Ph, TR, Toledo and Merlin) are arranged in the conventional HCMV map organization. ORFs are represented as arrows demonstrating the relative orientation of ORFs; and, where applicable, black carat symbols connect exons. In several cases, e.g., UL37, UL122 and UL123, numerous spliced variants are known, but only one abundant variant is shown on the map. The color codes designate ORFs that are essential (red arrows), augmenting (yellow arrows) or nonessential (green arrows) for replication within cultured fibroblasts. Gray arrows represent ORFs that are not yet been tested for function. Red, yellow, green and gray ORFs are conserved in CCMV; white ORFs are not conserved in CCMV. ORFs with an asterisk do not contain an AUG ≥ 80 codons from a stop codon. The three blue boxes represent the repeat sequences found at the ends of the unique long and unique short regions. The orange pins designate the location of virus-coded miRNAs. Their placement above or below the sequence line designates the strand on which they are encoded. Each tick mark on the black sequence line represents 1 kb of DNA. Figure from Murphy and Shenk 2008.
9
Literatures Review
2.3.2 Promoters of HCMV: A promoter is a region of DNA that facilitates the transcription of a particular gene. Promoters are typically located near the genes they regulate, on the same strand and upstream (towards the 5' region of the sense strand). Eukaryotic promoters are extremely diverse and are difficult to characterize. They typically lie upstream of the gene and can have regulatory elements several kilobases away from the transcriptional start site (enhancers). The transcriptional complex can cause the DNA to bend back on itself, which allows for placement of regulatory sequences far from the actual site of transcription. Many eukaryotic promoters, between 10 and 20% of all genes, contain a TATA box (sequence TATAAA), which in turn binds a TATA binding protein which assists in the formation of the RNA polymerase transcriptional complex (Gershenzon and Ioshikhes, 2005). The TATA box typically lies very close to the transcriptional start site (often within 50 bases) (Smale and Kadonaga, 2003). Eukaryotic promoter regulatory sequences typically bind proteins called transcription factors which are involved in the formation of the transcriptional complex. An example is the E-box (sequence CACGTG), which binds transcription factors in the basic-helix-loop-helix (bHLH) family (Levine and Tjian 2003). The HCMV promoter is defined as one of the strongest mammalian promoters in nonpermissive, undifferentiated cells (Makrides, 1999; Reeves et al., 2005; Liu et al., 2006; Ioudinkova et al., 2006; Yee et al., 2007) which is considered as a powerful tool to investigate the complex mechanisms of regulating gene silencing and for identifying new anticancer drugs (Grassi et al., 2003); One of these promoters is Major Immediate early (MIE) which co-regulates expression of downstream genes by using viral and cellular specific factors via a specific pathway (Jie et al., 2007). Figure (2-4) demonstrates that there are multiple different binding sites for eukaryotic transcription factors in the HCMV genome and some sites are repeated multiple times. The multiple elements work together to promote transcription from the MIE promoter. It is possible
10
Literatures Review
that in the presence of other binding sites of the multiple transcription factors on the entire enhancer, deletion of one type of site has little effect on the replication in HF cell culture. The other sites compensate for the loss or virion-associated glycoproteins like gB and gH or tegument proteins like pp71 facilitate a strong activation of the MIE promoter in HF cells (Stiniski and Isomura, 2008). The activity of this promoter depends on a series of 17, 18, 19 and 21bp with imperfect repeats containing NFκ-B elements within its major immediate early promoter prior to virus entry would prime the cell for viral replication (DeMeritt et al., 2004). There is also a late promoter in exon 5 that is activated after viral DNA synthesis. The viral protein (IE86) transactivates early viral promoters by interacting with cellular basal transcription machinery and requires a TATA box-containing promoter to transactivate downstream transcription (Lukac et al., 1994) while other viral protein (IE72) augments the activity of the IE86 protein by inhibiting histone deacetylase activity (Tang and Maul 2003; Nevels et al., 2004). Other cellular transcription factors and chromatin remodeling proteins also interact and contribute to the activity of the IE86 protein such as CREB, SP1, Tef-1, Egr-1, p300/CBP, and P/CAF (Lukac et al., 1994; Sommer et al., 1994; Lang et al., 1995; Scully et al., 1995; Schwartz et al., 1996; Yoo et al., 1996; Bryant et al., 2000). Also IE2 60 and IE2 40 contribute to regulate the major IE promoter (White et al., 2007). Isomura and his colleagues (2005) indicate that SP1 and SP3 binding sites have a significant role in HCMV replication in human fibroblast cells. Grassi and his colleagues (2003) found that trichostatin A and 5´-aza-2´-deoxycytidine results in reactivation of the CMV promoter by affecting DNA methylation and histone acetylation which enhance the expression of many cellular genes to act on the reactivation of CMV promoter. The MIE promoter region of HCMV has a cis-acting element that serves as a binding site for the IE86 protein or the late L40 protein. Point mutations in histidine residues 446 and 452 abolish DNA binding by glycoprotein (Macias and Stinski 1993; Macias et al., 1996).
11
Literatures Review
.
Figure 2-4: The human cytomegalovirus major immediate early enhancer and divergent promoters. The viral genes and promoter/transcription start sites are designated by an arrow. The enhancer has two components that are proximal and distal. Between the distal enhancer and the UL127 promoter is a unique region that binds transcriptional repressor proteins. Downstream of the UL127 promoter is a region referred to as the modulator. The transcription factor binding sites are designated (Stiniski and Isomura, 2008).
2.4 Replication of HCMV When HCMV infects a cell, the viral capsid is transported to the nucleus, where the viral DNA is released and transcribed by the host cell machinery (Figure 2-6) (Huang and Johnson, 2000). It was commonly believed that all the newly synthesized viral proteins were encoded by the viral DNA genome (Roizman, 2000). The human cytomegalovirus´s major immediate early gene is one of the important genes for viral replication by controlling and inhibiting cellular function including cellular transcription, apoptosis, immune response, and cell cycle (Stenberg, 1996; Petrike et al., 2006). However, Bresnahan and Shenk (2000) demonstrated that in addition to viral DNA, HCMV virus particles also carry mRNAs into the host cell. Using gene array technology, they identified four virally encoded mRNAs that are present in highly purified HCMV virions. These mRNAs are delivered to the cell cytoplasm when the viral envelope fuses with the plasma membrane at the start of infection. The four mRNAs remain in the cytoplasm, where they are translated into proteins in the absence of gene products encoded by viral DNA. One of the mRNAs, UL21.5, encodes a protein that contains a leader sequence localizing it to the Golgi network, but the function(s) of the mRNAs or their products is unknown (Huang and Johnson, 2000).
12
Literatures Review
2.4.1 Entry: The ability of a virus to enter a host cell and deliver its genome for replication represents the essential first step in the replication cycle of the virus. HCMV like most herpesviruses, enters cells via direct fusion of the viral envelope with the plasma membrane at neutral pH (Compton et al., 1992). However, in specific cell lines such as retinal pigment epithelial and endothelial cells, HCMV enters by receptor-mediated endocytosis, requiring low-pH (Bodaghi et al., 1999; Ryckman et al., 2006). Multiple receptors and ubiquitous molecules on the cell surface allow recognition and entrance of HCMV into the host. It utilizes several cellular and viral proteins for entry into such a wide range of cells. Regardless, the HCMV entry process is highly complex, requiring multiple envelope glycoproteins, which interacts with a series of cellular receptors so it is predicted to encode over 50 glycoproteins (Varnum et al., 2004); however, only five glycoproteins are essential for virus replication in vitro. A model for HCMV entry (Figure 2-5) illustrates that HCMV infection begins with low affinity tethering to heparan sulphate proteoglycans (HSPGs) (Compton et al., 1993). Two viral glycoprotein complexes, the heterodimer gM/gN (UL100/UL73) and the gB (UL55) homodimer of the virion have heparan binding ability (Kari and Gehrz 1992; Compton et al., 1993; Mach et al., 2000; Varnum et al., 2004). This then leads to firm docking to epidermal growth factor receptors via gB (Wang et al., 2003). However, susceptible hematopoietic cells lack epidermal growth factor receptor (EGFR) s, which argues for the existence of other HCMV receptors. Cellular integrins also interact with gB (Compton, 2004). Eventually the virus envelope fuses with the plasma membrane thus enabling the deposition of viral components in the cytoplasm. Membrane fusion requires the hetero trimeric envelope glycoprotein complex, gH/gL (UL75/UL115) both are complex with gO (UL74) and forming gH/gL/gO complex (Keay and Baldwin 1991; Huber and Compton 1997, 1998).
13
Literatures Review
Figure 2-5: Model for HCMV entry. Initial attachment of HCMV in tethering interactions to heparan sulphate proteoglycans (HSPGs) through gM/gN and/or gB glycoproteins. A stable docking step allows gB to cooperate with the epidermal growth factor receptor (EGFR) in HCMV permissive cell types and other receptors in hematopoietic cells. HCMV envelope glycoproteins and cellular integrins allow receptor clustering and thereby activate fusion facilitating internalisation of virion components (Compton, 2004). Abbreviations: HCMV, Human cytomegalovirus and TLRs, Toll-like receptors.
2.4.2 CMV Gene Expression and Regulation: Nucleocapsids released into the cytoplasm following membrane fusion are probably transported to the nucleus along microtubules to dock with the nuclear pore (Greber and Way, 2006). DNA then enters the cell through nuclear pores and is transcribed. CMV genes are grouped into three families as they are temporally regulated and transcribed at immediate early (IE, α), early (E, β) or late (L, γ) times post infection (Mocarski and Courcelle, 2001). IE gene expression is independent of denovo protein synthesis, i.e. after the host cell was infected; they are transcribed within 0-4 hours in the presence of protein synthesis inhibitors such as cycloheximide. When the virus enters the host cell (Figure 2-6), some viral tegument proteins are delivered along with the DNA to the nucleus and one is required to bind to host transcription factors required for IE gene expression. Expression of IE genes is required for E gene transcription. This latter phase occurs between 4-24 hours post
14
Literatures Review
infection. L genes are transcribed 12-48 hours post infection. The latter L genes can be further divided into early late (E-L or γ1) or true late (L or γ2), the latter being viral DNA synthesis dependent. E-L transcription is enhanced during the late stages of infection. True L gene expression takes place only after the onset of viral DNA synthesis (Chambers et al., 1999). 2.4.2.1 Immediate Early Gene Expression: IE genes are transcribed by the host cell machinery, immediately after entry of linearized double stranded viral DNA into the cell nucleus and they are independent of any viral gene expression. Transcription is mediated by the CMV major immediateearly promoter (MIEp) utilizing host cell RNA polymerase II and the basal cellular transcription machinery. The MIEp is located downstream from a strong enhancer located between ~-50 and -550bp relative to the transcription start site. Host nuclear transcription factors bind at multiple binding sites on the enhancer and these 16-, 18-, 19- and 21-bp repeats (figure 2-4) play a central role in the regulation of expression. Two genetic elements designated IE1 and IE2 are under the control of the single MIEp. From these regions, at least three IE-RNA transcripts are produced. A single open reading frame (ORF) designated as UL123 initiating in exon 2 and continuing through exons 3 and 4, comprises the IE-RNA transcript, that ultimately encodes IE1 p72 (a phosphoprotein, MW 72 kDa). Two RNA transcripts of 2.25 and 1.7-kb are encoded by IE2. These transcripts are generated through differential splicing mechanisms in the IE2 region. Hence, three exons of IE1 are fused to IE2 region. The 1.7-kb mRNA encodes a 55-kDa protein while the other transcript encodes the 86-kDa (UL-122) protein. IE1 p72 acts as a transactivator of MIEp whereas IE2 p86 acts as a repressor to control expression from the MIEp. However, IE1 and IE2 are transcription factors for E gene promoters (Meier and Stinski, 1996; Stenberg, 1996).
15
Literatures Review
2.4.2.2 Early Gene Expression: As described above, the products of IE genes, including IE1 and IE2, transactivate E promoters. During early gene expression, the machinery required for DNA replication is formed. These include the DNA polymerase (UL 54), helicase (UL 105), primase (UL70) and the associated proteins required for DNA synthesis (Anders and McCue, 1996). E genes are transcribed from all along the CMV genome. The E gene transcription region (UL112-113) lays in proximal vicinity to the IE transcription sites. UL112-113 encodes a family of alternatively spliced RNAs that produce a series of related phosphoproteins (Stenberg and Kerry, 1995). Products of both immediate early and early genes are responsible for the initiation of expression of the late gene set (γ1+ γ2) which ultimately produces viral structural proteins. 2.4.2.3 Late Gene Expression: The final phase of gene expression, designated late (L), begins with the onset of virion DNA replication. It is also accompanied by the synthesis of structural proteins and other proteins responsible for the packaging of the replicated viral DNA genome. E gene products activate the promoters of L genes facilitating the expression of these genes. E gene products are responsible for viral DNA replication but the L proteins are involved in the formation of mature virus particles. Some genes are designated as γ1 because these genes are transcribed initially during or before DNA synthesis and are not true L genes. All the true L genes belong to the subset γ2. Some E genes, such as UL4 is expressed in both E and L phases of the virus replication cycle (Sweet, 1999).
16
Literatures Review
Figure 2-6: HCMV life cycle. For efficient viral replication HCMV must maintain cellular viability by avoiding the host immune system and innate defense mechanisms such as apoptosis, by manipulating both viral and cellular responses through noncoding RNAs. Expression of the microRNA (miR) UL112-1 reduces the expression of major histocompatibility complex class I–related chain B (MICB), providing protection against attack by natural killer cells, and it attenuates acute replication by targeting the mRNA encoding the viral transactivator protein, immediate early 72 (IE72). The β2.7 noncoding RNA blocks apoptosis by stabilizing the mitochondrial respiratory-chain complex I. AAA denotes the polyadenylation sequence (Nelson, 2007).
2.4.3 DNA Replication and Packaging: DNA replication occurs and the progeny virus particles are assembled in the late phase. HCMV DNA replication requires six herpesvirus-conserved replication-fork proteins; the DNA polymerase (UL54), a single stranded binding protein (UL57), polymerase accessory protein (UL44), and three subunit helicase-primase complex (UL70, UL102, UL105) (Mocarski and Courcelle, 2001). The products of additional CMV genes (UL84, UL112, UL113, UL114) are also required for optimal replication (Anders and McCue, 1996; Prichard et al., 1996; Sarisky and Hayward, 1996) also IE2
17
Literatures Review
86 proteins are essential for viral replication and two other proteins IE2 60 and IE2 40 which are present in the terminal half of IE2 86 are important for later stages of the infection (Sanders et al., 2008). The unique replication origin (oriLyt) initiates binding of the replication complex and rolling cycle mechanism is followed for DNA synthesis. In the nucleus of permissive cells the HCMV genome circularizes and replication generates concatemers late in infection. Most replicating viral DNA lacks terminal fragments although they are larger than genome length. Short conserved sequence elements at the genome termini, pac1 and pac2, direct the signal for the cleavage of the concatemers into unit length genomes and packaging of the CMV genome. The packaging proteins bind to pac2 sequences and direct the entrance of cleaved viral genomes into the capsid (McVoy et al., 2000). In HSV-1, the viral genome is packaged into the capsid through a capsid protein encoded by UL6, called the vertex portal protein (Newcomb et al., 2001). CMV employs a similar type of mechanism which is also conserved in bacteriophages. The homologous internal repeat in the HCMV genome permits US and UL regions to invert with respect to each other and therefore DNA is packaged into virions (Figure 2-6). After a unit length, linear DNA genome is packaged; mature nucleocapsids accumulate in the nucleus and gather at the inner nuclear membrane prior to budding into the perinuclear space. They also acquire matrix proteins and an envelope in the process.
2.4.4 Egress of Viral Progeny: Enveloped capsids in the perinuclear space fuse with the outer nuclear membrane and the bare nucleocapsid is released into the cytoplasm (Figure 2-6). The nucleocapsid again acquires both the matrix proteins and an envelope by budding into the Golgi. It is then transported inside a vesicle towards the cell membrane where the vesicle membrane fuses with cell membrane and the virion is released (Johnson and Spear, 1982). Thus, it is predicted that the Golgi contributes towards the viral glycoproteins and matrix proteins are acquired in the cytoplasm.
18
Literatures Review
2.5 Transmission of HCMV HCMV is a ubiquitous virus which infects all ages. The early acquisition of the virus is associated with the socioeconomic circumstances, developing countries and countries with crowded population (Ho, 1990). Transmission occurs in most cases vertically – perinatally from mother to fetus (in the birth canal) or new born (after birth) or congenitally the infection detected within the first few months of pregnancy, and transmitted transplacentally or with in the uterus (Yan et al., 2008). Also it can transmit horizontally from one person to another after infection, the virus spreads through most secretions particularly saliva, vaginal secretions, semen and also in urine. Because of that, the virus found in highest level in the semen, so it is also transmitted sexually (Sandrine et al., 2009). Again it can be spread to patients who have blood transfusions or by organ and bone marrow transplantations (Dalen, 2002). New results showing that the risk of HCMV via bone marrow (BM) progenitor cells is higher than transmission by umbilical cord blood (UCB) cells (Behzad-Behbahani et al., 2008). In seropositive mothers for CMV, the virus may be transmitted to infant via breast milk (Numazaki, 2005) by rates of 6-76%. Reinfection with a different strain of CMV can lead to intra uterine transmission and symptomatic congenital infection (Boppana et al., 2001; Vander Strate et al., 2001) and the risk of the CMV did not decrease by freeze-thawing of the breast milk (Maschmann et al., 2006).
2.6 Pathogenesis and Infection of HCMV Little is known about the mechanisms underlying the pathogenicity of the virus, while in some studies by the analysis of HCMV nucleotides, it is indicated that many viral genes (about 60 genes) are non-essential for replication in vitro which are thus assumed to important in the pathogenesis of the virus (Sweet, 1999). Pathogenesis of CMV infection is directly related to the condition of the immune system of the host. Reeves and his colleagues (2007) found that early in infection the virus encodes a highly abundant 2.7-kb RNA transcript (β2.7) which is associated with mitochondria to 19
Literatures Review
prevent cell apoptosis. Both primary infection and reactivation from latency play important roles in pathogenesis. Innate and adaptive immune systems control the typical primary infection of this virus but the latent infection is maintained for life. The systemic phase of primary infection in adults occurs with persistent viral release in urine, saliva, breast milk, and genital secretions, which may be the key basis for spread between hosts (Plachter et al., 1996). Viremia lasts for a long period of time after an adaptive immune reaction which can be first detected (Revello et al., 1998). The lack of immunity in infants allows a relatively long period of persistence and continual virus secretion over this period which ensures efficient transmission to uninfected individuals (Mocarski and Courcelle, 2001). Transplantation of solid organs or bone marrow and transfusion of whole blood also aid transmission of CMV. In healthy seropositive individuals, latent infection arises from bone marrow (Mocarski and Courcelle, 2001). HCMV can infect a wide range of tissues (Pass, 2001) which also can infect vascular wall and play a role in the development of atherosclerosis (Zhu et al., 1999; Froberg et al., 2001) with the aid of Chlamydia pneumonia (Wanishsawad et al., 2000). The presence of specific antibodies to CMV correlates with increasing age and with sexual promiscuity (Robain et al., 1998). Therefore, elderly people are more likely to be CMV seropositve than younger individuals, while sex workers and those who are in immediate contact with small children also have high risk of infection with HCMV (Stagno et al., 1986; Pass, 2001). HCMV infection of immunocompetent hosts is asymptomatic; with very few infected individuals exhibit symptoms and then of a nonspecific nature. Mononucleosis, malaise, headache, fatigue, lymphadenopathy, pharyngitis, splenomegaly, fever and hepatomegaly are the clinical signs and symptoms seen in symptomatic individuals (Pass, 2001; Britt, 2006). While in these patients, HCMV has the risk of reactivating if they are seropositive or can be infected from an exogenous source if they are seropositive or seronegative. Specifically, immunosuppression is required in solid organ or bone marrow transplantation for the
20
Literatures Review
survival of the graft, and here viral infection can cause death (Pass, 2001). In immune compromised AIDS patients or immunosuppressed transplant patients, reactivation leads to uncontrolled HCMV replication and often results in high levels of mortality and morbidity. Thus, reactivation of latent HCMV constitutes a very severe clinical problem (Sinclair and Sissons, 2006). It has also been found in organ transplant patients that reactivation occurs from the transplant recipient’s own latent HCMV rather than virus transmitted from donor (Smyth et al., 1991). During a primary infection of the pregnant woman, HCMV can spread via the placenta to the fetus resulting in congenital abnormalities, which includes microcephaly, rash, jaundice, brain calcification and hepato-splenomegaly (Britt, 2006). This may lead to unilateral or bilateral hearing loss and mental retardation (Li et al., 2008). In latently infected pregnant females, reactivation of the virus in the cervix produces less severe symptoms in the infected fetus and congenital abnormalities are generally absent. The infant remains asymptomatic when infected perinatally or after birth through the process of lactation (Pass, 2001).
2.7 Latency and Reactivation HCMV persists as a lifelong infection in the normal human host without any noticeable clinical symptoms and is maintained in the absence of detectable infectious virus. Thus, it establishes a latent infection (Sinclair and Sissons, 2006). It is still unclear how the virus remains in some cells without producing any further virus particles. Virus can reactivate in these cells upon certain external stimuli and produce new viral progeny to infect new cells (Mocarski and Courcelle, 2001) and associated with prolonged hospitalization or death especially in immunocompetent patients (Limaye et al., 2008). The sites and mechanisms of HCMV latency are still poorly defined. Peripheral blood monocytes have been suggested as one site of latency in humans (Mendelson et al., 1996) but IE gene expression was absent. In a study, it was found that granulocyte-macrophage progenitors (GM-Ps), progenitors of monocytes,
21
Literatures Review
granulocytes, and dendritic cells, expressed latency-associated transcripts (LATs), whereas mature macrophages, granulocytes, T cells, and B cells lack evidence of these transcripts (Hahn et al., 1998). Again it was found that arterial endothelial cells harbor latently infected HCMV apart from the role of HCMV in governing the pathogenesis of atherosclerosis (Hendrix et al., 1991). During CMV replication in undifferentiated or unstimulated cells in vitro, if the major promoter of IE region is induced by host or viral transcription factors, productive infection will develop. So it was inferred by the investigators that reactivation was the predicted outcome of IE gene expression (Minagawa et al., 1994). However, most latently infected cells express IE RNA and their protein products insufficiently. When reactivation is perturbed, IE gene expression may be up-regulated enabling production of some E gene products. Therefore, threshold levels of E RNAs accumulate in some cells, permitting DNA replication and L gene expression. During lytic infection, virion associated proteins, such as the upper matrix protein (ppUL82), interact with host DNA binding proteins and initiate transcription from the MIEp. It is evident that these proteins are not available to carry out this function in latently infected cells. Two other factors may control virus reactivation: chromation remodelling and CD8+ cells coupled with virus immune which evasion mean that cytomegaloviruses express gene products that help to evade immune recognition and these may play an important role in virus reactivation. Silencing/desilencing of expression takes places by chromatin opening which leads to reactivation of viral transcription (Simon et al., 2006). Also HCMV reactivated during lactation in the breast feed mother and enhance transmission of the virus to preterm infants (Meier et al., 2005).
2.8 Treatment of HCMV Nucleoside analogues have been used over the years to inhibit viral infections. These nucleoside analogues target viral DNA polymerases or reverse transcriptases in host cells. One nucleoside analogue, ganciclovir (GCV), an acyclic nucleoside
22
Literatures Review
analogue of 2’-deoxyguanosine, is used for the treatment of HCMV. It is converted into ganciclovir triphosphate, its active form, by both viral and cellular enzymes. CMV UL97 encodes a protein kinase which catalyzes the initial phosphorylation of ganciclovir, the other two phosphates are added by host enzymes (Sullivan et al., 1992). The triphosphate competes with dGTP and inhibits DNA synthesis by the UL54 encoded viral DNA polymerase. While in a study, it appears that the ganciclovir prophylaxis does not prevent CMV viremia (Gutiérrez et al., 1998) and recurrence appeared in many cases (Loginov, 2007). Other antiviral drugs e.g. valganciclovir, foscarnet, cidofovir, acyclovir, fomivirsen, have also been used for the treatment of CMV (Biron, 2006). Their mode of action is more or less similar encompassing the inhibition of viral DNA synthesis. HCMV resistance to antiviral drugs is presently recognized as an emerging problem (Baldanti and Gerna, 2003). So, careful virological monitoring of HCMV infection and response to treatment, the use of rapid phenotypic screening assays for drug susceptibility testing and molecular techniques for the detection of specific genetic mutations, and the application of confirmatory drug susceptibility assays on viral isolates were obtained during virological follow-up. This still appears to be the best approach for the timely detection of drug-resistant HCMV strains in the clinical setting. A number of approaches have been taken to develop a suitable vaccine to prevent CMV infection. The attenuated Towne strain was used as a vaccine in both healthy immunocompetent and CMV positive and CMV negative renal transplant patients. In CMV positive patients, a virus-specific cellular immunity was present for over ten years post immunization (Plotkin et al., 1991) but in the latter case, i.e. CMV negative recipients, the attenuated virus was unable to induce an immune response capable of preventing re-infection but it did show some decrease in severity of infection (Plotkin, 2001). This disappointing finding led to the development of a recombinant subunit vaccine. Naturally infected patients produce a neutralizing antibody response to glycoprotein B (gB). Thus, incorporation of this glycoprotein into a baculovirus and its
23
Literatures Review
subsequent expression in chinese hamster ovary cell lines enabled it to be a potential candidate for a subunit vaccine (Khanna and Diamond, 2006). Another approach utilized a canarypox virus recombinant expressing gB. This has shown promise in that an antibody response to gB and neutralizing antibodies were induced by this vaccine in humans (Gonczol et al., 1995; Pass et al., 2009). Similarly, DNA plasmids expressing CMV genes (gB, pp65) have shown excellent results in mouse models (Pande et al., 1995; Go and Pollard, 2008). While a review by Scholz and his colleagues (2001) showed the possibility to develop novel treatment strategies directed HCMV-IE expression. Also another strategy which is claimed by Mersseman and his colleagues (2008) is to use recombinant subviral dense bodies (recDB) instead of vaccine.
2.9 Laboratory Diagnosis of HCMV Different laboratory methods based on either serology or identification of virus/virus components in clinical specimens are now available. Historically HCMV infection has been detected by cytomegalic inclusion bodies in tissue specimens. The positive results correlate well with active HCMV infection of the organ, e.g. hepatitis, but the sensitivity of the histopathological finding is relatively low (Colina et al., 1995; Mattes et al., 2000). The sensitivity of the histological examination has been enhanced by using immune staining or in situ hybridization (ISH) (Barkholt et al., 1994; Colina et al., 1995; Einsele et al., 1989; Espy et al., 1991; Musiani et al., 1996; Paya et al., 1990). However, they are not suitable for the early diagnosis of HCMV infection. Humoral response to primary HCMV infection is manifested by the production of IgG and IgM antibodies. Thus a diagnosis of HCMV infection can be obtained indirectly through serology. A variety of laboratory tests with different degrees of sensitivity have been described for the measurement of HCMV antibodies in human sera. The methods include
complement
fixation,
indirect
hemagglutination,
latex
agglutination,
radioimmunoassay, immunofluorescence and enzyme immunoassay (Mendez et al., 1998; Sia and Patel, 2000). The serology test have not enhanced detection of early
24
Literatures Review
infection because there is a time lag between primary infection and IgM antibody production (IgM level can remain undetectable because of delayed seroconversion owing to immune supressive agents), and IgM antibodies can also persist for a long time after infection in some healthy individuals. The results of the serological tests can also be confused by blood transfusions and/or antibody based therapy. The infectious HCMV virus can be isolated from various clinical samples by using conventional tube cell culture or more rapid shell vial culture methods (Mendez et al., 1998). In viral isolation methods, commonly used in earlier times, determination of viral replication is based on typical cytopathic effects (CPE) produced by HCMV. The time required for the development of CPE usually varies from 2 to 4 weeks, even up to six weeks (Mendez et al., 1998; Sia and Patel, 2000). These methods are time-consuming and cumbersome, and their sensitivity is relatively low, since the late 1980’s, the pp65 antigenemia test has been the most common method for the diagnosis of HCMV infection (Van der Bij et al., 1988; Landry and Ferguson, 1993; Van den Berg et al., 1998). Because of its quantitative nature, it has been prove that the clinical utility, not only in the diagnosis of HCMV infection, but also in guiding pre-emptive therapy, as well as in monitoring the response to antiviral treatment is influential (Baldanti et al., 1998; Van den Berg et al., 1998; Grossi et al., 1996; Kusne et al., 1999; Kim et al., 2003). One disadvantage of antigenemia assay is that the blood samples should be processed within a certain time, preferably within six hours, for optimal results (Boeckh et al., 1994; Schafer et al., 1997). In addition, though there have been attempts to simplify the method (Gratacap-Cavallier et al., 2003; Ho et al., 1998), it is still quite time-consuming and laborious, at least with large specimen numbers. However, in recent years, the tendency has been towards the replacement of the antigenemia assay with PCR methods, especially with quantitative modifications of PCR, and most specific detection by Real-Time PCR (RT-PCR) of blood, dried blood spot and feces (Mengelle et al., 2003; Ducroux et al., 2008; Soetens et al., 2008) also
25
Literatures Review
with other nucleic acid amplification techniques. The most frequently used methods are based on PCR detecting HCMV DNA (or RNA) in whole blood or in different blood compartments (Boeck et al., 2004) and from feces (Boom et al., 2000). Plasma viral load by PCR is a useful test for predicting CMV disease (Humar, 1999) and enhanced sensitivity for detecting low copy number samples (Pang et al., 2009). Also other nucleic acid-based techniques, such as nucleic acid sequence based amplification (NASBA) and signal amplification (Hybrid Capture System) have successfully been used in the detection of viral mRNA or DNA, respectively (Blok et al., 1998). In those patients who have culture-negative diarrhea that fails to settle and are suspected of HCMV-colitis, the diagnosis by biopsy and colonoscopy is the recommended protocol for detection (Lin et al., 2005; Lockwood et al., 2006).
2.10 Molecular Methods 2.10.1 Genome Extraction: Combining sensitive detection and quantification of pathogen-encoded nucleic acids with short processing times, nucleic acid amplification protocols are becoming a dominating technique in the diagnostic laboratory. Prerequisite to benefiting from the advantages of this technique are efficient protocols for the extraction of nucleic acids. Many existing protocols are labor intensive, time consuming, or restricted to certain specimens or types of nucleic acids. The optimal protocol should offer high sensitivity for extraction of DNA and RNA from a broad range of specimens combined with low time consumption, reduced hands-on time, low price, and the potential for automation (Klein et al., 1997; Daugharty et al., 1998; Vince et al., 1998). Many procedures available so far use a precipitation step to gain pure nucleic acids from the extracts. Other protocols take advantage of the nucleic acid-binding potential of matrix material supplied in a column (Fahle and Fischer, 2000). The simultaneous extraction of DNA and RNA and the underlying magnetic beads technology make it an interesting system
26
Literatures Review
for manual extraction of nucleic acids in a routine diagnostic laboratory and especially for automated extraction of nucleic acids (Kleines et al., 2003; Legler et al., 1999).
2.10.2 Polymerase Chain Reaction (PCR): The invention of PCR has been one of the major advances in the area of molecular-based methods (Mullis and Faloona, 1987; Saiki et al., 1987; Saiki et al., 1985). The PCR method uses essentially the same events which occur naturally in the cell, with the opening up of the double strand, using the exposed strands as templates, the addition of primers, and the action of DNA polymerase. Initiating the reaction requires a few specialized ingredients (Lewin, 1997). In theory, a million fold increases in yield of the desired target sequence, which can be achieved in a few hours, or even faster nowadays. PCR utilizes a pair of oligonucleotides (primers), each hybridizing to one strand of a double stranded DNA (dsDNA) target. The primers flank the region that will be amplified. The hybridized primer acts as a substrate for a thermostable DNA polymerase (most commonly derived from Thermus aquaticus and called Taq polymerase) that synthesizes a complementary strand via the sequential addition of deoxy ribonucleotides. The process includes repetitive cycles of three steps, denaturation of dsDNA, annealing of the primers and extension of the DNA fragments, which are accomplished by cyclic temperature changes in the reaction. The number of repetitive cycles varies usually from 25 to 50 in PCR tests used for diagnostic purposes. In addition to suitable primers, template DNA, polymerase enzyme, and deoxy ribonucleotide mixture, optimal conditions for the enzyme are needed for successful PCR. If the starting material is RNA, a further step with a reverse transcriptase (RT) enzyme is needed before amplification. This technique is then referred to as RT-PCR. At present, various programmable thermal cyclers vary in many technical aspects such as capacity and rapidity, are available for the performance of a PCR run. Conventional detection of amplified DNA products relies on electrophoresis combined with ethidium bromide
27
Literatures Review
staining. The sensitivity and specificity of the detection can be improved using hybridization methods either after, or instead of, electrophoresis. The major advantages of PCR over cloning as a mechanism of amplifying a specific DNA sequence are sensitivity and speed. DNA sequences present in only trace amounts can be amplified to become the predominant sequence. PCR is so sensitive that DNA sequences present in an individual cell can be amplified and studied. Isolating and amplifying a specific DNA sequence by PCR is faster and technically less difficult than traditional cloning methods using recombinant DNA techniques (Champe and Harvey, 1994). Inspite of all its advantages, PCR has some problems. A serious concern is the introduction and amplification of non- target DNA from the surrounding environment, such as a skin cell from the technician carrying out the PCR reaction rather than material from the sample DNA that was supposed to be amplified. Such contamination can be minimized by using equipment and rooms dedicated for DNA analysis and maintained with the utmost degree of cleanliness. Problems with contaminants can also be reduced by using gene-specific primers and treating samples with special enzymes that can degrade the contaminating DNA before it is amplified (Cowan and Talaro, 2006). The most frequently used methods are based on PCR detecting HCMV DNA (or RNA) in whole blood or in different blood compartments (Boeck et al., 2004) and from feces (Boom et al., 2000). Plasma viral load in liver transplant recipients by quantitative PCR is a useful test for predicting CMV disease, which is sensitive and specific as antigenemia, and could be employed as a marker in a pre-empitive strategy (Humar, 1999). Quantitative PCR was shown to have a clinical value in the monitoring of both asymptomatic and symptomatic HCMV infection in individual liver and kidney transplant patients. Also the response to the antiviral treatment was easily followed using the quantitative PCR assay (Piiparinen, 2004). For evaluating lytic gene expression in
28
Literatures Review
HCMV Bergallo and his colleagues (2008) used Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) which is a good way to be used for the evaluation of the reactivation state also. Establishment of a reliable real-time quantitative PCR assay (Q-PCR) for the detection of CMV is crucial for successful management of CMV infection. Optimal detection of CMV DNA in all clinical samples can be achieved only if primer sequences capable of detecting all the CMV strains are used. A number of different genes are used as a target for quantitative detection of CMV, including the major immediate-early (MIE) gene (Nitsche et al., 1999; Leruez-Ville et al., 2003; Drago et al., 2004), the phosphor protein 65 (pp65) gene (Gault et al., 2001; Griscelli et al., 2001; Stocher et al., 2003), and the glycoprotein B (gB) gene (Kearns et al., 2001; Li et al., 2003). Some groups use duplex assays to detect two different genes simultaneously (Boeckh et al., 2004; Herrmann et al., 2004). Specific detection done by Real-Time PCR of blood, plasma, dried blood spot and feces (Mengelle et al., 2003; Ducroux et al., 2008; Soetens et al., 2008; Vincent et al., 2009).
2.10.3 Cloning and Subcloning: Cloning has acted as spur to fundamental biological research as it follows an individual gene to be selected and purified in large amounts free of contamination by other DNA sequences, also it is the only means of obtaining material with which one can make a direct study of the structure of genes and the control of gene expression (Brown, 1986). BAC cloning technique of viral genomes has been a useful tool for mutagenesis studies of large DNA viruses such as HCMV. In such studies, the BAC DNA has been used to mutate or delete the individual genes to understand their functions in viral replication. Its greatest usefulness was marked by studies in which viral gene functions were screened at global scale for both MCMV and HCMV (Dunn et al., 2003; Yu et al., 2003). HCMV BAC DNA of several clinical and attenuated strains 29
Literatures Review
has been generated so that the genomic DNA can be propagated and sustained inside an E. coli host (Marchini et al., 2001; Murphy et al., 2003). The cloning technique using BAC DNA has several modifications over traditional cloning such as: using E. coli strains containing λ recombination proteins to enhance homologous recombination efficiency; and inserting the luciferase reporter gene in the viral genome so that viral growth curve experiments can be more reproducible and less time consuming (Baldick et al., 1997; Yu et al., 2000; Zhang et al., 2008). These modifications have made BAC cloning much easier and efficient than before. For cloning large pieces of DNA from herpsevirus genome, a new one-step genetic cloning method called “gene capture” was developed. This method allowed cloning of an 18-kb DNA fragment from HCMV BAC genome to a plasmid vector. This plasmid was used successfully to generate a rescue clone of the 15-kb deletion thus demonstrating that this method greatly simplifies the cloning of a large piece of genomic DNA and is applicable for genetic studies of herpesviruses and other large DNA viruses (Dulal et al., 2009).
2.10.4 DNA Sequencing: An exciting development in the world of genetics is genomics, the sequencing and analysis of the nucleotide bases of genomes. At first, scientists' sequenced DNA molecules by selectively cleaving DNA at A, T, G, or C bases, separating the fragments by gel electrophoresis, and mapping the order in which the fragments occur in a complete DNA molecule. Such time-consuming, labor-intensive, and cumbersome sequencing was limited to short DNA molecules such as those of plasmids. Today, scientists use a faster technique that utilizes cDNA synthesized with nucleotides that have been tagged with four different fluorescent dyes-a different color for each nucleotide base; then an automated DNA sequencer determines the sequence of base colors emitted by the dyes (Bauman, 2004). The important factor to consider when developing a sequencing strategy for whole genomes is to remember that one can
30
Literatures Review
sequence only small sections of DNA (1000-2000 bp) and that entire chromosomes are comprised of well over 1 x 106 bp. (Lakowicz, 2003). Two methods have been developed to determine the nucleotide sequence of DNA molecules: the dideoxy chain termination method of Sanger and the chemical degradation method developed by Maxam and Gilbert. The chain termination method has now superseded the chemical method because it is more efficient and is simpler to perform. The basis of the chain termination method is that the DNA molecule whose sequence is to be determined, is copied in an enzyme reaction by DNA polymerase. Modified nucleotide triphosphates are included in the reaction that causes termination of DNA synthesis randomly at each of the four bases where they occur in the template DNA. The overall effect is that a series of DNA molecules each one nucleotide longer than the next is synthesized which can be separated according to size by electrophoresis. The base sequence of the template DNA can then be determined by identifying the terminal base of each synthesized DNA molecule from the shortest to the longest (Winter et al., 1998).
2.10.5 Sequence Alignment: Sequence alignments provide a powerful way to compare novel sequences with previously characterized genes. Both functional and evolutionary information can be inferred from well-designed queries and alignments. BLAST, (Basic Local Alignment Search Tool), provides a method for rapid searching of nucleotide and protein databases. Since the BLAST algorithm detects local as well as global alignments, regions of similarity embedded in otherwise unrelated proteins can be detected. Both types of similarity may provide important clues to the function of uncharacterized proteins (Lodish et al., 2004). The basic algorithm is simple and robust; it can be implemented in a number of ways and applied in a variety of context including straight forward DNA and protein sequence databases, motif searches, gene identification searches, and in the analysis 31
Literatures Review
of multiple regions of similarity in long DNA sequence. In addition to its flexibility and tractability to mathematical analysis, BLAST is an order of magnitude faster than existing sequence comparison tools of comparable sensitivity (Altschul et al., 1990). A set of genomic sequences that have been assembled, condensed, ordered, and oriented together using sequence homology and mapping information, is to create a consensus sequence of a chromosome named as DNA sequence assembly. The FASTA format is the only format where you can input a sequence, instead of a number or code identifying a gene that has already been deposited in GenBank, so this is the format that must be used for non-published sequences (Kent, 2002).
32
Material and Methods
3. MATERIALS AND METHODS All the Molecular works were done in Kurdistan Medical Research Center in Erbil city.
3.1 Viruses 3.1.1 Sample Collection:
Serum samples were collected during January and May 2009 from different patients (13 samples from men, 27 samples from pregnant women, 62 samples from aborted women and 23 samples from new born babies). All serum samples were tested for CMV by ELISA using CMV ELISA kit, kindly done by the staff in the clinical lab of hospitals in Sulaimani city especially Shaheed Bakhtyar´s Lab.
3.1.2 Extraction of the Viral DNA:
Viral DNA was extracted from serum samples using genomic DNA purification kit (Gentra systems, USA). DNA extraction was performed from 1ml of serum according to manufacturer’s instructions. Briefly, the samples were harvested and pelleted by centrifugation at 2000xg for 10 minutes at room temperature. This was resuspended in 50µl of Resuspension solution, then either stored at -70°C (REVCO, USA) and used subsequently after thawing or used directly. 250µl of Cell lysis solution was added to the resuspended sample, mixed thoroughly by pipeting up and down. After that 1.5 µl of Proteinase K (Amersham life science, Germany) [ 20mg Proteinase K dissolved in sterile 50mM Tris (pH 8.0), 1.5mM Calcium Acetate ] was added to the cell lysate, mixed by inverting 25 times and incubated at 55°C for 60 minutes. The mixture was cooled to room temperature by placing on ice for 1 minute, and then 100µl of Protein precipitation solution was added and mixed thoroughly with vortex for 20
33
Material and Methods
seconds, then incubated on ice for 5 minutes and centrifuged at 13000xg for 3 minutes. The supernatant mixed gently with 300µl of 100% Isopropanol and incubated at room temperature for at least 5 minutes. The DNA was pelleted through centrifugation at 13000xg for 5 minutes, the supernatant was discarded, then the pellet was washed using 300µl of 70% ethanol and inverted several times, then centrifuged for 1 minute at 13000xg and the ethanol was discarded, and then air-dried for 5 minutes by inverting the tube on clean absorbent paper. The DNA was hydrated by 30µl of DNA Hydration solution and incubated for 60 minutes at 65°C. Finally, the hydrated DNA was mixed thoroughly using vortex and spin down before using then stored at 4°C.
3.1.3 Amplification of Promoters by PCR:
The primers (Sigma, Germany) (Table 3-1) for amplification of promoters (figure 3-1) were designed from the human cytomegalovirus (HCMV) complete genome (Gene Bank accession number NC-001347). One sample with –ve ELISA test for both IgM and IgG, and also –ve in PCR test was used as a negative control sample (NCS), the ddH2O was also used as a negative control (NC). The amplification was carried out by PCR thermocycler (Thermo, USA) and High-Fidelity DNA polymerase Kit (NEB, USA) according to manufactures instructions in a final volume 50µl reactions. The PCR mixture contained 2.5µl of 0.5µM Forward primer, 2.5µl of 0.5µM Reverse primer, 10 µl of 5x PhusionTM HF buffer, 1µl of 10mM dNTPs Mix, 0.5 µl of 50mM MgCl2, ~800ng template of DNA samples, 0.5µl PhusionTM DNA polymerase completed to 50µl by ddH2O and mixed. The promoters were amplified according to the following PCR program:
34
Material and Methods
No. of cycles
Temperature
Time
1 cycle
Initial denaturation 98 °C
1 minutes
Denaturation 98 °C
40 seconds
Annealing 58 °C
40 seconds
Elongation 72 °C
1 minutes
Final elongation 72 °C
1 minutes
30 cycles
1 cycle
For confirmation of cloning promoters on pJET1.2 vector by PCR, the sequencing primer (Fermentase, Germany) as shown in (Table 3-1) was used for the amplification of the Multiple Cloning Site of this vector with the cloned insert and the PCR program was as follows:
No. of cycles
Temperature
Time
1 cycle
Initial denaturation 95 °C
3 minutes
Denaturation 94 °C
30 seconds
Annealing 60 °C
30 seconds
Elongation 72 °C
1 minutes
25 cycles
IRL
UL
MIE
E1
L
TRL IRS
E2
IE
US
TRS
US
Figure 3-1: Promoters position on schematic HCMV genomes. Abbreviations: IRL, Inverted Repeat Long; UL, Unique sequence Long; TRL, Terminal Repeat Long; IRS, Inverted Repeat Short; US, Unique sequence Short; TRS, Terminal Repeat Short; MIE, Major Immediate Early promoter; E1, Early promoter; L, Late promoter; E2, Early promoter; IE, Immediate Early promoter, and US, Unique Short promoter.
35
Material and Methods
Table (3-1) primers used in this study
Primer name
Forward Sequence from 5´
3´
Tm (Cº)
Major Immediate Early Forward primer (MIEF)
GTTACGGCAACAGCGCTGATGGCA
56.0
Immediate Early Forward primer (IEF)
ACGGGGAATCCGCGTTCCAATGCA
56.0
Early-1 Forward primer (E1F)
AGACGTAGGCAGGGGAATTCCCATA
56.0
Early-2 Forward primer (E2F)
TCAATTACTCGTCCTCATCCTCCGC
56.0
Late Forward primer (LF)
TCTACGTCGACACGACGTGCTGGA
56.0
Unique Short Forward primer (USF)
CCGGCTTTAGTGATTCCATCGGGC
56.0
pJET1.2 vector Forward primer (pJET1.2F)
CGACTCACTATAGGGAGAGCGGC
60.0
Amplified LacZ gene Forward primer (Lac ZF )
2
ACGCTTACGATATCCATTCGCCATTC
56.0
Deleted tet gene of pBR322 Forward primer
CGGCACCTCGATATCGGATTCACCA
58.0
3
(∆ tet pBR322F ) Reverse Sequence from 5´
3´
Major Immediate Early Reverse primer (MIER)
ACAAGGCGCGGCGATGACGAGTAG
58.0
Immediate Early Reverse primer (IER)
CTGGCACATGGCCAATGCATATCGA
58.0
Early-1 Reverse primer (E1R)
CGGGTTCTTGCGGTTCTGCAACAAC
58.0
Early-2 Reverse primer (E2R)
TTCGAGTCCGTCCTCGAGGAACGA
56.0
Late Reverse primer (LR)
TACCTGTTAGACGGCGTCGTCGAC
56.0
Unique Short Reverse primer (USR)
CAACTCCGGTCGCTAACTGATAACG
56.0
pJET1.2 vector Reverse primer (pJET1.2R)
AAGAACATCGATTTTCCATGGCAG
58.0
Amplified LacZ gene Reverse primer (Lac ZR )
GGAAAGCTTGCATGCAGGCCTCTG
56.0
Deleted tet gene of pBR322 Reverse primer
ATACACGGTGCATGCCTGCGTTAGC
58.0
2
3
(∆ tet pBR322R )
1.
Annealing temperature of primer.
2.
Restriction enzyme recognition site incorporated into primers is shown with bold letters.
3.
Point mutation incorporated into primers for inverse PCR is indicated line under the letters.
36
1
Material and Methods
3.1.4 Agarose Gel Electrophoresis:
PCR products (section 3.1.3), plasmid preparation (section 3.3), restriction digestion (section 3.4.1) were visualized under UV light after resolution by gel electrophoresis through an agarose gel, comprising 1% W/V agarose (Biozyme, Germany) and this protocol was done according to Sambrook et al. (1989) and Absubel et al. (2003). Agarose was dissolved in 1X TBE buffer [10.8 gm Tris Base (Fisher), 5.5 gm Boric Acid (Fisher), 4ml of EDTA (ACROS), pH 8.0], the solution was cooled to 55°C and 4µl of ethidium bromide (Sigma, Germany) was added and then poured into a gel tray containing a comb to produce wells for loading DNA samples. The gel was left to solidify on the bench for 20 to 30 minutes. 7µl of the sample was mixed with 2µl of 6X loading buffer (Sigma, Germany) before loading into a well of the agarose gel. The gel tank was filled with 1X TBE buffer and the gel was run in 80V for 1 hour. A Mix, 1Kb and 100bp DNA ladder (Fermentase, Germany) was used as a marker.
3.1.5 DNA Gel Purification:
DNA from agarose gel was purified using two types of kit; first the DNA purification kit (Cinnagen, Iran) and the second Ultrafree -DA filter (Millipore, US). After purification all DNA was stored at -70°C.
To purify DNA from gels, the gel was placed onto an Ultraviolet illuminator (SPECTROLINE, USA) to visualize the DNA band. A clean scalped blade was used to remove the band of interest and the gel slice was transferred to a 1.5 eppendorf tube (Eppendorf, Germany). Three volumes of Binding Solution and ½ volume of TBE conversion Buffer was added to the eppendorf tube and incubated at 55°C for 5 minutes until the agarose were completely dissolved. The 5µl of Silica Powder Suspension was added to the viscous suspension and mixed thoroughly then incubated for 5 minutes at 55°C. The DNA was pelleted at 1000xg for 1 minute, and
37
Material and Methods
then the supernatant was removed. The DNA pellet was washed three times with 500µl ice cold Wash Buffer, each time the pellet was suspended completely, vortex and spin downed at 1000xg for 1 minute, then supernatant from the last wash was discarded and the pellet was air-dried for 15 minutes. The DNA pellet was eluted by TE Buffer [100mM Tris-Cl, 10mM EDTA (ACROS)], eluted DNA was incubated at 55°C for 5minutes, after centrifugation the pellet was discarded and the supernatant was transferred to a new tube and preserved till used.
Second, Ultrafree-DA filter kit (Figure 3-2) is also used for DNA purification from gel, when the sliced agarose with DNA band was placed into gel Nebulizer and the device was sealed with cap attached to vial. Then spinning down at 5000xg for 10minutes, through this centrifugation, the agarose forces through the gel Nebulizer and converted to fine slurry that was captured by Ultrfree – MC; then extruded DNA in electrophoresis buffer passed through the microporus membrane in Ultrafree – MC and collected in the filtrate vial. The Ultrafree – MC and gel Nebulizer were discarded and the filtrate was concentrated by concentrator machine (Eppendorf, Germany) and preserved till used in cloning (section 3.4).
Figure 3-2: Ultrafree -DA filter tube for Purification of DNA from Gel
38
Material and Methods
3.1.6 Purification of PCR Product:
PCR products were purified by using QIA quick PCR purification kit (Qiagen, USA) according to manufactures instructions. One volume of the PCR product mixed with 5 volume of PB buffer were orange or violet color produced, then by adding 3M Sodium Acetate (10µl) the color will turn to yellow. The mixture was placed to QIA quick column and centrifuged for 1minutes at 17900xg, the flow through was discarded and the column back to the same collection tube. The DNA was washed with 750µl of PE buffer and centrifuged twice for 1-minute. The column was placed to a new micro centrifuge tube and the DNA was eluted by 30µl of elution buffer and incubated for 1minutes, then centrifuged for 1minutes. The purified DNA stored at -70ºC till used in cloning (section 3.4) or other purposes.
3.1.7 Ethanol precipitation:
The ethanol precipitation method that is described by Sambrook et al. (1989) was used for recovering of DNA from restriction enzyme (section 3.4.1) especially in the plasmid which was treated with Dpn I or during double digestion when different buffers were used. For each ten volumes of reaction mixture, one volume of 3 M sodium acetate and 2.5 volumes of 100 % ethanol were added to the mixture and mixed with vortex. Then, the DNA was precipitated by overnight incubation of mixture at -20°C. After that, the mixture was centrifuged at 10000xg and 4°C for 20 minutes, the supernatant was aspirated thoroughly. To remove salts, 1 mL of cold 70% Ethanol was added and the suspension was recentrifuged for 10 minutes for pelleting the DNA. The supernatant was aspirated thoroughly and the DNA pellet was air dried for 20 minutes at room temperature, then dissolved in ddH2O and stored at -20°C until used.
39
Material and Methods
3.1.8 Determination of DNA Concentration and Purity:
NanoDrop 1000 UV-Vis spectrophotometer (NanoDrop, USA) used for the determination of genomic DNA concentration. The upper and lower optical surface of micro spectrophotometer (Figure 3-3) cleaned by 1.5μl of ddH2O pipeted on to lower optical surface. The lever arm is closed to wash the upper optical surface. The lever arm lifted and wiped off both optical surfaces with a soft tissue. The NanoDrop software is opened and the nucleic acid module selected. The spectrophotometer initialized by placing 1.5μl of ddH2O onto lower optic surface, the lever arm is lifted and “initialize” selected in the NanoDrop software. Once initialization was complete (~10 sec), both optical surfaces were cleaned with a tissue paper. The genomic sample DNA measured by loading 1.5μl and “measure” was selected. The software automatically calculates the double strand DNA (dsDNA) at A260 and DNA at purity A260/A280.
Figure 3-3: NanoDrop spectrophotometer.
40
Material and Methods
3.2 Bacterial Hosts and Plasmid The bacterial cloning strain E. coli DH5α was used as a competent cell and pBR322 plasmid carrying ampicillin and tetracycline resistance genes (Figure 3-4) were kindly gifted from Dr. Shwan K. Rachid from Pharmaceutical Biotech. Institute/ Saarland University in Germany. While stock culture of pTZ57R plasmids (Source: Fermentas) carries ampicillin resistance genes (Figure 3-5) was obtained by Dr. Farhad M. Barzinji from Kurdistan Medical Research Center In Erbil; and pJET1.2 which hold ampicillin and lethal gene (Figure 3-6) vector was purcashed from Fermentas company in Germany.
Figure 3-4: Map of the pBR322 vector with the restriction site of each unique restriction enzyme.
41
Material and Methods
Multiple Cloning Site (MCS) 615 M13 PUC sequencing primer, 17 mer
Eco RI
EcI136II
Acc651
Sac I
KpnI
Mph11031 Bsp681
Mva12691
XbaI
Eco321
5´ GTAAAACGAC GGCCAG TGAA TTCGAGCTCG GTACCTCGCG AATGCATCTA GAT 3´ CATTTTGCTG CCGGTC ACT T AAGCTCGAGC CATGGAGCGC TTACGTAGAT CTA
SmaI
Bam HI
ApaI
SalI
PstI
Eco1471
3´ 5´
695
AflI Eco321
Blunt PCR products
PaeI
Hind III
T7 transcription start
5´ ATCGGAT CCCGGGCCCG TCGACTGCAG AGGCCTGCAT GCAAGCTT TC CCTATAGTGA GT 3´ 3´ TA GCCTA GGGCCCGGGC AGCTGACGTC TCCGGACGTA CGTTCGAAAG GGATATCACT C A 5´ 5´ CGTAT T AGAGCTTGGC GTAATCATGG TCATAGCTGT T TCCTG 3´ 3´ GCATAA TCTCGAACCG CATTAGTACC AGTATCGACA AAGGAC 5´
T
T7 promoter
M13 pµ reverse sequencing primer
Figure 3-5: Map of the pTZ57R vector. The Blunt ended promoters were cloned between the Blunt ends of the vector after digestion by Eco RV restriction enzyme.
42
Material and Methods
Multiple Cloning Site (MCS) pJET1.2 forward sequencing primer, 23-mer
328
T7 transcription start
T7 promoter
Eco 521 Not I
Xho I Bg III
Kpn 21
Bsp XI
5´ GGC GTA ATA CGA CTC ACT ATA GGG AGA GCG GCC GCC AGA TCT TCC GGA TGG CTC GAG TTT 3´ 3´ CCG CAT TAT GCT GAG TGA TAT CCC TCT CGC CGG CGG TCT AGA AGG CCT ACC GAG CTC AAA 5´ 371
372 Xba I
5´ TTC AGC AAG AT 3´ AAG TCG TTC TA
Blunt PCR product
Bg III
A TCT TTC TAG AAG ATC TCC TAC AAT ATT CTC AGC TG 3´ T AGA AAGATC TTC TAG AGG ATG TTA TAA GAG TCG AC 5´
422 Nco I
Bsu 151
5´ C CAT GGA AAA TCG ATG TTC TTC T 3´ 3´ G GTA CCT TTT AGC TAC AAG AAG A 5´ pJET 1.2 reverse sequencing primer, 24-mer
Figure 3-6: Map of the pJET 1.2 vector. The Blunt ended promoters were cloned between the Blunt ends of the vector.
43
Material and Methods
3.2.1 Media for Bacterial Culture:
Bacterial cultures were grown in Luria Bertani medium (LB) prepared according to
Sambrook et al. (1989) by dissolving 10gm trypton (Bectone, UK), 5gm Yeast
extract (ACROSE) and 10gm NaCl (Fisher, USA) in 800ml distilled water. All culture media were sterilized by autoclave (Thermo, USA) for 15 minutes at 121°C and supplied with appropriate antibiotic “Ampicillin” (Sigma, Germany). To make agar (Fisher, USA) plates, 100 to 200ml aliquots of LB supplemented with 1.5 % Bacto-Agar (L-Agar) were sterilized, cooled and stored at 4°C refrigerator (Fisher, USA). The medium was cooled to 45°C and supplemented with appropriate Antibiotics - Ampicillin [100mg/ml] or Tetracycline [20mg/ml] (as needed) in a laminar hood (Fisher Hamilton, USA), 20-25ml of L-Agar was poured into a Petridish and left to solidify for 20 to 30 minutes. In case of transformation, 1µl of X-Gal (Fermenats) [20mg/ml of dimethyl formamide] and 1µl of IPTG (Fermentas) [100mM/ml of ddH2O] were mixed with 1ml of L-Agar just before pouring into a Petridish.
3.2.2 Preparation of Bacterial Culture:
Single colony isolated from agar plates were transferred aseptically into 5 or 10ml of LB supplemented with appropriate antibiotics-Ampicillin. Bacteria were then incubated in Shaker Water Bath (Barnstead International, Switzerland) at 37°C and 200rpm.
3.3 Plasmid DNA isolation by Mini prep All the plasmid prep of this study were done according to manufacture´s instructions of Gene JETTM plasmid mini prep kit (Fermentas, Germany) and manually based on Kotchoni et al. (2003). Briefly, cultures were grown overnight in LB broth with appropriate selective antibiotics (Ampicillin). The overnight culture (10ml) was
44
Material and Methods
centrifuged at 6800xg for 2 minutes and the pellet resuspended in 250µl Cell Resuspension Solution. To lyse the cells, 2500µl Cell Lysis Solution was added and the tube was inverted 6-8 times for mixing, and then incubated at room temperature for 3 minutes. Neutralization Solution (350µl) was mixed thoroughly by inverting 4-6 times and added to the sample then centrifuged at 12000xg for 5 minutes. The supernatant of the mixture was added to the Gene JET™ spin column and centrifuged for 1 minute at 12000xg; the flow through liquid was discarded. Washing was carried in two steps with 500µl of the diluted wash solution followed by centrifugation for 1 minute at 12000xg. The spin column was then transferred to a sterile 1.5ml micro centrifuge tube then incubated for 2 minutes and centrifuged for 1 minute at 12000xg after the addition of 50µl Elution buffer.
Manually based on Kotchoni et al. (2003), the pellet resuspended in 250µl Solution I [50mM Glucose, 25mM Tris-Cl and 10mM EDTA (pH = 8.0), mixed and sterilized by autoclave and preserved at 4ºC] containing 20mg/ml Proteinase K; then the suspension was incubated for 5 minutes at room temperature. To lyse the cells, 400µl Solution II [0.2N NaOH and 1%SDS] was added and the tube inverted 6-8 times for mixing and immediately 200µl Solution III [8M Ammonium acetate, autoclaved and preserved at room temperature] was mixed gently by pipetting up and down and incubated on ice for 5 minutes without shaking, then the sample centrifuged at 10000xg for 5 minutes at room temperature. The supernatant of the mixture was transferred into a new eppendorf tube and 0.6 volume of Isopropanol was added then mixed and incubated at room temperature for 10 minutes. Then centrifuged for 5 minutes at 10000xg the flow through liquid was discarded. Washing was carried in one step with 400µl of 70% (V/V) ethanol followed by centrifugation for 3 minutes at 10000xg at room temperature. The supernatant was removed and the pellet dried at room temperature for 20 minutes, then resuspended in 50µl of 10mM Tris-Cl and incubated at 37ºC for 5 minutes after the addition of 1µl RNase enzyme, then preserved at -20ºC till used.
45
Material and Methods
3.4 Cloning The aim of this section is to clone promoters into vectors pJET 1.2 (Figure 3-6) and pTZ57R (Figure 3-5) (Wu et al. 2003).
3.4.1 Restriction Enzyme Digestion:
In this study, the digestion was done in many steps according to the enzymes manufacturer’s instructions and the use of the restriction enzyme depended on the purposes of the work like cloning and confirmation of the promoter. Usually digestion was carried out as follows:
Component
Amount
Restriction enzyme
1U
specific 10X Buffer
2µl
Plasmid (up to 1µg)
2-5µl
ddH2O
to 20µl 20µl
Mixed thoroughly with vortex then spined-down the mixture and incubated at 37°C for 3hr (depend on the incubation time of the restriction enzyme), inactivated at 65°C or 80°C for 20 minutes depending on the enzyme used. For cloning purposes, digestion was done by Eco RV enzyme (Fermentas, Germany) with 7µl pTZ57R plasmid. For confirmation of the promoters present in the plasmid or its direction, different enzymes were used such as Sal I, Xba I, Sph I (Pae I), Hind III, Eco RI, Pvu II, Nco I, Kpn 21, Mva 12691 (Fermentas, Germany). After digestion, samples were visualized on agarose gel (Section 3.1.4).
46
Material and Methods
Before ligation, PCR products from vectors (amplified LacZ gene with promoter cassettes, ∆tet pBR322) and digested plasmids were treated by Dpn I (NEB, USA) to get rid of the template by digest (Adeno) methylated GATC sites by this enzyme
because the genotype of E. coli strain is M+ (methylated). The treatment by Dpn I done as follows:
Component
Amount
Dpn I
1U
NEB Buffer 4 (10X Buffer)
2µl
Plasmid (up to 1µg)
2-5µl
ddH2O
to 20µl 20µl
The mixture mixed then spined-down and incubated at 37°C for 1hr, inactivated at 80°C for 20 minutes. Then the DNA was precipitated by ethanol precipitation (section 3.1.7) then used for ligation.
3.4.2 Preparation of Insert and Vector:
The amplified DNA fragments (Promoters) from HCMV genomic DNA have a blunt end due to the Taq polymerase used in PCR (section 3.1.3) which can be ligated on the blunt ended plasmid pJET 1.2 as described in Section 3.4.3 without using exonuclease enzyme. While when cloned these promoters on pTZ57R this vector was digested by Eco RV enzymes (section 3.4.1) to give a blunt end too, so the insert prepared to ligate on these mentioned vectors.
3.4.3 Ligation:
The blunt ended promoter inserts were ligated into pJET 1.2 and pTZ57R at the blunt ended sites (Eco RV) (section 3.4.1) using T4 DNA ligase (Fermentase, Germany). The ligation reactions were performed in 20µl volumes as follows:
47
Material and Methods
Components
Amounts
vector
-- µl (depend on concentration)
Promoter insert
-- µl (depend on concentration)
T4 DNA ligase
1.0 µl
2X Ligase Buffer
10.0 µl
ddH2O
To 20 µl 20 µl
The ligation was carried out overnight at room temperature then transformed to a freshly prepared competent cell as described in section 3.5.2.
3.5 Transformation Both competent cell and transformation are prepared based on Sambrook et al. (1989) and Absubel et al. (2003) with some modification.
3.5.1 Preparation of Chemically Competent Cells: A competent cell was prepared chemically from strain of E. coli DH5α (section 3.3). 1-2 colonies from overnight culture (section 3.3.2) were inoculated into 50ml LB broth (section 3.3.1) and incubated at 37°C with shaking until the absorbance at 600nm reached 0.6. Cells were chilled on ice for 30 minutes then centrifuged (Lab Tech, Korea) at 2400xg for 10 minutes and the supernatant discarded. 25ml of ice cold 0.1M CaCl2 added to resuspend the pellet, which was then centrifuged at 2400xg for 5 minutes. Again the supernatant was discarded and the pelleted cell resuspended with 20ml ice cold 0.1M CaCl2, which was then incubated on ice for 20 minutes. Following another round of centrifugation at 2400xg for 5 minutes, the pellet was resuspended in 2ml ice-cold 0.1M CaCl2. The cells were then chilled on ice for 2hrs or preserved in 4ºC till used.
48
Material and Methods
3.5.2 Transformation of Plasmid DNA into Competent Cells:
Chemically competent cells (section 3.5.1) were used by adding plasmid DNA (10µl) and mixed through tube flicking and chilled on ice for 30 minutes. The cells were then heat shocked at 42°C for 90seconds followed by incubation on ice for 2 minutes. 800µl of LB broth (section 3.2.1), pre-warmed to room temperature, was added to the cells and then incubated at 37°C with shaking at 200rpm for 45 minutes. The sample (100µl) was then spread on freshly prepared L-Agar plate supplemented with antibiotics-Ampicillin, X-Gal (20mg/ml) and 100mM IPTG (section 3.2.1) then incubated overnight at 37°C in dark incubator. Also the second method was used for transformation based on clone JET™ PCR cloning kit (Fermentas, Germany) in which 5µl of the ligated sample (section 3.4.3) was mixed with 50µl of the competent cell, mixed and incubated on ice for 5minutes then spread on LB agar (section 3.2.1) supplemented with appropriate antibiotic- ampicillin (50-100mg/ ml as needed) and incubated overnight at 37ºC.
3.6 Sequencing DNA was sequenced using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on an automated ABI 3730xl 384-capillary DNA analyzer (Applied Biosystems) in SeqIT-company (Kaiserslautern-Germany). The concentration of the template DNA used in this study and sequencing based on, which was taken from NanoDrop 1000 UV-Vis spectrophotometer (section 3.1.8) and shown as follows:
Template
Quantity (ng)
260/280
pJET1.2 + promoter 1
395.53
2.01
pJET1.2 + promoter 2
462.37
1.99
pJET1.2 + promoter 3
458.86
1.97
pJET1.2 + promoter 4
354.21
1.96
pJET1.2 + promoter 5
423.74
1.81
pJET1.2 + promoter 6
420.09
1.98
49
Material and Methods
The forward sequencing primer of the clone JET™ PCR cloning kit was used for each promoter to be sequenced in order to obtain sequences in 5´ to 3´ directions (Fermentase, table).
3.7 Sequence Alignment and Bioinformatics The sequences were determined with the ABI3700 DNA analyser and analyzed using chromas software (version 1.45, Germany). The homology search using BLAST was made online through a site of NCBI web site (http://www.ncbi.nlm.nih.gov) to find out sequenced promoters with the published sequence on NCBI; then made Multiple Sequence Alignment also online through ClustalW2/ EBI website to compare promoters sequence from local wild strain of HCMV with that of the published HCMV and AD169 strain sequences (Gene Bank accession number NC-001347). The restriction map was done using Genome expression software (version 1.100).
3.8 Subcloning Subcloning protocol done according to Sambrook (1989) and Absubel (2003) with some modification.
To prepare the insert for subcloning, the cloned promoters on pTZ57R (section 3.4) which have sense direction were amplified with LacZ gene using LacZ amplification primer (Table 3-1) by the following PCR program:
No. of cycles
Temperature
Time
1 cycle
Initial denaturation 98 °C
3 minutes
Denaturation 98 °C
40 seconds
Annealing 61 °C
40 seconds
Elongation 72 °C
40 seconds
Final elongation 72 °C
50 seconds
30 cycles
1 cycle
50
Material and Methods
The amplified region checked on gel (section 3.1.4) and the products were purified (section 3.1.6) and digested by Dpn I (section 3.4.1). The treated LacZ gene with promoter by ethanol was precipitated (section 3.1.7) and preserved till used in subcloning.
In vector pBR322 (section 3.4) which was about 4361bp (Figure 3-4) the tet gene was deleted by the above PCR program using ∆tet pBR322 deletion primer (Table 3-1); then, the remained part of ∆tet pBR322 vector was checked out on gel (section 3.1.4) which was about 3171bp and the PCR products were purified (section 3.1.6) and treated by Dpn I (section 3.4.1) then precipitated by ethanol (section 3.1.7) and preserved till used in subcloning. The treated LacZ gene promoters were subcloned on treated ∆tet pBR322 using T4 Ligase (section 3.4.3) and transformed (section 3.5.2). The extracted plasmids were confirmed by restriction digestion (section 3.4.1) and prepared for enzyme assay.
In other way the pBR322 vectors were digested by Hind III and Mva 12691 (section 3.4.1) to remove tet gene and it is promoter; then blunted by Blunt enzyme (present with clone JET™ PCR cloning kit) and incubated at 70ºC for 5minutes, then precipitated using ethanol precipitation (section 3.1.7). Only the treated LacZ gene (without promoters of HCMV) were cloned on digested ∆tet pBR322 using T4 Ligase (section 3.4.3) then transformed (section 3.5.2). The plasmids were checked out by both restriction digestion (section 3.4.1) and PCR (section 3.1.3), then prepared for enzyme assay and used as a control to compare the expression with or without tet gene promoter.
51
Results
4. Results In order to characterize and subsequently evaluate all promoters from the local isolates of HCMV and to compare published sequences in other region and countries, the genes were cloned and subcloned on high and relatively low copy number plasmids and were analyzed for their different activity by enzyme assay.
4.1 Sample Collection 130 Serum samples were tested for CMV by ELISA (Table 4-1) using CMV ELISA kit. After DNA extraction, PCR amplification was done using primer sets of MIE and IE promoter regions. As shown in Table 4-1, among 46 +ve samples for both IgM and IgG, 37 samples were also +ve by PCR, while among 33 –ve samples for both IgM and IgG, 18 samples were amplified by PCR. There are no amplified PCR products for only IgG +ve samples (Figure 4.1 and 4.2).
Table (4-1): The results of ELISA and PCR
ELISA No. of samples
IgM
IgG
PCR
%
46
+ve
+ve
37 +ve
80.43
24
+ve
-ve
20 +ve
83.33
27
-ve
+ve
27 -ve
0.00
33
-ve
-ve
18 +ve
54.54
75 +ve
57.70
130
Total
52
Results
4.2 PCR Amplification of Promoters All promoters (Table 4-2) were amplified by PCR from a wild strain of Human cytomegalovirus (HCMV) using specific primer sets (Table 3-1). Primers MIEF/MIER, IEF/IER, E1F/E1F, E2F/E2R and LF/LR were designed to amplify ~ 350bp (Figure 4-3 A), 1045bp (Figure 4-3 B), 1009bp (Figure 4-3 C), 494bp (Figure 4-3 D) and 510bp (Figure 4-3 E) PCR products of promoters from major immediate early region, Immediate-early region, Early 1 region, Early 2 region and Late region respectively in the Unique Long region of the HCMV genome and primer USF/USF was designed to amplified ~ 878bp (Figure 4-3 F) PCR products of promoter from Unique Short region of the HCMV genome. Amplification of the correct base pairs (Figure 4-3) products confirmed the presence of these regions on the HCMV genome. The negative control was the IgM -ve and IgG -ve sample.
Table (4-2): showing promoters size and there region on published HCMV (Gene Bank accession number NC-001347).
Promoter name
Size
Region Number
major immediate early (MIE) region
(350bp)
32200
immediate-early (IE) region
(1045bp)
174551
Early 1 (E1) region
(1009bp)
54001
Early 2 (E2) region
(494bp)
162601
Late (L) region
(510bp)
139981
unique short (US) region
(878bp)
195111
53
Results
IgM +ve IgG +ve M
1
2
IgM +ve IgG -ve 3
4
5
IgM -ve IgG +ve 6
7
8
IgM -ve IgG -ve 9
10
11
12
Control NCS
13
14
NC
15
1000 750 500 250
Figure 4-1: Amplified PCR product of MIE region using MIE primer sets. The size of the marker (M) from 1kb is shown on the left margin in bp. Most of those samples were both IgM and IgG +ve, also showed +ve PCR products on gel (Lane 1, 2 and 3). Most of the samples which have IgM +ve and IgG –ve were shown +ve PCR product (Lane 4, 5 and 6). While all samples with –ve IgM and +ve IgG showed –ve results on gel, means no PCR product (Lane 7, 8 and 9). Samples with IgM and IgG –ve by ELISA, on gel showed +ve PCR product (Lane 10 to 13). For control sample with IgM –ve and IgG –ve are used as negative control sample (NCS) in Lane 14, while ddH2O used as -ve control (NC) and both shows –ve PCR products on Gel.
IgM +ve IgG +ve M
1
2
IgM –ve IgG +ve
IgM +ve IgG –ve 3
4
5
6
7
8
9
IgM -ve IgG -ve 10
11
12
13
14 15
16
17
1000 750 500 250
Figure 4-2: Amplified PCR products of IE region using IE primer sets. The size of the marker (M) from 1kb is shown on the left margin in bp. Most of those samples were both IgM and IgG +ve also showed +ve PCR products on gel (Lane 1 and 2) and some –ve PCR product (Lane 3); Most of the samples which have IgM +ve and IgG – ve were shown +ve PCR product (Lane 4 and 5) and –ve PCR product as shown in Lane 6. While all the samples with –ve IgM and +ve IgG showed –ve result on gel, means no PCR product (Lane 7, 8, 9 and 10). Samples with IgM and IgG –ve in ELISA test, were shown +ve PCR product on Gel (Lane 12, 13, 15 and 16) and –ve PCR products as appeared in (Lane 11, 14 and 17).,
54
Results
+ve M
1
- ve 2
3
- ve M
4
+ve M
+ve - ve +ve
1
2
3
4
5
- ve
1
2
3
4 1500 1000 750 500 250
1500 1000 750 500 250
400 300 200 100
A +ve 1
2
B
- ve 3
+ve 4
M
M
1
C
-ve 2
3
+ve 4
-ve
5
M
1
+ve 2
3
1500 1500 1000 750
1000 750
1000 800
500
500
500 250
250
D
E
F
Figure 4-3: PCR amplification of promoters using specific primer. The size of the marker (M) from 100bp is shown on the left margins of A and F while from 1Kb is shown on the left margin of B, C and E and on the right margin of D in bp. A: + ve PCR product showed in Lane 1 and 2 as a sign for amplification of of Major Immediate Early (MIE) promoter samples, while Lane 3 and 4 are –ve PCR product. B: +ve PCR product as a correct amplification of Immediate Early promoter Region (lane 1 and 2) and –ve PCR product (Lane 3 and 4). C: Lane 1, 2 and 4 showed -ve PCR products while in Lane 3 and 5 showed exact fragment of Early Region 1 (E1) promoter. D: Lane 1 and 2 +ve PCR products of Early Region 2 (E2) promoter observed, while Lane 3 and 4 -ve PCR product appeared. E: + ve PCR product showed in Lane 1, 4 and 5 which proved the correct fragment of Late Region (L) promoter and -ve PCR product seen in Lane 2 and 3. F: in Lane 1 -ve PCR product seen while +ve PCR products of Unique Short Region (US) promoter observed in Lane 2 and 3.
55
Results
4.3 Cloning A linear and purified DNA fragment – Promoter was cloned to pJET1.2 and pTZ57R plasmids (section 3-4). The cloned promoter on pJET1.2 was transformed into DH5α – competent cell (section 3-5) then plated on LB-Agar, a white colony appeared as a sign for not expressing the lethal gene on the plasmid due to the insertion of the insert (Figure 4-4).
Figure 4-4: Transformed cloning promoter on pJET1.2. supplemented with 50mg/ml Ampicillin.
A white colony on LB-Agar
While the cloned promoters on pTZ57R after transformation (section 3-5) the Blue – white colony appeared on LB-Agar supplemented with Ampicillin, IPTG and XGal (Figure 4-5 A) after overnight incubation. The white colony and the slightly blue colony are a sign for the cloned promoter on the Multiple Cloning Site (MCS) of pTZ57R vector while the blue colony confirmed the pTZ57R vector without the promoter which is due to the expression of β-galactosidase enzyme from LacZ gene (Figure 4-5 B).
56
Results
B
B-W
W
A
B
Figure 4-5: Blue – White screening. LB-Agar supplemented with 100mg/ml Ampicillin with IPTG and X-Gal. A: transformed cloning promoter of pTZ57R result in W (White), B (Blue) and B-W (Blue-White) colony on the plate. B: Blue colony of transformed pTZ57R used as a control.
57
Results
4.3.1 PCR Confirmation of Cloned Promoter on pJET1.2:
The cloned promoters were amplified by PCR using primer of pJET1.2 cloning kit (Table 3-1). The pJET1.2F primer was 23nt in length and bound to 46nt upstream of the promoter at the 5´ end on the multiple cloning site of pJET1.2. Similarly, the pJET1.2R primer was 24nt in length and was bound to 40nt downstream of the promoter at the 3´ end on the multiple cloning site of pJET1.2 (Figure 4-6A). PCR screening was performed to check the correct cloning of the promoter on pJET1.2. The PCR products base pairs with primers sets indicated the presence of the promoters in the correct position on pJET1.2 plasmid. The positive control shows the 1200bp product amplified from pJET1.2 vectors with the same primer, while, no product was amplified in the negative control where the sterile ddH2O was used as a template (Figure 4-6B).
58
Results
A
pJET1.2F
pJET1.2
MCS
Promoter
MCS
pJET1.2
pJET1.2R
B
-ve M
1
+ve 2
promoter + MCS of pJET1.2 3
4
5
1200 1000
6
7
8
M
1000 750 500
500
Figure 4-6: PCR confirmation of the correct integration of the promoters into the pJET1.2 plasmids. A: diagram showing the position of the pJET1.2F and pJET1.2R primer binding to the Multiple Cloning Site (MCS) of pJET1.2 vector also integration site of promoter in the MCS of the vector. B: 976bp with MCS where used as a + ve control (Lane 2) while using ddH2O as a –ve Control (Lane 1). The PCR products of ~ 450bp (Lane 3), 1100bp (Lane 4), 1100bp (Lane 5), 480bp (Lane 6), 600bp (Lane 7) and 900bp (Lane 8) indicates the presence of MIE, IE, E1, E2, L and US promoters region with MCS on pJET1.2 vector, respectively. The size of the markers (M) from 1Kb ladder and 100bp are shown on the right and left margins respectively in bp.
59
Results
4.3.2 Confirmation of the Cloned Insert (promoter) on pJET1.2 by Restriction Enzyme:
Double restriction digestion by Xba I and Kpn 21 was used to confirm the cloned promoters on pJET1.2 when both enzymes have a restriction site on the MCS of this vector (Figure 4-7A), so on gel the two bands appeared one represent promoters with part of the MCS and the other band represents the remaining part of the vector. The positive control shows the 974bp fragment which was supplemented by the kit (Figure 4-7B).
A Kpn 21
Xba I
T CCGGA
T CTAGA
pJET1.2
MCS
Promoter
MCS
pJET1.2
B +ve Co M
1
2
MIE 3
4
IE 5
E1 6
7
1200 1000
E2 8
9
10
L 11
US 12
13
14
M
1000 750 500
500
Figure 4-7: Restriction Digestion by Xba I and Kpn 21 confirm the cloning result on pJET1.2. A: diagram showed the restriction site of both Nco I and Kpn 21 on the MCS of the pJET1.2 vector. B: The size of the marker (M) from 100bp is shown on the left margins while from 1Kb is shown on the right margin in bp. Lane 1, 3, 5, 7, 9, 11 and 13 showed the undigested of the plasmid mean pJET1.2 with it is cloned insert. The
60
Results
digested plasmid of +ve control by the mentioned enzymes were showed the exact fragment (Lane 2) (arrow). Also the digested plasmid which the promoters integrated on it, were appeared the corrected fragment size on gel as appeared in Lane 4, 6, 8,10, 12 and 14 (arrow) of MIE, IE, E1, E2, L and US promoter, respectively.
4.3.3 Sequencing of Cloned Promoter on pJET1.2:
Cloned promoter on pJET1.2 vector was sequenced in Seq IT- Company (section 3-6) Germany and analyzed with Chromas software (section 3-7) as shown a small region in Figure 4-8. The Blast and Multiple Sequence Alignment with the published sequence were made online through both websites NCBI and ClustalW2/ EBI (section 3-7) respectively. The Multiple Sequence Alignment compare sequenced promoter with both published HCMV 3301 and 3157 strains also with the Lab strain AD169 and the results will mentioned in details in the next paragraph.
As shown in Figure 4-8 MIE promoter was different in 9nt and was not aligned completely with any of each strain and the sequence is about 370nt in length. The sequence of IE promoter showing nearly 20nt was different form the other published sequences (Figure 4-9). The E1 promoter in Figure 4-10 showed nearly 15nt different and was not similar completely with any of the published strain, also if the gap observed, there is no presence of nucleotide. The E2 promoter showed only ~ 6nt difference from the other published nucleotide strains (Figure 4-11). Figure 4-12 showed ~ 12nt difference of L promoter from the published strain and somewhat similar with the AD169 lab strain (Figure 4-12). Finally the US promoter region showing ~ 11nt difference from the other strains (Figure 4-13).
Also the restriction map of each promoter was obtained by Genome expression software (section 3-7); generally, in this program we select one restriction enzyme to obtain later the direction of each promoter on the plasmid depending on this map, and behind each enzyme there is a number indicating the restriction site. The Figures 4-14 show the map of restriction enzymes of MIE, IE, E1, E2, L and US promoters.
61
Results
MIE AD169 3157 3301
GTTACGGCAACAGCGCTGATGGCACGTTGCCGGCTTCGAACATCGCGTCGGTGATTTCTT GTTACGGCAACAGCGCTGATGGCACGTTGCCGGCTTCGAACATCGCGTCGGTGATTTCTT GTTACGGCAACAGCGCTGATGGCACGTTGCCGGCTTCGAACATCGCGTCGGTGATTTCTT GTTACGGCAACAGCGCTGATGGCACGTTGCCGGCTTCGAACATCGCGTCGGTGATTTCTT ************************************************************
60 60 60 60
MIE AD169 3157 3301
GCTTGCCCGGCGTCACACGGTGACGCAGCAGCACGCGGCTCACGTAGCAGGCCGACTCGC GCTTGCCCGGCGTCACACGGTGACGTAGCAGCACGCGGCTCACGTAGCAGGCCGACTCGC GCTTGCCCGGCGTCACACGGTGACGTAGCAGCGCGCGGCTCACGTAGCAGGCCGACTCGC GCTTGCCCGGCGTCACACGGTGACGCAGCAGCGCGCGGCTCACGTAGCAGGCCGACTCGC ************************* ****** ***************************
120 120 120 120
MIE AD169 3157 3301
GGATGACTTGGCCGTCGGCGTCGCGTCGCAGGCCCGAGCGGTTGCCGTGACGCAGTCGGC GGATGACCTGGCCGTCGGCGTCGCGTCGCAGGCCCGAGCGGTTGCCGTGACGCAGTCTGC GGATGACTTGGCCGTCGGCGTCGCGTCGCAGGCCCGAGCGGTTGCCGTGACGCAGTCTGC GGATGACCTGGCCGTCGGCGTCGCGTCGCAGGCCCGAGCGGTTGCCGTGACGCAGTCGGC ******* ************************************************* **
180 180 180 180
MIE AD169 3157 3301
CCTGCGCAGCGCGCTCCACGTCTTCAAAGTAGCTGTGTAGCAGGCCGCGCTCCAGCAGCT CCTGCGCAGCGCGCTCCACGTCTTCAAAGTAGCTGTGTAGCAGGCCGCGCTCCAGCAGCT CCTGCGCAGCGCGCTCCACGTCTTCAAAGTAGCTGTGTAGCAGGCCGCGCTCCAGCAGCT CCTGCGCGGCGCGCTCCACGTCTTCAAAGTAGCTGTGTAGCAGGCCGCGCTCCAGCAGCT ******* ****************************************************
240 240 240 240
MIE AD169 3157 3301
GCGGCAGCGAGTCGGCGGCGCGCACTACAAAGTTCTCACGGCTGATCTCGTAGCACAGCA GCGGCAGCGAGTCGGCGGCGCGCACTACAAAGTTCTCACGGCTGATCTCGTAGCACAGCA GCGGCAGCGAGTCGGCGGCGCGCACCACAAAGTTCTCACGGCTGATCTCGTAGCACAGCA GCGGCAGCGAGTCGGCGGCGCGCACCACAAAGTTCTCACGGCTGATCTCGTAGCACAGCA ************************* **********************************
300 300 300 300
MIE AD169 3157 3301
CGCTGCCGTCAGCTGCCACGCCGGCCACGCTGCGGTCCCAACTGAAAAGGTTGGCGAGTC CGCTGCCGTCGGCCGCCACGCCGGCCACGCTGCGGTCCCAACTGAAAAGGTTGGCGAGTC CGCTGCCGTCAGCCGCCACGCCGGCCACGCTGCGGTCCCAACTGAAAAGGTTGGCGAGTC CGCTGCCGTCGGCTGCCACGCCGGCCACGCTGCGGTCCCAACTGAAGAGGTTGGCGAGTC ********** ** ******************************** *************
360 360 360 360
MIE AD169 3157 3301
CGATGATGCCGATG CGATGGTGCCGATG CGATGGTGCCGATG CGATGGTGCCGATG
374 374 374 374
***** *********
Figure 4-8: Multiple Sequence Alignment between Sequenced MIE promoter with the published HCMV wild type 3301 and 3157 and Lab strain AD169. Sequence of MIE promoter is about 370bp. Nucleotide which differs from published sequence are shown in bold and black color, also no star seen when there is a difference and the gap is shown with a dash.
62
Results
Wild 3301 3157 IE AD169
-----GAATCCGCGTTCCAATGCACCGTTCCCGGCCGCGGAGGCTGGATCGGTCCCGGTG ACGGGGAATCCGCGTTCCAATGCACCGTTCCCGGCCGCGGAGGCTGGATCGGTCCCGGTG ACGGGGAATCCGCGTTCCAATGCACCGTTCCCGGCCGCGGAGGCTGGATCGGTCCCGGTG ACGGGGAATCCGCGTTCCAATGCACCGTTCCCGGCCGCGGAG-CTGGATCGGTCCCGGTG ACGGGGAATCCGCGTTCCAATGCACCGTTCCCGGCCGCGGAGGCTGGATCGGTCCCGGTG ************************************* *****************
55 60 60 60 60
Wild 3301 3157 IE AD169
TCTTCTATGGAGGTCAAAACAGCGTGGATGGCGTCTCCAGGCGATCTGACGGTTCACTAA TCTTCTATGGAGGTCAAAACAGCGTGGATGGCGTCTCCAGGCGATCTGACGGTTCACTAA TCTTCTATGGAGGTCAAAACAGCGTGGATGGCGTCTCCAGGCGATCTGACGGTTCACTAA TCTTCTATGGAGGTCAAAACAGCGTGGATGGCGTCTCCAGGCGATCTGACGGTTCACTAA TCTTCTATGGAGGTCAAAACAGCGTGGATGGCGTCTCCAGGCGATCTGACGGTTCACTAA ************************************************************
115 120 120 120 120
Wild 3301 3157 IE AD169
ACGAGCTCTGCTTATATAGACCTCCCAATCGTACACGCCTACCGCCCATTTGCGTCAATG ACGAGCTCTGCTTATATAGACCTCCCA-TCGTACACGCCTACCGCCCATTTGCGTCAATG ACGAACTCTGCTTATATAGACCTCCCA-TAGTACACGCCTACCGCCCATTTGCGTCAATG ACGAACTCTGCTTATATAGACCTCCCAACCGTACACGCCTACCGCCCATTTGCGTCAATG ACGAGCTCTGCTTATATAGACCTCCCA-CCGTACACGCCTACCGCCCATTTGCGTCAATG **** ********************** ******************************
175 179 179 179 179
Wild 3301 3157 IE AD169
GGGCGGAGTTATTACGACATTTT-GGAAAGTCCCGTTGAATTTGGTGCCAAAACAAACTC GGGCGGAGTTATTACGACATTTTTGGAAAGTCCCGTTGAATTTGGTGCCAAAACAAACTC GGGCGGAGTTATTACGACATTTT-GGAAAGTCCCGTTGAATTTGGTGCCAAAACAAACTC GGGCGGAGTTGTTACGACATTTT-GGAAAGTCCCGTTGATTTTGGTGCCAAAACAAACTC GGGCGGAGTTGTTACGACATTTT-GGAAAGTCCCGTTGATTTTGGTGCCAAAACAAACTC ********** ************ *************** ********************
234 239 238 238 238
Wild 3301 3157 IE AD169
CCATTGACGTCAATGGGGTGGAGACTTGGAAATCCCCGTGAGTCAAACCGCTATCCACGC CCATTGACGTCAATGGGGTGGAGACTTGGAAATCCCCGTGAGTCAAACCGCTATCCACGC CCATTGACGTCAATGGGGTGGAGACTTGGAAATCCCCGTGAGTCAAACCGCTATCCACGC CCATTGACGTCAATGGGGTGGAGACTTGGAAATCCCCGTGAGTCAAACCGCTATCCACGC CCATTGACGTCAATGGGGTGGAGACTTGGAAATCCCCGTGAGTCAAACCGCTATCCACGC ************************************************************
294 299 298 298 298
Wild 3301 3157 IE AD169
CCATTGATGTACTGCCAAAACCGCATCACCATGGTAATAGCGATGACTAATACGTAGATG CCATTGATGTACTGCCAAAACCGCATCACCATGGTAATAGCGATGACTAATACGTAGATG CCATTGATGTACTGCCAAAACCGCATCACCATGGTAATAGCGATGACTAATACGTAGATG CCATTGATGTACTGCCAAAACCGCATCACCATGGTAATAGCGATGACTAATACGTAGATG CCATTGATGTACTGCCAAAACCGCATCACCATGGTAATAGCGATGACTAATACGTAGATG ************************************************************
354 359 358 358 358
Wild 3301 3157 IE AD169
TACTGCCAAGTAGGAAAGTCCCGTAAGGTCATGTACTGGGCATAATGCCAGGCGGGCCAT TACTGCCAAGTAGGAAAGTCCCGTAAGGTCATGTACTGGGCATAATGCCAGGCGGGCCAT TACTGCCAAGTAGGAAAGTCCCGTAAGGTCATGTACTGGGCATAATGCCAGGCGGGCCAT TACTGCCAAGTAGGAAAGTCCCATAAGGTCATGTACTGGGCATAATGCCAGGCGGGCCAT TACTGCCAAGTAGGAAAGTCCCATAAGGTCATGTACTGGGCATAATGCCAGGCGGGCCAT ********************** *************************************
414 419 418 418 418
Wild 3301 3157 IE AD169
TTACCGTCATTGACGTCAATAGGGGGCGTACTTGGCATATGATACACTTGATGTACTGCC TTACCGTCATTGACGTCAATAGGGGGCGTACTTGGCATATGATACACTTGATGTACTGCC TTACCGTCATTGACGTCAATAGGGGGCGTACTTGGCATATGATACATTTGATGTACTGCC TTACCGTCATTGACGTCAATAGGGGGCGTACTTGGCATATGATACACTTGATGTACTGCC TTACCGTCATTGACGTCAATAGGGGGCGTACTTGGCATATGATACACTTGATGTACTGCC ********************************************** *************
474 479 478 478 478
Wild 3301 3157 IE AD169
AAGTGGGCAGTTTACCGTAAATACTCCACCCATTGACGTCAATGGAAAGTCCCTATTGGC AAGTGGGCAGTTTACCGTAAATACTCCTCCCATTGACGTCAATGGAAAGTCCCTATTGGC AAGTGGGCAGTTTACCGTAAATACTCCACCCATTGACGTCAATGGAAAGTCCCTATTGGC AAGTGGGCAGTTTACCGTAAATACTCCACCCATTGACGTCAATGGAAAGTCCCTATTGGC AAGTGGGCAGTTTACCGTAAATACTCCACCCATTGACGTCAATGGAAAGTCCCTATTGGC *************************** ********************************
534 539 538 538 538
63
Results
Wild 3301 3157 IE AD169
GTTACTATGGGAAC-TCACGTCAATATTGACGTCAATGGGCGGGGGTCGTTGGGCGGTCA GTTACTATGGGAAC-CCACGTCATTATTGACGTCAATGGGCGGGGGTCGTTGGGCGGTCA GTTACTATGGGAAC-TCACGTCATTATTGACGTCAATAGGCGGGGGTCGTTGGGCGGTCA GTTACTATGGGAACGATACGTCATTATTGACGTCAATGGGCGGGGGTCGTTGGGCGGTCA GTTACTATGGGAAC-ATACGTCATTATTGACGTCAATGGGCGGGGGTCGTTGGGCGGTCA ************** ****** ************* **********************
593 598 597 597 597
Wild 3301 3157 IE AD169
GCCAGGCGGGCCATTTACCGTAAGTTATGTAACGCGGGAACTCCATATATGGGCTATGAA GCCAGGCGGGCCATTTACCGTAAGTTATGTAACGCGG-AACTCCATATATGGGCTATGAA GCCAGGCGGGCCATTTACCGTAAGTTATGTAACGCGG-AACTCCATATATGGGCTATGAA GCCAGGCGGGCCATTTACCGTAAGTTATGTAACGCGG-AACTCCATATATGGGCTATGAA GCCAGGCGGGCCATTTACCGTAAGTTATGTAACGCGG-AACTCCATATATGGGCTATGAA ************************************* **********************
653 657 656 656 656
Wild 3301 3157 IE AD169
CTAATGACCCCGTAATTGATTACTATTAATAACTAGTCAATAATCAATGTCAACATGGCG CTAATGACCCCGTAATTGATTACTATTAATAACTAGTCAATAATCAATGTCAACATGGCG CTAATGACCCCGTAATTGATTACTATTAATAACTAGTCAATAATCAATGTCAACATGGCG CTAATGACCCCGTAATTGATTACTATTAATAACTAGTCAATAATCAATGTCAACATGGCG CTAATGACCCCGTAATTGATTACTATTAATAACTAGTCAATAATCAATGTCAACATGGCG ************************************************************
713 717 716 716 716
Wild 3301 3157 IE AD169
GTCATATTGGACATGAGCCAATATAAATGTACATATTATGCTATAGCTGCAATGTATGCA GTCATATTGGACATGAGCCAATATAAATGTACATATTATGATATAGCTGCAATGTATGCA GTCATATTGGACATGAGCCAATATAAATGTACACATTATGATATAGATGCAACGTATGCA GTAATGTTGGACATGAGCCAATATAAATGTACATATTATGCTATGGCTACAACGTATGCA GTAATGTTGGACATGAGCCAATATAAATGTACATATTATGATATGGATACAACGTATGCA ** ** *************************** ****** *** * * *** *******
773 777 776 776 776
Wild 3301 3157 IE AD169
ATGGCCATTAGCCAATATTGATTTATGCTATATAACCAATGACTAATATGGCTAATAGCC ATGGCCATTAGCCAATATTGATTTATGCTATATAACCAATGACTAATATGGCTAATGGCC ATGGCCATTAGCCAATATTGATTTACGCTATATAACCAATGACTAATATGGCTAATGGCC ATGGCCAATAGCCAATATTGATTTACGCTATATAACCAATGAATAATATGGCTAATAGCC ATGGCCAATAGCCAATATTGATTTATGCTATATAACCAATGAATAATATGGCTAATGGCC ******* ***************** **************** ************* ***
833 837 836 836 836
Wild 3301 3157 IE AD169
AATATTGATTCAATGTATATATCGATATGCATTGGCCATGTGCC-AATATTGATTCAATGTATATATCGATATGCATTGGCCATGTGCCAAATATTGATTCAATGTATATATCGATATGCATTGGCCATGTGCCAAATATTGATTCAATGTATATATCGATATGCATTGGCCATGTGCCAG AATATTGATTCAATGTATAGATCGATATGCATTGGCCATGTGCCAG ******************* ************************
877 882 881 882 882
Figure 4-9: Multiple Sequence Alignment between Sequenced IE promoter with the published HCMV wild type 3301 and 3157 and Lab strain AD169. IE promoter sequence is about 880bp. Nucleotide which differs from published sequence are shown in bold and black color, also no star is seen when there is a difference and the gap is shown with a dash.
64
Results
E1 AD169 3157 3301
AAGACGTAGGCAGGGGAATTCCCATATTTTTATGGCTTCTTTTAAAAGTCTGTATCCGAC AAGACGTAGGCAGGGGAATTCCCATATTTTTATGGCTTCTTTTAAAAGTCTGTATCCGAC AAGACGTAGGCAGGGGAATTCCCATATTTTTATGGCTTCTTTTAAAAGTCTGTATCCGAC AAGACGTAGGCAGGGGAATTCCCATATTTTTATGGCTTCTTTTAAAAGTCTGTGTCCGAC ***************************************************** ******
60 60 60 60
E1 AD169 3157 3301
TCCATCCGGCGCTTTTCCCAAACCGTGGTCTCCTCGTCGTCCGACTCGGTACCCAGGAGG TCCATCCGGCGCTTTTCCCAAACCGTGGTCTCCTCGTCGTCCGACTCGGTACCCAGGAGG TCCATCCGGCGCTTTTCCCAAACCGTGGTCTCCTCGTCGTCCGACTCGGTACCCAGGAGG TCCATTCGGCGCTTTTCCCAAACCGTGGTCTCCTCGTCGTCCGACTCGGTACCCAGGAGG ***** ******************************************************
120 120 120 120
E1 AD169 3157 3301
TGGTAAGTCTTTTGCCGCACGTAGAAAGCTTTCAACGTGGAGCAAAAGATGAGAATAAAG TGGTAAGTCTTTTGCCGCACGTAGAAAGCTTTCAACGTGGAGCAAAAGATGAGAATAAAG TGGTAAGTCTTTTGCCGCACGTAGAAAGCTTTCAACGTGGAGCAAAAGATGAGAATAAAG TGGTAAGTCTTTTGCCGCACGTAGAAAGCTTTCAACGTGGAGCAAAAGATGAGAATAAAG ************************************************************
180 180 180 180
E1 AD169 3157 3301
ACCCCGAAAACGAAACAAACCACGCCGATCATGCCGATGCAGACGTTCATGTCGACGTAG ACCCCGAAAACGAAACAAACCACGCCGATCATGCCGATGCAGACGTTCATGTCGACGTAG ACCCCGAAAACGAAACAAACCACGCCGATCATGCCGATGCAGACGTTCATGTCGACGTAG ACCCCGAAAACGAAACAAACCACGCCGATCATGCCGATGCAGACGTTCATGTCGACGTAG ************************************************************
240 240 240 240
E1 AD169 3157 3301
CCGGCGGTGCTGTTGGCGGTGCGGCAAAAGAGTGTCATGTCGTGCGTGCACAAAAAACAA CCGGCGGTGCTGTTGGCGGTGCGGCAAAAGAGTGTCATGTCGTGCGTGCACAAAAAACAA CCGGCGGTGCTATTGGCGGTGCGGCAAAAGAGTGTCATGTCGTGCGTGCACAAAAAACAA CCGGCGGTGCTGTTGGCGGTGCGGCAAAAGAGTGTCATGTCGTGCGTGCACAAAAAACAC *********** ***********************************************
300 300 300 300
E1 AD169 3157 3301
CACACACCACAGGCCAGGTCGTAGCGTAGTTATTATTCCGTAGCAGCAATGATGGTACAG CACACACCACAGGCCAGGTCGTAGCGTAGTTATTATTCCGTAGCAGCAATGATGGTACAG CACACACCACAGGCCAGGTCGTAGCGTAGTTATTATTCCGTAGCAGCAATGATGGTACAG CACACACCACAGGCCAGGTCGTAGCGTAGTTATTATTCCGTAGCAGCAATGATGGTACAG ************************************************************
360 360 360 360
E1 AD169 3157 3301
TCAAGCACATGCTCTATC-CCCGTTACCCCGATGATGCT---TGCGGAAATCCCCGTTGT TCAAGCACATGCTCTATC-CCCGTTACCCCGATGATGCT---TGCG----TCCCCGTTGT TCAAGCACATGCTCTATC-CCCGTTACCCT-ATGTTGAT---TGTC----TCCCCGTTGT TCAAGCACATGCTCTATTTCCCGTTACCCCGATGAGGGAGC-TGCAGAAACCCCCGCTGC ***************** ********** *** * ** ***** **
412 412 411 419
E1 AD169 3157 3301
TATATTGGCACTGTCCCGGTTAATCACCACGGTGAACACCACGGCCAAGAAAATGATCCC TATATTGGCACTGTCCCGGTTAATCACCACGGTGAACACCACGGCCAAGAAAATGATCCC TGTATTGGAACTGTCCCGGTTAATCACCACGGTGAACACCACGGCCAAGAAAATGATCCC TGTATTGGAACTGTCCCGGTTAATCACCACGGTGAACACCACGGCCAAGAAAATGATCCC * ****** ***************************************************
472 472 471 479
E1 AD169 3157 3301
TAATATAGCGACCACTAAGAGAGCAAAAGTCCATTTCCAGCCGTTGTCAAAGTACGCCCC TAATATAGCGACCACTAAGAGAGCAAAAGTCCATTTCCAGCCGTTGTCAAAGTACGCCCC TAATATAGCGACCACTAAGAGAGCAAAAGTCCATTTCCAGCCGTTGTCAAAGTACGCCCC TAATATAGCGACCACTAAGAGAGCAAAAGTCCATTTCCAGCCGTTGTCAAAGTACGCCCC ************************************************************
532 532 531 539
E1 AD169 3157 3301
CGTGGTGGGATGCATGGTGGCGGGCATTTCCATCATGTCCATGTCGAACGTGTGTCGCGG CGTGGTGGGATGCATGGTGGCGGGCATTTCCATCATGTCCATGTCGAACGTGTGTCGCGG CGTGGTGGGATGCATGGTGGCGGGCATTTCCATCATATCCATGTCGAACGTGTGTCGCGG CGTGGTGGGATGCATGGTGGCGGGCATTTCCATCATATCCATGTCGAACGTGTGTCGCGG ************************************ ***********************
592 592 591 599
E1 CGACGGCGAACTAACCAGGCAGTACGGGGGTCGATAGGGCGGTGGGCTGCAGTCGGGTGG 652 AD169 CGACGGCGAACTAACCAGGCAGTACGGGGGTCGATAGGGCGGTGGGCTGCAGTCGGGTGG 652
65
Results
3157 3301
CGACGGCGAACTAACCAGGCAGTACGGGGGTCGATAGGGCGGTGGGCTGCAGTCGGGTGG 651 CGACGGCGAACTAACCAGGCAGTACGGGGGTCGATAGGGCGGTGGGCTGCAGTCGGGTGG 659 ************************************************************
E1 AD169 3157 3301
TGGCGGCGGTGGCGTGGAAACCGTCGTCGGGCACAGACCCATGGCCTGCTCGTAGGTGGG TGGCGGCGGTGGCGTGGAAACCGTCGTCGGGCACAGACCCATGGCCTGCTCGTAGGTGGG CGGCGGTGGTGGCGTGGAAACCGTCGTCGGGCACAGACCCATGGCCTGCTCGTAGGTGGG TGGCGGCGGTGGCGTGGAAACCGTCGTCGGGCACAGACCCATGGCCTGCTCGTAGGTGGG ***********************************************************
712 712 711 719
E1 AD169 3157 3301
GGGCGCGTCGTCGTGATCCCGGTCGCGCAGCATCGGCGTGGGCTCCATGTCGGTGGCAGT GGGCGCGTCGTCGTGATCCCGGTCGCGGAGCATCGGCGTGGGCTCCATGTCGGTGGCAGT GGGCGCGTCGTCGTGATCCCGGTCGCGCAGCATCGGCGTGGGCTCCATGTCGGTGGCAGT GGGCGCGTCGTCGTGATCCCGGTCGCGGAGCATCGGCGTGGGCTCCATGTCGGTGGCAGT *************************** ********************************
772 772 771 779
E1 AD169 3157 3301
GACGGCGACGGTGGTAACTGTGGTGGAGACGATACCGACGGCGTCCGCGGTTCACCTTCG GACGGCGACGGTGGTAACTGTGGTGGAGACGGTACCGACGGCGTCCGCGGTTCACCTTCG GACGGCGACGGTGGTAACTGTGGTGGAGACGATACCGACGGCGTCCGCGGATCACCTTCG GACGGCGACGGTGGTAACTGTGGTGGAGACGGTACCGACGGCGTCCGCGGCTCACCTTCG ******************************* ****************** *********
832 832 831 839
E1 AD169 3157 3301
AGCAAAGAGCCCCTTCTTTTTGCGCAAACGACGGCAAAACAGTTCTCTGGGACAACCGGT AGCAAAGAGCCCCTTCTTTTTGCGCAAACGACGGCAAAACAGTTCTCTGGGACAACCGGT AGCAAAGAGCCCCTTCTTTTTGCGCAAACGACGGCAAAACAGTTCTCTGGGACAGCCGGT AGCAAAGAGCCCCTTCTTTTTACGCAAACGACGGCAAAACAGTTCTCTGGGACAGCCGGT ********************* ******************************** *****
892 892 891 899
E1 AD169 3157 3301
GGCGCGGTAAGCGGGTGCCACGCTTTCAGGGTGGGTAAAACAGTCGCGGGCGAAGCAGTA GGCGCGGTAAGCGGGTGCCACGCTTTCAGGGTGGGTAAAACAGTCGCGGGCGAAGCAGTA GGCGCGGTAAGCGGGTGCCACGCTTTCAGGGTGGGTAAAACAGTCGCGGGCGAAGCAGTA GGCGCGGTAAGCGGGCGCCACGCTTTCAGGGTGGGTAAAACAGTCGCGGGCGAAGCAGTA *************** ********************************************
952 952 951 959
E1 AD169 3157 3301
GTTGTTGCAGAACCGCAAGAACCCG GTTGTTGCAGAACCGCAAGAACCCG GTTGTTGCAGAACCGCAAGAACCCG GTTGTTGCAGAACCGCAAGAACCCG *************************
977 977 976 984
Figure 4-10: Multiple Sequence Alignment between Sequenced E1 promoter with the published HCMV wild type 3301 and 3157 and Lab strain AD169. IE promoter sequence is about 975bp. Nucleotide which differs from published sequence are shown in bold and black color, also no star is seen when there is a difference and the gap is shown with a dash.
66
Results
3157 3301 E2 AD169
TCAATTACTCGTCCTCATCCTCCGCGGTCTCTTCTTCCTCCAACAACCACCACCACCATC TCAATTACTCGTCCTCATCCTCCGCGGTCTCTTCTTCCTCCAACAACCACCACCACCATC TCAATTACTCGTCCTCATCCTCCGCGGTCTCTTCTTCCTCCAACAACCACCACCACCATC TCAATTACTCGTCCTCATCCTCCGCGGTCTCTTCTTCCTCCAACAACCACCACCACCATC ************************************************************
60 60 60 60
3157 3301 E2 AD169
ATCACCACCATAACGCCGTGACGGACGTGGCCGCCGGCACCGACGGTGCGTTACTTCTAC ATCACCACCATAACGCCGTGACGGACGTGGCCGCCGGCACCGACGGTGCGTTACTTCTAC ATCACCACCATAACGCCGTGACGGACGTGGCCGCCGGCACCGACGGTGCGTTACTTCTAC ATCACCACCATAACGCCGTGACGGACGTGGCCGCCGGCACCGACGGTGCGTTACTTCTAC ************************************************************
120 120 120 120
3157 3301 E2 AD169
CCATTGAGCGCGGAGCGGTGGTTTCGTCG-C--CGT---CGTCGCCGTCGTCACTTCTTT CCATTGAGCGCGGAGCGGTGGTTTCGTCGCCGTCGTCGACGTCGCCGTCGTCACTTCTTT CCATTGAGCGCGGAGCGGTGGTTTCGTCG-CGTCGTCGTCGTCGCCGTCGTCACTTCTTT CCATTGAGCGCGGAGCGGTGGTTTCGTCGCCGTCGTCGACGTCGCCGTCGTCACTTCTTT ***************************** * *** *********************
174 180 180 180
3157 3301 E2 AD169
CGCTCCCTCGACCCAGCAGCGCCCACAGCGCGGGCGAGACGGTGCAGGAGTCCGAGGCGG CGCTCCCTCGACCCAGCAGCGCCCACAGCGCGGGCGAGACGGTGCAGGAGTCCGAGGCGG CGCTCCCTCGACCCAGCAGCGCCCACAGCGCGGGCGAGACGGTGCAGGAGTCCGAGGCGG CGCTCCCTCGACCCAGCAGCGCCCACAGCGCGGGCGAGACGGTGCAGGAGTCCGAGGCGG ************************************************************
234 240 240 240
3157 3301 E2 AD169
CGGCGACGGCGGCGGCTGCGGGGTTAATGATGATGAGGAGGATGAGGAGGGCTCCGGCTG CGGCGACGGCGGCGGCTGCGGGGTTAATGATGATGAGGAGGATGAGGAGGGCTCCGGCTG CGGCGACGGCGGCGGCTGCGGGGTTAATGATGATGAGGAGGATGAGGAGGGCTCCGGCTG CGGCGACGGCGGCGGCTGCGGGGTTAATGATGATGAGGAGGATGAGGAGGGCTCCGGCTG ************************************************************
294 300 300 300
3157 3301 E2 AD169
AGGCGGCGGAGGCACCACCGCAGTCGGAGGAGGAGAATGATTCCACCACTCCAGTCTCTA AGGCGGCGGAGGCACCACCGCAGTCGGAGGAGGAGAATGATTCCACCACTCCAGTCTCTA AGGCGGCGGAGGCACCACCGCAGTCGGAGGAGGAGAATGATTCCACCACTCCAGTCTCTA AGGCGGCGGAGGCACCACCGCAGTCGGAGGAGGAGAATGATTCCACCACTCCAGTCTCTA ************************************************************
354 360 360 360
3157 3301 E2 AD169
ACTGCCGTGTTCCTCCGAATTCGCAGGAATCCGCGGCGCCTCAGCCTCCTCGCAGTCCGC ACTGCCGTGTTCCTCCGAATTCGCAGGAATCCGCGGCGCCTCAGCCTCCTCGCAGTCCGC ACTGCCGTGTTCCTCCGAATTCGCAGGAATCCGCGGCGCCTCAGCCTCCTCGCAGTCCGC ACTGCCGTGTTCCTCCGAATTCGCAGGAATCCGCGGCGCCTCAGCCTCCTCGCAGTCCGC ************************************************************
414 420 420 420
3157 3301 E2 AD169
GTTTTGATGACATTATACAGTCATTGACCAAAATGCTCAATGATTGTAAGGAGAAAAGAT GTTTTGATGACATTATACAGTCATTGACCAAAATGCTCAATGATTGTAAGGAGAAAAGAT GTTTTGATGACATTATACAGTCATTGACCAAAATGCTCAATGATTGTAAGGAG---AGAT GTTTTGATGACATTATACAGTCATTGACCAAAATGCTCAATGATTGTAAGGAGAAAAGAT ***************************************************** ****
474 480 480 480
3157 3301 E2 AD169
TGTGCGATCTCCCCCTGGTTTCCAGCAGACTC TGTGCGATCTCCGCCTGGTTTCCAGCAGACTC TGTGCGATCTCCGCCTGGTTTCCAGCAGACTC TGTGCGATCTCCCCCTGGTTTCCAGCAGACTC ************ *******************
506 512 512 512
Figure 4-11: Multiple Sequence Alignment between Sequenced E2 promoter with the published HCMV wild type 3301 and 3157 and Lab strain AD169. IE promoter sequence is about 510bp. Nucleotide which differs from published sequence are shown in bold and black color, also no star is seen when there is a difference and the gap is shown with a dash.
67
Results
3157 3301 L AD169
TCTACGTCGACACGACGTGCTGGAGCGTTTCGCGGCCGCGGCTGAGCCTTTGCCGTCGCT TCTACGTCGACACGACGTGCTGGAGCGTTTCGCGGCCGCGGCTGAGCCTTTGCCGTCGCT TCTACGTCGACACGACGTGCTGGAGCGTTTCGCGGCCGCGGCTAAGCCTTTGCCGTCGCT TCTACGTCGACACGACGTGCTGGAGCGTTTCGCGGCCGCGGCTAAGCCTTTGCCGTCGCT ******************************************* ****************
60 60 60 60
3157 3301 L AD169
TTGTGTGCATGATTATGCGTTACGCAATGCTGACCGTGTTACCTACGACGGCGAATTAAT TTGTGTGCGTGATTATGCGTTACGCAATGCTGACCGTGTTACCTACGACGGCGAATTAAT TTGTGTGCGTGATTATGCGTTACGCAATGCTGACCGTGTTACCTACGACGGCGAATTAAT TTGTGTGCGTGATTATGCGTTACGCAATGCTGACCGTGTTACCTACGACGGCGAATTAAT ******** ***************************************************
120 120 120 120
3157 3301 L AD169
CTACGGCAGTTACCTGTTGTATCGCAAGGCTCACGTGGAGCTGTCACTCTCCAGCAACAA CTACGGCAGTTACCTGTTGTATCGCAAGGCTCACGTGGAGCTGTCACTCTCCAGCAACAA CTACGGCAGTTACCTGTTGTATCGCAAGGCTCACGTGGAGCTGTCACTCTCCAGCAACAA CTACGGCAGTTACCTGTTGTATCGCAAGGCTCACGTGGAGCTGTCACTCTCCAGCAACAA ************************************************************
180 180 180 180
3157 3301 L AD169
GGTGCAATACGTGGAAGCCGTGCTGCGACAGGTGTACACGCCGGGCTTGTTAGATCATCA GGTGCAACACGTGGAAGCCGTGCTGCGACAGGTGTACACGCCGGGCTTGTTAGATCATCA GGTGCAATACGTGGAAGCCGTGCTGCGACAGGTGTACACGCCGGGCTTGTTAGATCATCA GGTGCAACACGTGGAAGCCGTGCTGCGACAGGTGTACACGCCGGGCTTGTTAGATCATCA ******* ****************************************************
240 240 240 240
3157 3301 L AD169
CAACGTGTGCGACGTGGAGGCCCTGCTGTGGCTGCTGTACTGTGGACCGCGCAGCTTTTG CAACGTGTGCGACGTGGAGGCCCTGCTGTGGCTGCTGTACTGTGGACCGCGCAGCTTTTG CAACGTGTGCGACGTGGAGGCCCTGCTGTGGCTGCTGTACTGTGGACCGCGCAGCTTTTG CAACGTGTGCGACGTGGAGGCCCTGCTGTGGCTGCTGTACTGTGGACCGCGCAGCTTTTG ************************************************************
300 300 300 300
3157 3301 L AD169
CGCGCGTGACACCTGTTTCGGTCGCGAAAAGAACGGTTGTCCTTTCCCCGCGTTGTTGCC CGCGCGTGACACCTGTTTCGGTCGCGAAAAGAACGGTTGTCCTTTCCCCGCGTTGTTGCC CGCGCGTGACACCTGTTTCGGTCGCGAAAAGAACGGTTGTCCTTTCCCCGCGTTGTTGCC CGCGCGTGACACTTGTTTCGGTCGCGAAAAGAACGGTTGTCCTTTCCCCGCGTTGTTGCC ************ ***********************************************
360 360 360 360
3157 3301 L AD169
CAAACTCTTTTACGAACCCGTGCGGGACTATATGACCTACATGAATCTGGCTGAGCTGTA CAAACTCTTTTACGAACCCGTGCGGGACTATATGACCTACATGAATCTGGCTGAGCTGTA CAAACTCTTTTACGAACCCGTGCGGGACTATATGACCTACATGAATCTGGCTGAGCTGTA CAAACTCTTTTACGAACCCGTGCGGGACTATATGACCTACATGAATCTGGCTGAGCTGTA ************************************************************
420 420 420 420
3157 3301 L AD169
CGTCTTTGTTTGGTATCGCGGCTACGAATTCCCTGCGCCAACGCCGCAGGCGACGACGGC CGTCTTTGTTTGGTATCGCGGCTACGAATTCCCTGCGCCGACGCCGCAGGCGACGACGGC CGTCTTTGTTTGGTATCGCGGCTACGAATTCCCTGCGCCAACGCCGCAGGCGACGACGGC CGTCTTTGTTTGGTATCGCGGCTACGAATTCCCTGCGCCGACGCCGCAGGCGACGACGGC *************************************** ********************
480 480 480 480
3157 3301 L AD169
GGGTGGTGGTGGTGGTGGTGGTAGTGGTGGCGGCGGCGGGGCCGGCGCTTGTGCGGTCGA G-----------------------------CGGCGGCGGGGCCGGCGCTTGTGCGGTCGA GGGTGGTGGTG------GTGGTAGTGGTCCCGGCGGCGGGGCCGGCGCTTGTGCGGTCGA GGGTGGTGGTG------GTGGTAGTGGTGGCGGCGGCGGGGCCGGCGCTTGTGCGGTCGA * ******************************
540 511 534 534
3157 3301 L AD169
GACGAGCGCGTCAGCAGGCCGGGTCGATGACGCCGGCGACGAGGTGCATTTGCCTTTA GACGAGCGCGTCAGCAGGCCGGGTCGATGACGCCGGCGACGAGGTGCATTTGCCTTTA GACGAGCGCGTCAGCAGGCCGGGTCGATGACGCCGGCGACGAGGTGCATTTGCCTTTA GACGAGCGCGTCAGCAGGCCGGGTCGATGACGCCGGCGACGAGGTGCATTTGCCTTTA **********************************************************
68
558 569 592 592
Results
Figure 4-12: Multiple Sequence Alignment between Sequenced L promoter with the published HCMV wild type 3301 and 3157 and Lab strain AD169. IE promoter sequence is about 590bp. Nucleotide which differs from published sequence are shown in bold and black color, also no star is seen when there is a difference and the gap is shown with a dash.
US AD169 3157 3301
CCGGCTTTAGTGATTCCATCGGGCAGGCGGATCAAGGGACCCATGGAGGTCCAAAGACCC CCGGCTTTAGTGATTCCATCGGGCAGGCGGATCAAGGGACCCATGGAGGTCCAAAGACCC CCGGCTTTAGTGATTCCATCGGGCAGGCGGATCAAGGGACCCATGGAGGTCCAAAGACCC CCGGCTTTAGTGATTCCATCGGGCAGGCGGATCAAGGGACCCATGGAGGTCCAAAGACCC ************************************************************
60 60 60 60
US AD169 3157 3301
ACCCAGGCTTTCCAGAGATTGTTCATGGTGAAACAGCGTGTGGACTGTACGCTCTTTCCC ACCCAGGCTTTCCAGAGATTGTTCATGGTGAAACAGCGTGTGGACTGTACGCTCTTTCCC ACCCAGGCTTTCCAGAGATTGTTCATGGTGAAACAGCGTGTGGACTGTACGCTCTTTCCC ACCCAGGCTTTCCAGAGATTGTTCATGGTGAAACAGCGTGTGGACTGTACGCTCTTTCCC ************************************************************
120 120 120 120
US AD169 3157 3301
AATTTATATCCCAGAGTAGTGACGTGAGCCCAGCCACCTCCCAGATTCCTGACGTTTTGG AATTTATATCCCAGAGTAGTGACGTGAGCCCAGCCACCTCCCAGATTCCTGACGTTTTGG AATTTATATCCCAGAGTAGTGACGTGAGCCCAGCCACCTCCCAGATTCCTGACGTTTTGG AATTTATATCCCAGAGTAGTGACGTGAGCCCAGCCACCTCCCAGATTCCTGACGTTTTGG ************************************************************
180 180 180 180
US AD169 3157 3301
TTGTCTTTCCTGCCAATTCCTCCCGTAAACTTATGATTATCCTAGCCCATTCCCGATAAA TTGTCTTTCCTGCCAATTCCTCCCGTAAACTTATGATTATCCTAGCCCATTCCCGATAAA TTGTCTTTCCTGCCAATTCCTCCCGTAAACTTATGATTATCCTAGCCCATTCCCGATAAA TTGTCTTTCCTGCCAATTCCTCCCGTAAACTTATGATTATCCTAGCCCGTTCCCGATAAA ************************************************ ***********
240 240 240 240
US AD169 3157 3301
AATACACGGAGACAGTAGATAGAGTTACGAATAAACCGGTTTATTTATTCAAGTGTCTCA AATACACGGAGACAGTAGATAGAGTTACGAATAAACCGGTTTATTTATTCAAGTGTCTCA AATACACGGAGACAGTAGATACAGTTACGAATAAACCGGTTTATTTATTCAAGTGTCTCA AATACACGGAGACAGTAGATAG--TTACGAATAAACCGGTTTATTTATTCAAGTGTCTCA ********************* ************************************
300 300 300 298
US AD169 3157 3301
GGAGATTATTGAGCGAGCGTGGATACCACGCCGTCGTCAGTTCATGGTGGCATTGAGCAG GGAGATTATTGAACGAGCGTGGATACCACGCCGTCGTCAGTTCATGGTGGCATTGAGCAG GGAGATTCTTGAACGAGCGTGGATACCACGCCGTCGTCAGTTCATGGTGGCATTGAGCAG GGAGATTCTTGAGCGAGCGTGGATACCACGCCGTCGTCAGTTCATGGTGGCATTGAGCAG ******* **** ***********************************************
360 360 360 358
US AD169 3157 3301
CCATAGCACCAGAGTCCCGGCGCCCGGTATCAGACACGCTGACCTACCGGGCGCCTTCGA CCATAGCACCAGAGTCCCGGCGCCCGGTATCAGACACGCTGACCTACCGGGCGCCTTCGA CCATAGCACCAGAGTCCCGGCGCCCGGTATCAGACACGCTGACCTACCGGGCGCCTTCGA CCATAGCACCAGAGTCCCGGCGCCCGGTATCAGACACGCTGACCTACCGGGCGCCTCCGA ******************************************************** ***
420 420 420 418
US AD169 3157 3301
GTCCGTACCCCGCGGCCTGGGTGTTAGAGTCCGTACCTTGCAGCCCAGGTAGGTTTCAGG GTCCGTACCCCGCGGCCTGGGTGTTAGAGTCCGTACCTTGCAGCCCAGGTAGGTTTCAGG GTCCGTACCCCGCGGCCTGGGTGTTAGAGTCCGTACCTTGCAGCCCAGGTAGGTTTCAGG GTCCGTACCCCGCGGCCTGGGTGTTAGAGTCCGTACCTGGCAACCCAGGTAGGTTTCAGG ************************************** *** *****************
480 480 480 478
US AD169 3157 3301
TACCAGCTGGTTCGTACCTGTTAAATAAATCGCAGACGGGCGCTCACCCCTACGGTCAGG TACCAGCTGGTTCGTACCTGTTAAATAAATCGCAGACGGGCGCTCACCCCTACGGTCAGG TACTAGCTGGTTCGTACCTGTTAAATAAATCGCAGACGGGCGCTCACCCCTACGGTCAGG TACCAGCTGGTTCGTACCTGTTAAATAAATCGCAGACGGGCGCTCACCCCTACGGTCAGG *** ********************************************************
540 540 540 538
US AD169 3157 3301
AGCACAAGAACAACCAGAGAGAACAGATATACGAGCAGGGTTCTGAACAGCAGACCCCAA AGCACAAGAACAACCAGAGAGAACAGATATACGAGCAGGGTTCTGAACAGCAGACCCCAA AGCACAAGAACAACCAGAGAGAACAGATATACGAGCAGGGTTCTGAACAGCAGACCCCAA AGCACAAGAACAACTAGAGAGAACAGATATACGAGCAGGGTTCTGAACAGCAGACCCCAA ************** *********************************************
600 600 600 598
69
Results
US AD169 3157 3301
TTGTCGTCTCTCATGCTTCGCTGAAGGTACCAGTTGATGGTCTGAGAGCTATAGTCCATC TTGTCGTCTCTCATGCTTCGCTGAAGGTACCAGTTGATGGTCTGAGAGCTATAGTCCATC TTGTCGTCTCTCATGCTTCGCTGAAGGTACCAGTTGATGGTCTGAGAGCTATAGTCCATC TTGTCGTCTCTCATGCTTCGCTGAAGGTACCACTTGATGGTCTGAGAGCTATAGTCCATC ******************************** ***************************
660 660 660 658
US AD169 3157 3301
CTCACCTGAGGAACACACGCGGCATATTTCTTGGGGTCTCCCCACCTCGTAGACAACGTG CTCACCTGAGGAACACACGCGGCATATTTCTTGGGGTCTCCCCACCTCGTAGACAACGTG CTCACCTGAGGAACACACGCGGCATATTTCTTGGGGTCTCCCCACTTCGTAGACAACGTG CTCACCTGGGGAACACACGCGGCATATTTCTTGGGGTCTCCCCACCTCGTAGACAACGTG ******** ************************************ **************
720 720 720 718
US AD169 3157 3301
ATGTCCACCATATCCACGGTGTGCGTCACCGGGTGCCCACCGATGTTCCACTCGAAATAG ATGTCCACCATATCCACGGTGTGCGTCACCGGGTGCCCACCGATGTTCCACTCGAAATAG ATGTCCACCATATCCACGGTGTGCGTCACCGGGTGCCCACCGATGTTCCACTCGAAATAG ATGTCCACCATATCCACGGTGTGCGTCACCGGGTGCCCACCGATGTTCCACTCGAAATAG ************************************************************
780 780 780 778
US AD169 3157 3301
GCTCCGCGCTCATCATGGTGGTACTGCTCACCGGACACATGCAGTCTGTCCATGTAAGAT GCTCCGCGCTCATCATGGTGGTACTGCTCACCGGACACCTGCAGTCTGTCCATGTAAGAT GCTCCGCGCTCATCATGGTGGTACTGCTCACCGGACACCTGCAGTCTGTCCATGTAAGAT GCTCCGCGCTCATCATGGTGGTACTGCTCACCGGACACTTGCAGTCTGTCCATGTAAGAT ************************************** *********************
840 840 840 838
US AD169 3157 3301
TGAGAGACGATACCCACGTTCACAAAGTGTTTCTTGGTGAAGTTGCCCGACATCCTCCCC TGAGAGACGATACCCACGTTCACAAAGTGTTTCTCGGTGAAGTTGCCCGACATCCTCCCC TGAGAGACGATACCCACGTTCACAAAGTGTTTCTCGGTGAAGTTGCCCGACATCCTCCCC TGAGAGACGATACCCACGTTCACAAAGTGTTTCTTGGTGAAGTTGCCCGACATCCTCCCC ********************************** *************************
900 900 900 898
US AD169 3157 3301
TTGA TTGA TTGA TTGA ****
904 904 904 902
Figure 4-13: Multiple Sequence Alignment between Sequenced US promoter with the published HCMV wild type 3301 and 3157 and Lab strain AD169. IE promoter sequence is about 900bp. Nucleotide which differs from published sequence are shown in bold and black color, also no star is seen when there is a difference.
70
Results
A
TaqI 36 Eco47III 14 NspV 36
NciI 67
EcoRII 126
Av aI 153
FspI 185
MboII 193
AlwNI 238 Pv uII 238
MboI 285 NdeII 285 Sau3AI 285 XmaIII 310 BglI 321 Av aII 334
MIE (374)
B Av aII 51 SstII 38 XmaIII 32
SstI 127 AluI 125
MseI 682 VspI 682 SpeI 688 HincII 707 HindII 707
Sty I 327 NcoI 327
BanIII 858 ClaI 858 TaqI 858 NsiI 867
IE (882)
C NgoAIV 240 HindII 233 HaeII 72 HincII 233 DraI 43 AccI 232 EcoRI 16 AluI 148 SalI 231
NspI 371
NsiI 546 Af lIII 580 BstXI 764 PstI 643 SstII 820 NcoI 691 FspI 855 Sty I 691 PinAI 887
DdeI 487
E-1 (977)
D NgoAIV 93 HaeIII 90
HindII 157 HincII 157 AccI 156 SalI 155
EcoRI 377 NarI 396
MseI 264
MboI 487 NdeII 487 Sau3AI 487 EcoRII 493
E-2 (512)
E SstII 39 XmaIII 33 NotI 33 HindII 8 HincII 8 AccI 7 SalI 6
Av aII 284 EcoO109I 259 Sau3AI 232 NdeII 232 MboI 232
VspI 116 MseI 116
BssHII 300 NruI 324
EcoRI 446
L (592)
F Sty I 41 NcoI 41 EcoO109I 37 Sau3AI 29 NdeII 29 MboI 29
PinAI 275
HaeIII 435 SstII 433
Pv uII 486 MseI 501
MunI 598
Cv nI 666 AccI 710
PstI 823
US (904)
Figure 4-14: Restriction Map of sequenced promoters. The restriction enzymes digest in only one site and in each Restriction map showing restriction site number behind each
71
Results
restriction enzyme. A: Restriction map of Major Immediate Early promoter (MIE). B: Restriction map of Immediate Early promoter (IE). C: Restriction map of Early-1 promoter (E-1). D: Restriction map of Early-2 promoter (E-2). E: Restriction map of Late promoter (L). F: Restriction map of Unique Short promoter (US).
4.3.4 Confirmation of Cloned Promoter on pTZ57R by Restriction Digestion:
As described in section 3.4 the blunt ended PCR products (promoters) cloned on pTZ57R. This vector was digested by Eco RV to produce a blunt end site (Figure 415) then treated by Dpn I (section 3.4.1) and purified by ethanol precipitation (section 3.1.7) then the insert (promoter) ligate on the blunt end pTZ57R.
pTZ57R digested pTZ57R M
1
2
3
3000 2000
1000
Figure 4-15: Restriction digestion of pTZ57R by Eco RV. The complete digested pTZ57R plasmid by the restriction enzymes was showed in Lane 2 while partially digested vector appeared clearly in Lane 3 (arrow). Lane 1 shows the undigested or untreated plasmid by the mentioned enzyme. The size of the marker (M) from 1Kb is shown on the left margin in bp.
Depending on the restriction map of each promoter (section 3.7) (Figure 4-14) each cloned promoter on pTZ57R vector showed white colonies, also those that convert to Blue and some of the Blue colonies on LB-Agar supplemented with IPTG
72
Results
and X-Gal (Section 3.5) were confirmed by using single and double restriction digestion. The Xba I restriction enzyme was used only to check the exact size of promoters on pTZ57R (Figure 4-16A). The size of pTZ57R is 2886bp and when the promoters cloned on it, the vector size shows approximately 3260bp, 3930bp, 3895bp, 3380bp, 3396bp and 3790bp which confirm the size of vector with MIE, IE, E1, E2, L and US promoter regions (Figure 4-16B).
Xba I
A T CTAGA
Promoter
pTZ57R (2886bp)
pTZ57R
B
M
1
promoter + pTZ57R 2
3
4
5
6
7
4000 3500 3000
Figure 4-16: Confirmation by single restriction digestion Xba I of the size of promoter on pTZ57R. A: diagram of the cloned promoter on the pTZ57R when after digestion by Xba I. The size of the marker (M) from 1Kb is shown on the left margin in bp. The 2886bp of the vector after digestion was shown in Lane 1, while the other Lanes from 2 to 7 were shown the size of the digested vector which the promoter cloned.
To confirm the promoters cloning on pTZ57R, double restriction digestion is done by Mva 12691 and Pae I, when both digest only the MCS of pTZ57R (Figure 417A).
The entire digested vector showed two bands, one of them is the vector
(pTZ57R) and the other represents the cloned insert (promoter) (Figure 4-17 B to G).
73
Results
Mva 12691
Pae I (Sph I)
GAATG C
pTZ57R
G CATGC
MCS
Promoter
MCS
pTZ57R
A MIE pro.+pTZ57R M
1
IE pro.+pTZ57R
2
M
1
E1 pro.+pTZ57R
2
M
1
2
3000
1200 1000
3000
3000
1200 1000 1000 500
B
C
E2 pro.+pTZ57R M
1
D
L pro.+pTZ57R
2
M
1
US pro.+pTZ57R
2
M
1
2
3000 3000 3000
1000 900
1000 1000 500 500
E
F
G
Figure 4-17: Cloning confirmation by restriction digestion using Mva 12691 and Pae I. A: Diagram showing the restriction site of the Mva 12691 and Pae I on MCS of the pTZ57R. B – G: The size of the marker (M) from 100bp is shown on the left margin from C to G while from 1Kb is shown on the left margin B in bp. All the undigested plasmid with the cloned promoter was shown in the Lanes 1 while the digested plasmid by the Mva 12691 and Pae I were shown in Lane 2. The arrow represents the promoters
74
Results
(MIE,IE, E-1, E-2, L and US) respectively from B to G with a part of the MCS of this vector.
The direction of cloned promoter on the vector was confirmed by using double restriction digestion; one of the enzymes has a restriction site on the cloned promoter and the other enzyme has a site on the MCS of the vector (Figure 4-18). The using of the enzyme and its direction on each promoter depend on the restriction maps (Figure 4-14)
Those cloned promoter which were located from 3´ to 5´ direction on the pTZ57R vector also confirmed its direction by restriction enzyme but these figures were not mentioned here because only those promoters were subcloned which have 5´ to 3´ direction on the pTZ57R vector. The colonies’ color of cloned promoters which have 3´ to 5´ direction on the pTZ57R has white colony while those promoters with 5´ to 3´ direction their colonies were those which convert from white to blue after 4hrs of incubation in 4ºC.
MIE promoter were digested by Pvu II and Sal I, two fragments of about 2020bp and 238bp (arrow) were produced which indicate that the promoter is in the 5´ to 3´ direction on the pTZ57R vector (Figure 4-18B); both IE and E1 were digested by Hind III, in digesting IE promoter on the vector approximately 3220bp and 710bp (arrow) and in digesting cloned E1 promoter approximately 3665bp and 240bp (arrow) were produced when the promoter is clone in the 5´ to 3´ direction on the pTZ57R vector (Figure 4-18 C and D). E2 and L promoter were digested by Eco RI (Figure 4-18 E and F) and approximately 3230bp and 150bp for E2 promoter and nearly about 3246bp and 160bp for L promoter were observed which by this confirmed that these promoters were also in the sense direction on the pTZ57R vector. The US promoter was digested by Pvu II and Xba I, which by this, gives approximately 3300bp and 495bp meaning that it is in the sense direction on the pTZ57R vector (Figure 4-18G).
75
Results
Restriction enzyme
pTZ57R
Restriction enzyme
MCS
Promoter
MCS
pTZ57R
A MIE pro.+pTZ57R M
1
E1 pro.+pTZ57R
2
M
1
4000
3000
IE pro.+pTZ57R M
1
2 1000
3000
250
1000 800 700 500
3500 3000
1000
250
B
C
76
D
2
Results
E2 pro.+pTZ57R M
1
L pro.+pTZ57R
2
M
1
US pro.+pTZ57R
2
M
1
2
3000
3000 4000
1000
3000 1000 200 100
500
1000
250
E
F
G
Figure 4-18: Cloning confirmation by double restriction digestion. A: Diagram showing the restriction sites of the restriction enzymes, one on the cloned promoter and the other on MCS of the pTZ57R. B – G: The size of the marker (M) from 100bp is shown on the left margins of C, E and G while from 1Kb is shown on the left margin of B, D and E in bp. All the undigested plasmids with the cloned promoter were shown in the Lanes 1 while the digested plasmids by the double restriction enzyme were shown in Lane 2 (arrow) and the details were in the paragraph which is about the enzymes used, size and the direction of each promoter.
4.3.5 PCR amplification of LacZ gene – Promoters cassettes from pTZ57R:
The amplification by PCR was performed for LacZ gene - Promoters cassettes from pTZ57R vector in order to use these fragments in the subcloning (section 3-8) on ∆tet pBR322 vector. This amplification was done with the aid of two primer sets, LacZF and LacZR primer (Table 3-1) the PCR program of this amplification shown in section 3.8. The forward primer was 26nt in length and a point mutation were incorporated to produce a recognition site for Eco RV enzyme and bound to 157nt of 5´ upstream from MCS of pTZ57R vector. Similarly, the reverse primer was 24nt in length and bind to the 3´ downstream end of the MCS and included two recognition site for Hind III and Pae I restriction enzymes the position of each primer was shown in the drawing figure 4-19A.
The PCR products of 238bp represent as the amplified LacZ gene which was used as a positive control. The Amplified LacZ gene with the promoter regions cassette
77
Results
were shown approximately 600bp, 1238bp, 1240bp, 740bp, 790bp and 950bp as a result of MIE, IE, E1, E2, L and US promoter regions with the LacZ gene (figure 4-19B). These amplified cassette were purified (section 3.1.6) from the excess PCR cocktail then treated by Dpn I (section 3.4.1) and used in subcloning on ∆tet pBR322 (section 3.8).
A
LacZF
pTZ57R
LacZ gene
Promoter
pTZ57R
LacZR
LacZ gene
B
M
1
promoter + LacZ gene 2
3
78
4
5
6
7
Results
1500 1000 500
Figure 4-19: PCR amplification of the LacZ gene with promoter regions cassettes. A: Diagram showing the position of the LacZF and LacZR primer also the amplified LacZ gene with promoter regions cassettes. B: 238bp of the amplified LacZ gene were shown in Lane 1. The PCR products of MIE, IE, E1, E2, L and US promoters regions with the LacZ gene were shown ~ 600bp, 1238bp, 1240bp, 740bp, 790bp and 950bp, respectively. The size of the marker (M) from 1Kb ladder (Promega) is shown on the left margin in bp.
4.4 Confirmation of tet gene Deletion From pBR322 by Restriction Digestion: The deletion tet gene in pBR322 plasmids was done by using two protocol, one by using a PCR based amplification (Pérez-Pinera et al., 2006) and the other deletion based on restriction enzyme, when the latter protocol was to delete the promoter with the tet gene.
PCR based amplification of the circular DNA sequence that excludes the tet gene is to be deleted by using a specific primer set (Table 3-1). The ∆tet pBR322F primer was 25nt in length and bind to 5´ end upstream and the point mutation incorporated into this primer is to produce a recognition site for Eco RV enzyme. Similarly, the ∆tet pBR322R primer was 25nt and bound to 3´end downstream and a
79
Results
point mutation was incorporated to produce a recognition site for Pae I (Sph I) into this primer. The amplified PCR product of 3171bp, deletion by the primer set ∆tet pBR322F/R indicated the correct deletion of the tet gene which is about 1190bp (Figure 4-20A). Following PCR amplification, the plasmid is digested with Dpn I to eliminate the template DNA, and ligated then transformed.
The deletion of tet gene by restriction enzyme from pBR322 with its promoter is done by using Hind III and Mva 12691 (section 3.4.1); two fragments were formed and they were about 3037bp and 1324bp, the latter was the deleted gene (Figure 4-20B). The 3037bp were purified from gel, digested by Blunt enzyme (section 3.8) and treated by Dpn I then ligated by T4 ligase (section 3.4.3) and transformed to a competent cell (section 3.5).
The results of transformed fragments (3171bp and 3037bp) were separately checked on LB-Agar supplemented with ampicillin and other plate with tetracycline which showed growth on ampicillin plate but no growth on tetracycline plate was seen (Figure 4-21). Thus discusses the success of the deletion.
A ∆tet pBR322F
pBR322
tet gene
pBR322
∆tet pBR322R
B Hind III
pBR322
Promoter
tet gene
pBR322
Mva 12691
C
D
pBR322 Amplified ∆tetpBR322 M
1
pBR322 Digested pBR322
2
80
Results
M
5000 4000 3000
1
2
5000 4000 3000
1500 1000
1000
Figure 4-20: tet gene deletion from pBR322 vector by PCR and Restriction Digestion using Hind III and Mva12691. A: Diagram showing PCR based deletion with primer position. B: Diagram showing Restriction enzyme based deletion with the restriction site position. C: amplified ∆tet pBR322 by PCR using ∆tet pBR322F/∆tet pBR322R which is about 3171bp (Lane 2). D: Digested pBR322 by using Hind III and Mva 12691 two fragments of about 3037bp and 1324bp (arrow) which are ∆tet pBR322 and deleted tet gene with its promoter. While in the figure C and D, Lane 1 represents the digested pBR322 by Sal I and in both figures´ the size of the marker (M) from 1Kb is shown on the left margins in bp.
A
B
C
D
81
Results
E
F
Figure 4-21: Screening of the transformation of pBR322 and ∆tetpBR322 on LB-Agar supplemented by ampicillin and tetracycline. In figure A and B both represented pBR322 on ampicillin and tetracycline plates respectively. C: represented ∆tet pBR322 vector on Ampicillin plate when the tet gene deleted by PCR while in figure D confirms the success of the deletion when no growth seen on tetracycline plate. E: digested ∆tet pBR322 vector by Hind III and Mva 12691 were represented on Ampicillin plate, and no growth observed on tetracycline plate which shown in figure F.
After transformation, the ∆tet pBR322 vector was confirmed by restriction digestion using Hind III which formed 4361bp for pBR322 and 3171bp for ∆tet pBR322, when tet gene was deleted by PCR; while the ∆tet pBR322, when tet gene was deleted by using Hind III and Mva 12691, digested by Hind III no digestion appeared; while when digested by Eco RI gives approximately 3037bp. So according to these results, the deletion was done as expected (Figure 4-22).
pBR322
82
∆tetpBR322
Results
M
1
2
3
4
5000 4000 3000 2000
1000
Figure 4-22: Confirmation of ∆tet pBR322 by restriction digestion. pBR322 vector digested by Hind III, and 4361bp were observed (Lane 1). Lane 2 showing ∆tet pBR322 (amplified by PCR) digested by Hind III and showing ~ 3171bp. While the other lanes were shown ∆tet pBR322 (deleted tet gene by using Hind III and Mva 12691) where digested by Eco RI and Hind III which results in 3037bp (lane 3) and no digestion (lane 4) were seen. The size of the marker (M) from 1Kb is shown on the left margins in bp.
4.5 Subcloning on ∆tet pBR322 and its Confirmation by Restriction Digestion The subcloned of LacZ gene on ∆tet pBR322 vectors were digested by Pvu II to confirm size of the vector. On digestion of ∆tet pBR322 vector when the tet gene was deleted by PCR (Figure 4-23B) a fragment was formed about 3409bp while those ∆tet pBR322 vectors which were deleted through double digestion by Hind III and Mva 12691 (Figure 4-23C) as mentioned in other sections, a band was formed of about
83
Results
3275bp. The ∆tet pBR322 - LacZ gene vector later was used as a control in the enzyme assay.
A ∆tet pBR322
B
pBR322 M
1
∆tet pBR322
LacZ gene
C
∆tetpBR322 2
3
pBR322 M
5000 4000 3000
5000 4000
2000
3000
1
∆tetpBR322 2
3
2000 1000 1000
Figure 4-23: Subcloning confirmation of the LacZ gene on ∆tet pBR322. A: diagram showing subcloning of the LacZ gene on both types of ∆tet pBR322. The size of the marker (M) from 1Kb is shown on the left margins in bp and the vectors were digested by Pvu II. Digested pBR322 vector given 4361bp in both B and C. B: Subcloned LacZ gene on ∆tet pBR322 (by PCR) formed 3409bp in lane 3 while without subcloning the digestion gives 3171bp (Lane 2). C: 3037bp appeared in lane 2 as a result of the digested ∆tet pBR322 which was formed through double digestion by Hind III and Mva 12691 while in digestion of the subcloned LacZ gene on this vector gives about 3275bp (lane 3).
LacZ gene - promoters´ cassettes were subcloned on ∆tet pBR322 which were deleted by PCR protocol (section 3.8). The vectors were digested by Kpn 21 to determine the exact size of each vector with its cassette. Digested ∆tet pBR322 vectors which the LacZ gene – promoter cassette subcloned on it were shown to be approximately 3783bp, 4454bp, 4418bp, 3915bp, 3919bp and 4313bp respectively of subcloned LacZ gene- MIE, IE, E1, E2, L and US promoters on this produced vector (Figure 4-24).
84
Results
A Kpn21
∆tet pBR322
LacZ gene
∆tet pBR322
Promoter
∆tet pBR322 promoter + LacZ gene
B
M
1
2
3
4
5
6
5000 4000 3000 2000
1000
Figure 4-24: Subcloning confirmation of the LacZ gene - promoter cassette on ∆tet pBR322. The size of the mixed marker (M) from 1Kb and 100bp (Fermentase) is shown on the left margins in bp and the vectors were digested by Kpn 21. A: diagram showed subcloned LacZ gene – promoter cassette on ∆tet pBR322 (by PCR) after digestion by Kpn 21. B: digested ∆tet pBR322 vector which the LacZ gene – promoter cassette subcloned on.
The direction of subcloned LacZ gene – promoters´ cassettes on ∆tet pBR322 were confirmed by using double restriction digestion, one of the enzymes has only a restriction site on the cloned promoter and the other enzyme has a site on the vector (Figure 4-25). The use of the enzyme and its direction on each promoter depend on the restriction maps (Figure 4-14) which calculate the fragment size on the gel and comparing it with that on the map. Those subcloned LacZ gene – promoters´ cassettes which are located from 3´ to 5´ direction on the ∆tet pBR322 vector also confirmed its
85
Results
direction by double restriction enzyme but these figures are not showed here because only those which have 5´ to 3´ direction on the ∆tet pBR322 vector were used later in the enzyme assay. Both LacZ gene - MIE and US cassettes on ∆tet pBR322 are digested only by Pvu II which has a restriction site on promoters and the vector, two fragments from subcloned MIE promoter on the vector produced of about 1121bp and 2662bp, and for subcloned US promoter on the vector also two fragments of about 1358bp and 2955bp were produced. Double digestion Nco I and Kpn 21 were used to digest both LacZ gene - IE and E1 cassettes on ∆tet pBR322 when two fragments from each vector produced of about 1302bp and 3152bp for subcloned IE promoter on the vector and two fragments of about 902bp and 3516bp for subcloned E1 promoter on the ∆tet pBR322 vector. While Sal I and Kpn 21 were used to digest both LacZ gene - E2 and L cassettes on ∆tet pBR322 when two fragments from each vector produced about 610bp and 3305bp for subcloned E2 promoter on the vector and two fragments of about 942bp and 2977bp for subcloned L promoter on the ∆tet pBR322 vector (Figure 4-25).
A Restriction enzyme
∆tet pBR322
B
LacZ gene
Promoter
Restriction enzyme
∆tet pBR322
double digested (∆tet pBR322 + promoter + LacZ gene)
86
Results
M
1
2
3
4
5
6
5000 4000 3000 2000 1500
1000 750 500
Figure 4-25: Direction confirmation of the subcloning LacZ gene - promoter cassette on ∆tet pBR322 by double restriction digestion. A: diagram showed the restriction site of the restriction enzymes on the ∆tet pBR322 + (LacZ gene – promoters cassettes) vectors. B: The size of the marker (M) from 1Kb (Fermentase) is shown on the left margins in bp. MIE and US promoter - LacZ gene cassette subcloned on ∆tet pBR322 vector were digested only by Pvu II (Lane 1 and 6) while the other subcloned promoter cassettes where digested by using double restriction enzyme. Lane 2 and 3 show digested IE and E1 promoter - LacZ gene cassette respectively by Nco I and Kpn 21 while subcloned E2 and L promoter - LacZ gene cassette respectively showing in Lane 4 and 5 which are digested by Sal I and Kpn 21. The size of the fragments was shown in the text above and in the figures by arrows.
87
Discussion
5. DISCUSSION
5.1 Detection Analysis of HCMV by ELISA Diagnosis
of
primary CMV
infection
is relatively
straight
forward
if
seroconversion is detected. However, most pregnant women do not know their prepregnancy serologic status. How pregnant women can undergo an acute CMV infection to be identified if this is asymptomatic?. The solution to these problems requires a diagnostic strategy, employing an algorithm based on screening pregnant women with a CMV IgG assay and a sensitive CMV IgM assay, followed by reflex testing of CMV IgM positive specimens with a CMV IgG avidity assay. A total of 130 serum samples were tested for CMV by ELISA suspected men, pregnant and aborted women also from new born babies. As shown in Table (4-1), 46 samples were +ve for both IgM and IgG which means the immunity starts to face the virus by producing Immunoglobulin’s while 24 samples were produced IgM which means that the patient is in the acute or late phases of a primary infection and may persist for 6 to 9 months or the virus may reactivate/reinfect (Genser et al., 2001; Maine et al., 2001). Also from the table 4-1 seen 27 samples with +ve IgG because the patients may be entering the past infection and this is considered true when there is no PCR product because IgG level over time is an unreliable approach for distinguishing primary from non-primary HCMV infection and most seropositive patients showed high IgG levels in the first serum samples collected for testing (Prince and Leber, 2002). From the 130 samples, 33 serum samples were taken as a control mean -ve from both IgM and IgG. These ELISA tests were not differed on age or gender (Pouria et al., 1998; Munro et al., 2005; Arabpour et al., 2007; Tawfeq, 2009).
87
Discussion
5.2 DNA Extraction and Amplification Total DNA of HCMV from serum samples were purified by DNA purification kit as mentioned in detail in section 3.1.2. Earlier studies suggested that detection of CMV in plasma is at best equivalent to detection of CMV by antigenemia and inferior to detection from PBL or whole blood (Razonable et al., 2002) While Lengerova and his colleagues (2007) suggested automated extraction instead of manual extraction because of the specific detection of the low copy numbers by automated extraction. The PCR assays developed in this study allow the detection of six HCMV promoters with the aim of evaluating gene expression at different stages of viral life cycle by qualitative detection of promoters. Sensitivity of the assays was maximized by careful choice of designed primers, adjustment of dNTP and by primer concentrations (section 3.1.3). PCR allows the specific detection of HCMV in clinical samples. Two viral promoter regions (MIE and IE region) were selected as PCR targets for detection of all 130 samples. Our results confirm that from 70 samples which had +ve PCR product and the remaining 23 samples showed –ve PCR product (Figure 4-1 and 4-2). This could be attributed to low sensitivity as well as to the choice of target region by PCR, because from experience of Lengerova and his colleagues (2007), they recommended not to use MIE regions in routine PCR diagnosis; while all the 27 serum samples which were +ve for IgG antibody, no PCR product was observed which assures that these patients enter past infection and no CMV DNA remains in the serum of these patients. The question here is that from the 33 samples were taken as control, because 18 of the samples showed +ve PCR product on gel (Figure 4-1 and 4-2). This result is in agreement with Lazzarotto and his colleagues (2004) who found the positive detection of viral DNA in the time of diagnosis of CMV primary infection, and also in agreement with Tawfeeq (2009), which from 36 different samples 9 of them were –ve by ELISA showed +ve PCR product. Healthy men may carry CMV in their genital tract and
88
Discussion
semen (Bresson et al., 2003) numerous PCR +ve results in the semen of seronegative men some of whom were seroconverting, while others presented persistent seronegativity for many months (Witz et al., 1999). Till now, the detection of CMVspecific IgM has traditionally been considered the most appropriate procedure for screening pregnant women. However, the search for CMV-specific IgM has always been hampered by the fact that the correlation of results obtained with different commercial kits is poor and results are contradictory if a serum is tested with different kits (Genser et al., 2001). Availability of new tests may rapidly change this situation because they seem sensitive and specific enough to detect all pregnant women undergoing active infection; one of these tests is Quantitative PCR which had a clinical value in the monitoring of both asymptomatic and symptomatic HCMV infection (Maine et al., 2001; Piiparinen, 2004). The nested quantitative-competitive polymerase chain reaction (nQC-PCR) is a very sensitive test for accurate quantitative detection of CMV DNA in different clinical specimens that avoids the need for high-cost instrumentation (Tarragó et al., 2004; Ziyaeyan et al., 2005). As mentioned in section (3.4, 4.3, 4.3.1 and 4.3.2) the blunt end PCR products were cloned on pJET1.2/Blunt vector. After confirmation, the constructed plasmids were sequenced in Germany. The big trouble in this construction was that the vector inspite of that is high copy number became low copy number in the bacterial cell also degrades after purification from the cell inspite of that we used Dnase free water in all of this work, also RNase was present in the solution of the purification kit.
5.3 Sequencing Analysis Cycle sequencing was performed to identify sequence of the resulting bands (section 3-6). The constructed pJET1.2 plasmids were used as a template for DNA sequencing. The multiple sequence alignment of these inserts (promoters) revealed substantial variation in the nucleotide sequences and showed in Bold Letter. This result 89
Discussion
in disagreement with Murphy and his colleagues (2003) who mentioned that a total identified of 252 ORFs are conserved in all clinical isolates of the virus. While the results in agreement Brytting and his colleagues (1992) variations in the Cytomegalovirus major immediate-early gene was found by direct genomic sequencing. Most HCMV genes are highly conserved in sequence among strains, but genetic variability of CMV has been reported several times (Pignatelli et al., 2004; Nye et al., 2005; Bradley et al., 2008), and this study documents how seriously this variability can influence PCR results. So based on these variations which appear in sequencing, we conclude that the misidentification by ELISA may contribute to these variations in some nucleotides. Further studies must be done to confirm these results especially in those asymptomatic patients with both IgM and IgG –ve.
5.4 Construction of HCMV Promoters Regions on pTZ57R and ∆tet pBR322 Vector The aim for cloning promoters on pTZ57R plasmids was to form new constructed plasmids containing LacZ gene-Promoters cassettes on it. The LacZ gene coding for bacterial β-galactosidase has been used with a number of promoters and works well to identify positive cells but requires histochemical reaction generally on dead cells (Forss-Petter et al., 1990; Jankovski and Sotelo, 1996; Paradies et al., 1996; Sekerkova et al., 1997). After confirmation of this newly constructed pTZ57R vector, the LacZ genePromoters cassettes were amplified by using two sets of specific primers, which showed that these cassettes were prepared for subcloning on ∆tet pBR322 vector. The aim of this construction was to subclone LacZ gene-Promoters cassettes on a vector which has low copy number (compared to pTZ57R) and lacks Lac I gene.
90
Discussion
5.5 β - galactosidase Assay The aim of the present study was to examine the relative potency of prokaryotic expression vectors with different HCMV promoters. To further examine the ability of the HCMV promoters to drive expression of foreign genes in vectors, we constructed viral vectors with LacZ gene under the control of the HCMV promoters’ element, relative to the transcriptional start site. We have used these vectors to determine whether orientation of the expression cassette within the viral vector has an effect on gene expression, and to examine variations in expression associated with different vectors in vitro, but the data was not shown here because in comparing the strength of six different HCMV promoters, in prokaryotic cells using LacZ gene for transcript βgalactosidase, the results showed that the CMV promoters were able to drive LacZ gene expression in prokaryotic cell and with the aid of high and low copy number vectors, and concluded that CMV was transcriptionally active in this cell. Since these are unexpected results and are in disagreement with the other investigations which showed CMV promoter activity in different cells line like neuron (Wheeler and Cooper, 2001) and other studies showed different sequences of the CMV promoter which have been used previously with a LacZ reporter with a nuclear localization site (Koedood et al., 1995; Fritschy et al., 1996). Because of the nuclear localization and necessity of staining with a suitable colorant such as X-gal, those mice were less suitable for studies of living neurons (Van den Pol and Ghosh, 1998) but no study showed the activity of these promoters in Prokaryotic system. The results of this first external quality assessment study indicate a clear need for improvement of methods. Future quality assessment programs should collect more detailed data on all the critical points of the assay. The results of such further quality assessment studies will aid laboratories in adjusting the assay in order to achieve better rates of sensitivity and specificity and to fully exploit the test.
91
Discussion
In fact, the strength of different promoters, both in cell culture and in vivo, has been compared in numerous studies and has been demonstrated to derive gene expression in all cell types tested and more skin layers, while other promoters studied are more restricted (Lin et al., 2001). Based on the physiological expression of the distinct promoters, the CMV promoter In terms of versatility for reporter gene assays, the CMV promoter has been shown to exhibit high activity in both attached and suspended cells, The human CMV promoter has been shown to be at least one order of magnitude stronger than the SV40 promoter and others (Doll et al., 1996; Feng et al., 2003). Using either CAT or luciferase as a reporter gene, the CMV regulatory elements were found to have greater transcriptional activity than any of the other viral positive regulatory elements examined (Lee et al., 1997; Tucker et al., 2000; Xu et al., 2001), suggesting their potential applications in DNA vaccine development (Garmory et al., 2003). The EGFP-based cell assays have proved to be a rapid, sensitive, quantitative and specific system for detection of HCMV and selection of antivirals (Luganini et al., 2008). The pGL3-CMV reporter construct might be utilized as a positive control for reporter gene assay in cell line (Tencomnao et al., 2008). It is important to note that HCMV early promoters are not activated in uninfected cells or cells lacking IE proteins. The activity of one or both of the HCMV major IE proteins is required in vivo for the modulation of cell cycle proteins observed in cells infected with wild-type HCMV (White and Spector, 2005) while the IE proteins cannot activate promoters having only a TATA element or only an upstream transcription factor binding site (Lukac et al., 1994). Clearly, cellular transcription factors alone are insufficient for activating early promoter expression (Kerry et al., 1994). The analysis of IE promoter in vivo revealed that lytic cycle activation precedes latency in a subpopulation of latently infected neurons (Proença et al., 2008). The CREB and ATF sites cooperate to regulate the US11 promoter in HCMV-infected cells (Chau et al., 1999). The Isomura and his colleagues (2007) showed that late promoter depends on
92
Discussion
viral DNA replication for activity and these promoters are required for efficient viral growth at a low or high multiplicity of infection. While sometimes other factors affected the activation of promoter as Herberth and his colleagues (2008) investigated the hypothesis that parathyroid hormone (PTH) regulates HCMV immediate-early promoter activation in proximal renal tubular cells. Other studies showed that External Guide Sequence (EGS) RNAs effectively inhibits HCMV gene expression and growth. While EGS complex with RNAs P represents a novel nucleic-acid-based gene interference approaches to modulate gene expression (Kim et al., 2004; Li et al., 2006). CMV promoter silencing and activation are cell type specific and it is silenced by methylation (Radhakrishnan et al., 2008). Proposed mechanisms for inhibition of gene expression due to promoter methylation include direct interference of methyl group in binding of transcription factors due to steric hindrance, methyl groups mediating the binding of certain proteins to DNA by forming a protein complex that blocks the binding of transcription factors and methyl groups affecting DNA–histone interaction, resulting in chromatin compaction, thereby preventing transcription (Esteller et al., 2001; Esteller and Herman, 2002; Singal and Ginder, 1999). The acetylation status of lysine side chains in histones also can regulate gene expression. Hypoacetylation of histones leads to the condensation of DNA through interactions of the free lysine residues in histones and DNA backbones, resulting in suppression of gene expression. Measurement of the status of DNA methylation and histone acetylation in the promoter regions can serve as an indicator of the transcription activity of a specific gene (Grassi et al., 2003).
93
Conclusions
CONCLUSIONS
The rapid identification of HCMV is important for earlier effective management and antiviral therapy. However, the serological method and some clinical sign are the main ways for the detection of this virus, which are less sensitive due to delayed seroconversion and also uses different un-sensitive kits in our hospitals. The current study proved the misidentification by ELISA technique of this virus in different clinical labs and the DNA of the virus can be detected by a very sensitive technique which is PCR using specifically designed primer for a conserved region in no significant or detectable amount of viral antigen during primary and latent infection by HCMV. PCR amplification of different HCMV promoters from different regions of the local HCMV genome and sequencing proved and observed sequence variability in these fragment comparing with the published wild and lab strains sequences. This proves the misidentification by serological methods and presence of this virus in our community. Cloning and subcloning of these promoters regions on different vectors were revealed the ability for new construction of new vectors and monitoring expression of different genes under the control of these promoters in different assays like βgalactosidase assay. After confirmation the more powerful Promoters could be used in DNA vaccine to obtain a best way for treatment.
94
Recommendations
RECOMMENDATIONS
The following points are recommended by the current study: 1. Further survey studies are needed to investigate the role of HCMV in abortion, hearing loss in neonates and immunocompromised patient including organ transplants. 2. A very sensitive Kit of ELISA used for the detection in our hospitals that has an efficiency to detect different strains of HCMV virus. 3. More efforts are necessary to confirm ELISA negative samples by routine PCR selecting a specific conserved region and also by more specific techniques like Real Time PCR and Microarray. 4. More researches are required on HCMV to know the mechanism of Latency and Reactivation of this virus to enhance finding the best treatment at the time of infection. 5. Studying the effect of different reporter gene like Luciferase gene and Green Flouresence Protein (GFP) in Prokaryotic and Eukaryotic cells by using shuffling vector. 6. More works are needed to use powerful HCMV promoters in expression for the finding of the best treatment based on DNA vaccine.
95
References
REFERENCES Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W. and Lipman, D.J. (1990). Basic Local Alignment Search Tool. J. Mol. Biol. 215:403-410. Anders, D.G. and McCue, L.A. (1996). The human cytomegalovirus genes and proteins required for DNA synthesis. Intervirol. 39:378-388. Arabpour, M.; Kaviyonee, K.; Jankash, A. and Yoghobi, R. (2007). Human cytomegalovirus infection in women of child bearing age throughout Fars Province-Iran: a population-based cohort study. Malaysian J. Microbiol. 3(2):23-28. Ausubel, F.M.; Brent, R.; Kingston, R.E.; Moore, D.D.; Seidman, J.G.; Smith, J.A. and Struhl, K. (2003). Current Protocols in Molecular Biology. 1st edition. John Wiley & Sons, Inc. Baldanti, F. and Gerna, G. (2003). Human cytomegalovirus resistance to antiviral drugs: diagnosis, monitoring and clinical impact. J. Antimicrob. Chemother. 52:324-330. Baldanti, F.; Revello, M.G.; Percivalle, E. and Gerna, G. (1998). Use of the human cytomegalovirus (HCMV) antigenemia assay for diagnosis and monitoring of HCMV infections and detection of
antiviral drug resistance in the
immunocompromised. J. Clin. Virol. 11:51-60. Baldick Jr.C.J.; Marchini, A.; Patterson, C.E. and Shenk, T. (1997). Human cytomegalovirus tegument protein pp71 (ppUL82) enhances the infectivity of viral DNA and accelerates the infectious cycle. J. Virol. 71:4400-4408. Bale, J.F.; Petheram, S.J.; Robertson, M.; Murph, J.R. and Demmler, G. (2001). Human Cytomegalovirus a Sequence and UL144 Variability in Strains from Infected Children. J. Med. Virol. 65:90-96. Barkholt, L.M.; Ehrnst, A. and Veress, B. (1994). Clinical use of immune histopathologic methods for the diagnosis of cytomegalovirus hepatitis in human liver allograft biopsy specimens. Scand. J. Gastroenterol. 29:553-560. Bauman, R.W. (2004). Microbiology. Benjamin Cummings. P: 575, 247. Behzad-Behbahani, B.; Entezam, M.; Mojiri, A.; Pouransari, R.; Rahsaz, M.; Banihashemi, M.; Heidari, T.; Farhadi, A.; et al. (2008). Incidence of human herpes virus-6 and human cytomegalovirus infections in donated bone marrow 96
References
and umbilical cord blood hematopoietic stem cells. Indian J. Med. Microbiol. 26 (3):253-255. Bergallo, M.; Costa, C.; Terlizzi, M.E.; Margio, S.; Sidoti, F.; Astegiano, S.; Franca, S. and Cavallo, R. (2008). Reverse Transcriptase-Polymerase Chain Reaction to Evaluate Human Cytomegalovirus Lytic Gene Expression. Mol. Biotechnol. 40(2):144-150. Biron, K.K. (2006). Antiviral drugs for cytomegalovirus diseases. Antiviral Res. 71:154-163. Blok, M.J.; Christiaans, M.H.L.; Goossens, V.J.; van Hoof, J.P.; Sillekens, P.; Middeldorp, J.M. and Bruggeman, A. (1998). Early detection of Human cytomegalovirus infection after kidney transplantation by Nucleic Acid Sequence-Based Amplification. Transplantation. 67(9):1264-1277. Bodaghi. B.; Slobbe-van Drunen, M.E.; Topilko, A.; Perret, E.; Vossen, R.C.; van Dam-Mieras, M.C.; Zipeto, D.; et al. (1999). Entry of human cytomegalovirus into retinal pigment epithelial and endothelial cells by endocytosis. Invest. Ophthalmol. Vis. Sci. 40:2598-2607. Boeckh, M.; Huang, M.; Ferrenberg, J.; Stevens-Ayers, T.; Stensland, L.; Nichols, W.G. and Corey, L. (2004). Optimization of Quantitative Detection of Cytomegalovirus DNA in Plasma by Real-Time PCR. J. Clin. Microbiol. 42(3):1142-1148. Boeckh, M.; Woogerd, P.M.; Stevens-Ayers, T.; Ray, C.G. and Bowden, R.A. (1994). Factors influencing detection of quantitative cytomegalovirus antigenemia. J Clin. Microbiol. 32:832-834. Boom, R.; Sol, C.; Weel, J.; Lettinga, K.; Gerrits, Y.; Van Breda, A. and Dillen, P.W. (2000). Detection and quantitation of human cytomegalovirus DNA in feces. J. Virol. Methods. 84:1–14. Boppana, S. B.; Rivera, L.B.; Fowler, K.B.; Mach, M. and Britt, W.J. (2001). Intrauterine transmission of cytomegalovirus to infants of women with reconceptional immunity. N. Eng/J Med. 33:1366-1371. Bradley, A.J.; Kovács, I.J.; Gatherer, D.; Dargan, D.J.; et al. (2008). Genotypic Analysis of Two Hypervariable Human Cytomegalovirus Genes. J. Med. Virol. 80:1615-1623.
97
References
Brennan, D.C. (2001). Cytomegalovirus in renal transportation. J. Am. Soc. Nephrol. 12:848-855. Bresnahan, W.A. and Shenk, T. (2000). A subset of viral transcripts packaged within human cytomegalovirus particles. Sci. 288:2373–2376. Bresson, J.L.; Clavequin, M.C.; Mazeron, M.C.; Mengelle, C.; Scieux, C.; Segondy, M. and Houhou, N. (2003). Risk of cytomegalovirus transmission by cryopreserved semen: a study of 635 semen samples from 231 donors. Human Reprod. 18(9):1881-1886. Britt, W. (2006). Human cytomegalovirus infections and mechanisms of disease, p. 1-28. In: Reddehase, M.J. (ed.), Cytomegalovirus Molecular Biology and Immunology. Caister Academic Press, Norfolk, UK. Brown, T.A. (1986). Gene Cloning: an introduction. VNR, international. P:7. Bryant, L.A.; Mixon, P.; Davidson, Μ.; Bannister, A.J.; Kouzarides, T. and Sinclair, J.H. (2000). The human cytomegalovirus 86-kilodalton major immediate-early protein interacts physically and functionally with histone acetyl transferase P/CAF. J. Virol. 74:7230-7237. Brytting, M.; Wahlberg, J.; Lundeberg, J.; Wahren, B.; Uhlen, M. and Sundqvist V.A. (1992). Variations in the Cytomegalovirus Major Immediate-Early Gene Found by Direct Genomic Sequencing. J. Clin. Microbiol. 30(4):955-960. Chambers, J.; Angulo, A.; Amaratunga, D.; Guo, H.; Jiang, Y.; Wan, J.S.; Bittner, A.; Frueh, K.; Jackson, M.R.; Peterson, P.A.; Erlander, M.G. and Ghazal, P. (1999). DNA microarrays of the complex human cytomegalovirus genome: profiling kinetic class with drug sensitivity of viral gene expression. J. Virol. 73:5757-5766. Champe, P. and Harvey, R. (1994). Lippincott’s illustrated reviews: Biochemistry. 2 nd edition. J.B. Lippincott Company. P: 409. Chan, C.K.; Brignole, E.J. and Gibson, W. (2002). Cytomegalovirus assemblin (pUL80a): cleavage at internal site not essential for virus growth; proteinase absent from virions. J. Virol. 76:8667-8674. Chau, N.H.; Vanson, C.D. and Kerry J.A. (1999). Transcriptional Regulation of the Human CytomegalovirusUS11 Early Gene. J. Virol. 73(2):863-870. Chee, M.S.; Bankier, A.T.; Beck, S.; Sohni, R.; Brown, C.M.; Cerny, R.; Horsnell, T.; Hutchinson, C.A.; Kouzarides, T.; Marignetti, J.A.; Preddie, E.; Satchwell,
98
References
S.C.; Tomlinson, P.; Weston, K.; Barrell, B.G. (1990). Analysis of the proteincoding content of the sequence of human cytomegalovirus strain AD169. In: Shenk, T. and Stinski, M.F. (ed.). Human cytomegalovirus; current topics in Microbiology and Immunology. Spring-Verlag Berlin Heidelberg. Colina, F.; Juca, N.T.; Moreno, E.; Ballestin, C.; Farina, J.; Nevado, M.; Lumbreras, C. and Gomez-Sanz, R. (1995). Histological diagnosis of cytomegalovirus hepatitis in liver allografts. J. Clin. Pathol. 48:351-357. Compton, T. (2004). Receptors and immune sensors: the complex entry path of human cytomegalovirus. Trends Cell Biol. 14:5-8. Compton, T.; Nepomuceno, R.R. and Nowlin, D.M. (1992). Human cytomegalovirus penetrates host cells by pH-independent fusion at the cell surface. Virol. 191:387-395. Compton, T.; Nowlin, D.M. and Cooper, N.R. (1993). Initiation of human cytomegalovirus infection requires initial interaction with cell surface heparan sulfate. Virol. 193:834-841. Cowan, M.K. and Talaro, K.P. (2006). Microbiology: a system approach. McGrow. Hill, P.292-294. Crough, T. and Khanna, R. (2009). Immunobiology of Human Cytomegalovirus: from Bench to Bedside. Clin. Microbiol. Rev. 22(1):76-98. Dalen, A.B. (2002). Cytomegalovirus (CMV). P:149-151. In: Haaheim, L.R.; Pattison, J.R. and Whitley, R.J. (ed.). A practical guide to clinical virology. John Wiley and Sons, Ltd. Daugharty, H.; Skelton, S.K. and Messmer, T. (1998). Chlamydia DNA extraction for use in PCR: stability and sensitivity in detection. J. Clin. Lab. Anal. 12:47-53. Davison, A.J.; Dolan, A.; Akter, P.; Addison, C.; Dargan, D.J.; Alcendor, D.J.; McGeoch, D.J. and Hayward, G.S. (2003). The human cytomegalovirus genome revisited: comparison with the chimpanzee cytomegalovirus genome. J. Gen. Virol. 84:17-28. DeMeritt, I.B.; Milford, L.E. and Yurochko, A.D. (2004). Activation of the NFκ-B pathway in human cytomegalovirus-infected cells is necessary for efficient transactivation of the major immediate-early promoter. J. Virol. 78:4498-4507. Dolan, A.; Cunningham, C.; Hector, R.D.; Hassan-Walker, A.F.; Lee, L.; Addison, C.; Dargan, D.J.; McGeoch, D.J.; Gatherer, D.; Emery, V.C.; Griffiths, P.D.;
99
References
Sinzger, C.; McSharry, B.P.; Wilkinson, G.W.G. and Davison, A.J. (2004). Genetic content of wild-type human cytomegalovirus. J. Gen. Virol. 85:13011312. Doll, R.F.; Crandal, J.E.; Dyaer, C.A.; Aucoin, J.M. and Smith, F.I. (1996). Comparison of promoter strength on gene delivery into mammalian brain cells using AAV vectors. Gene Ther. 3:437-447. Drago, L.; Lombardi, A.; De Vecchi, E.; Giuliani, G.; Bartolone, R. and Gismondo, M.R. (2004). Comparison of nested PCR and real time PCR of herpesvirus infections of central nervous system in HIV patients. BMC Infect. Dis. 4:55. Ducroux, A.; Cherid, S.; Benachi, A.; Ville, Y. and Leruez-Ville, M. (2008).Evaluation of New Commercial Real-Time PCR Quantification Assay for Prenatal Diagnosis of Cytomegalovirus Congenital Infection. J. Clin. Microbiol. 46(6):2078-2080. Dulal, K.; Zhang, Z. and Zhu, H. (2009). Developments of a gene capture method to rescue a large deletion mutant of human cytomegalovirus. J. Virol. Methods. 157(2):180-187. Dunn, W.; Chou, C.; Li, H.; Hai, R.; Patterson, D.; Stolc, V.; Zhu, H. and Liu, F. (2003). Functional profiling of a human cytomegalovirus genome. Proc. Natl. Acad. Sci. USA. 100:14223-14228. Dunn, W.; Trang, P.; Zhong, Q.; Yang, E.; van Belle, C. and Liu, F. (2005). Human cytomegalovirus expresses novel microRNAs during productive viral infection. Cell Microbiol. 7:1684-1695. Eickmann, M.; Gicklhorn, D. and Radsak, K. (2006). Glycoprotein trafficking in virion morphogenesis. In: Reddehase MJ (ed) Cytomegaloviruses molecular biology and immunology. Caister Academic Press, Norfolk, UK. 245-264. Einsele, H.; Vallbracht, A.; Jahn, G.; Kandolf, R. and Muller, C.A. (1989). Hybridization techniques provide improved sensitivity for HCMV detection and allow quantitation of the virus in clinical samples. J. Virol. Methods. 26:91-104. Espy, M.J.; Paya, C.V.; Holley, K.E.; Ludwig, J.; Hermans, P.F.; Wiesner, R.H.; Krom, R.A. and Smith, T.F. (1991). Diagnosis of cytomegalovirus hepatitis by histopathology and in situ hybridization in liver transplantation. Diagn. Microbiol. Infect. Dis. 14:293-296.
100
References
Esteller, M. and Herman, J.G. (2002). Cancer as an epigenetic disease: DNA methylation and chromatin alterations in human tumors. J. Pathol. 196:1-7. Esteller, M.; Corn, P.G.; Baylin, S.B. and Herman, J.G. (2001). A gene hypermethylation profile of human cancer. Cancer Res. 61:3225-3229. Fahle, G.A. and Fischer, S.H. (2000). Comparison of Six Commercial DNA Extraction Kits for Recovery of Cytomegalovirus DNA from Spiked Human Specimens. J. Clin. Microbiol. 38(10):3860-3863. Feng, G.; Hicks, P. and Chang, P.L. (2003). Differential expression of mammalian or viral promoter-driven gene in adherent versus suspension cells. In Vitro Cell. Dev. Biol.-Anim. 39:420-423. Forss-Petter, S.; Danielson, P.E.; Catsicas, S.; Battenberg, E.; Price, J.; Nerenberg, M. and Sutcliffe, J.G. (1990). Transgenic mice expressing beta galactosidase in mature neurons under neuron-specific enolase promoter control. Neuron. 5:187-197. Fritschy, J.M.; Brandner, S.; Aguzzi, A.; Koedood, M.; Luscher, B. and Mitchell, P.J. (1996). Brain cell type specificity and gliosis-induced activation of the human cytomegalovirus immediate-early promoter in transgenic mice. J. Neurosci. 16:2275-2282. Froberg, M.K.; Adams, A.; Seacotte, N.; Parker-Thornburg, J. and Kolattukudy P. (2001). Cytomegalovirus Infection Accelerates Inflammation in Vascular Tissue Overexpressing Monocyte Chemo attractant Protein-1. Circulation Res. 89:1224-1230. Garmory, H.S.; Brown, K.A. and Titball, R.W. (2003). DNA vaccines: improving expression of antigens. Gen. Vaccine Ther. 1:2. Gault, E.; Michel, Y.; Dehee, A.; Belabani, C.; Nicolas, J.C. and Garbarg-Chenon, A. (2001). Quantification of human cytomegalovirus DNA by real-time PCR. J. Clin. Microbiol. 39:772-775. Genser, B.; Truschnig-Wilders, M.; Stunzner, D.; Landini, M.P. and HalwachsBaumann, G. (2001). Evaluation of five commercial enzyme immunoassays for the detection of human cytomegalovirus-specific IgM antibodies in the absence of a commercially available gold standard. Clin. Chem. Lab. Med. 39(1):62-70.
101
References
Gershenzon, N.I. and Ioshikhes, I.P. (2005). Synergy of human Pol II core promoter elements revealed by statistical sequence analysis. Bioinf. 21(8):1295-1300. Gibson, W. (1996). Structure and assembly of the virion. Intervirol. 39:389-400. Gibson, W. (2006). Assembly and maturation of the capsid. In: Reddehase M.J. (ed.) Cytomegaloviruses: molecular biology and immunology. Caister Academic Press. 231-244. Gibson, W. (2008). Structure and Formation of the Cytomegalovirus Virion. In: Shenk, T. and Stinski, M.F. (ed.).Human cytomegalovirus; current topics in Microbiology and Immunology. Spring-Verlag Berlin Heidelberg. 325: 187-207. Go, V. and Pollard, R.B. (2008). A cytomegalovirus vaccine for transplantation: are we closer? J. Infec. Dis. 197:1631-1633. Gonczol, E.; Berencsi, K.; Pincus, S.; Endresz, V.; Meric, C.; Paoletti, E. and Plotkin, S.A. (1995). Preclinical evaluation of an ALVAC (canarypox)-human cytomegalovirus glycoprotein B vaccine candidate. Vaccine. 13:1080-1085. Grassi, G.; Maccaroni, P.; Meyer, R.; Kaiser, H.; Ambrosio, E.D.; Pascale, E.; Grassi, M.; Kuhn, A.; Inhibitors
of
DNA
Nardo, P.D.; Kandolf, R. and Küpper, J.H. (2003). methylation
and
histone
deacetylation
activate
cytomegalovirus promoter-controlled reporter gene expression in human glioblastoma cell line U87. Carcinog. 24(10):1625-1635. Gratacap-Cavallier, B.; Bonadona, A.; Berthier, R.; Brambilla, E.; Seigneurin, J.M. and Lorimier, P. (2003). A simplified cytomegalovirus pp65 antigenemia assay procedure. J. Clin. Virol. 28:317-322. Greber, U.F. and Way, M. (2006). A Superhighway to Virus Infection. Cell. 124:741754. Grey, F.; Antoniewicz, A.; Allen, E.; Saugstad, J.; McShea, A.; Carrington, J.C. and Nelson,
J.
(2005).
Identification
and
characterization
of
human
cytomegalovirus-encoded microRNAs. J. Virol. 79:12095-12099. Grey, F.; Meyers, H.; White, E.A.; Spector, D.H. and Nelson, J. (2007). A Human Cytomegalovirus-Encoded microRNA Regulates Expression of Multiple Viral Genes Involved in Replication. PLoS. Pathogens. 3(11):1593-1602. Griscelli, F.; Barrois, M.; Chauvin, S.; Lastere, S.; Bellet, D.; and Bourhis, J.H. (2001). Quantification of human cytomegalovirus DNA in bone marrow transplant recipients by real-time PCR. J. Clin. Microbiol. 39:4362-4369.
102
References
Grossi, P.; Kusne, S.; Rinaldo, C.; St George, K.; Magnone, M.; Rakela, J.; Fung, J. and Starzl, T.E. (1996). Guidance of ganciclovir therapy with pp65 antigenemia in cytomegalovirus-free recipients of livers from seropositive donors. Transplantation. 61:1659-1660. Gutiéerrez, C.A.; Chaparro, C.; Krajden, M.; Winton, T. and Kesten, S. (1998). Cytomegalovirus Viremia in Lung Transplant Recipients Receiving Ganciclovir and Immune Globulin. Chest. 113:924-932. Haaheim, L.R.; Pattison, J.R. and Whitely, R.J. (2002). A practical guide to Clinical Virology. 2nd edition. John Wiley and Sons, Ltd. Hahn, G.; Jores, R. and Mocarski, E.S. (1998). Cytomegalovirus remains latent in a common precursor of dendritic and myeloid cells. Proc. Natl. Acad. Sci. USA. 95:3937-3942. Hendrix, M.G.; Daemen, M. and Bruggeman, C.A. (1991). Cytomegalovirus nucleic acid distribution within the human vascular tree. Am. J. Pathol. 138:563-567. Herberth, J.; Alimov, A.P.; Williams, J.P.; Malluche, H.H.; Koszewski, N.J. (2008). PTH regulation of the human cytomegalovirus immediate-early gene promoter. Biochem. Biophys. Res. Commun. 368:977-982. Herrmann, B.; Larsson, V.C.; Rubin, C.J.; Sund, F.; Eriksson, B.M.; Arvidson, J.; Yun, Z.; Bondeson, K. and Blomberg, J. (2004). Comparison of a duplex quantitative real-time PCR assay and the COBAS Amplicor CMV Monitor test for detection of cytomegalovirus. J. Clin. Microbiol. 42:1909-1914. Ho, M. (1990). Epidemiology of cytomegalovirus infections. Rev. Infect. Dis. 7:701710. Ho, S.K.; Lo, C.Y.; Cheng, I.K. and Chan, T.M. (1998). Rapid cytomegalovirus pp65 antigenemia assay by direct erythrocyte lysis and immunofluorescence staining. J. Clin. Microbiol. 36:638-640. Huang, E. and Johnson, R.A. (2000). Human cytomegalovirus-no longer just a DNA virus. Nat. Med. 6:863-864. Huber, M.T. and Compton, T. (1997). Characterization of a novel third member of the human cytomegalovirus glycoprotein H-glycoprotein L complex. J. Virol. 71:5391-5398.
103
References
Huber, M.T. and Compton, T. (1998). The human cytomegalovirus UL74 gene encodes the third component of the glycoprotein H-glycoprotein L-containing envelope complex. J. Virol. 72:8191-8197. Humar, A. (1999). Clinical utility of quantitative cytomegalovirus viral load determination for predicting cytomegalovirus disease in liver transplant recipients. MSc. Thesis, Toronto University. Canada. Ioudinkova, E.; Arcangeletti, M.C.; Rynditch, A.; De Conto, F.; Motta, F.; Covan, S.; Pinardi, F.; Razin, S.V. and Chezzi, C. (2006). Control of human cytomegalovirus gene expression by differential histone modifications during lytic and latent infection of a monocytic cell line. Gene. 384:120-128. Isomura, H.; Stiniski, M.F.; Kudoh, A.; Diakoku, T.; Shirata, N. and Tsurumi, T. (2005). Two SP1/SP3 binding sites in the major immediate-early proximal enhancer of human cytomegalovirus have a significant role in viral replication. J. Virol. 79(15):9597-9607. Isomura, H.; Stinski, M.F.; Kudoh, A.; Nakayama, S.; Iwahori, S.; Sato, Y. and Tsurumi, T. (2007). The late promoter of the human cytomegalovirus viral dna polymerase processivity factor has an impact on delayed early and late viral gene products but not on viral DNA synthesis. J. Virol. 81(12):6197-6206. Jankovski, A. and Sotelo, C. (1996). Sub ventricular zone-olfactory bulb migratory pathway in the adult mouse: cellular composition and specificity as determined by heterochronic and heterotopic transplantation. J. Comp. Neuro. 371:376396. Jie, L.; Wei, C.; YanChun, C.; LiChun, W.; WeiZhong, L.; LongDing, L. and QiHan, L. (2007). Analysis of HSV-I ICP22 effects on HCMV major immediate-early promoter structure. Sci. China Series C: Life Sci. 50(3):292-297. Johnson, D.C. and Spear, P.G. (1982). Monensin inhibits the processing of herpes simplex virus glycoproteins, their transport to the cell surface and the egress of virions from infected cells. J. Virol. 43:1102-1112. Kalejta, R.F. (2008). Functions of Human cytomegalovirus tegument proteins prior to immediate early gene expression. In Shenk, T. and Stinski, M.F. (ed.). Human cytomegalovirus; current topics in Microbiology and Immunology. SpringVerlag Berlin Heidelberg. 325:101-115.
104
References
Kari, B. and Gehrz, R. (1992). A human cytomegalovirus glycoprotein complex designated gC-II is amajor heparin-binding component of the envelope. J. Virol. 66:1761–1764. Kearns, A. M.; Guiver, M.; James, V. and King, J. (2001). Development and evaluation of a real-time quantitative PCR for the detection of human cytomegalovirus. J. Virol. Methods. 95:121-131. Keay, S. and Baldwin, B. (1991). Anti-idiotype antibodies that mimic gp86 of human cytomegalovirus inhibit viral fusion but not attachment. J. Virol. 65:5124–5128. Kent, W.J. (2002). BLAST--the BLAST- like alignment tool. Gen. Res. 12(4):656-664. Kerry, J.A.; Priddy, M.A. and Stenberg, R.M. (1994). Identification of Sequence Elements in the Human Cytomegalovirus DNA Polymerase Gene Promoter Required for Activation by Viral Gene Products. J. Virol. 68(7):4167-4176. Khanna, R. and Diamond, D.J. (2006). Human cytomegalovirus vaccine: time to look for alternative options. Trends Mol. Med. 12:26-33. Kim, C.K.; Song, J.H.; Kim, S.M.; Peck, K.R.; Oh, W.; Huh, W.; Kim, Y.G.; Kim, S.J.; Joh, J.W.; Lee, N.Y.; Park, C.G.; Hwang, E.S.; Cha, C.Y. and Oh, H.Y. (2003). Clinical usefulness of human cytomegalovirus antigenemia assay after kidney transplantation. Transplantation. 75:2151-2155. Kim, K.; Umamoto, S.; Trang, P.; Hai, R. and Liu, F. (2004). Intracellular expression of engineered RNase P ribozymes effectively blocks gene expression and replication of human cytomegalovirus. RNA. 10:438-447. Klein, A.; Barsuk, R.; Dagan, S.; Nusbaum, O.; Shouval, D. and Galun, E. (1997). Comparison of methods for the extraction of nucleic acid from hemolytic serum for PCR amplification of hepatitis B virus DNA sequences. J. Clin. Microbiol. 35:1897-1899. Kleines, M.; Schellenberg, K. and Ritter K. (2003). Efficient Extraction of Viral DNA and Viral RNA by the Chemagic Viral DNA/RNA Kit Allows Sensitive Detection of Cytomegalovirus, Hepatitis B Virus, and Hepatitis G Virus by PCR. J. Clin. Microbiol. 41(11):5273–5276. Koedood,
M.;
Fichtel,
A.;
Meier,
P.
and
Mitchell,
P.J.
(1995).
Human
cytomegalovirus (CMV) immediate-early enhancer/promoter specificity during embryogenesis defines target tissue of congenital HCMV infection. J. Virol. 69:2194-2207.
105
References
Kotchoni, S.O.; Gachomo, E.W.; Betiku, E. and Shonukan, O.O. (2003). A homemade kit for plasmid DNA mini-preparation. African J. Biotech. 2(4):8890. Kusne, S.; Grossi, P.; Irish, W.; St George, K.; Rinaldo, C.; Rakela, J. and Fung, J. (1999). Cytomegalovirus PP65 antigenemia monitoring as a guide for preemptive therapy: a cost effective strategy for prevention of cytomegalovirus disease in adult liver transplant recipients. Transplantation. 68:1125-1131. Lakowicz, J.R. (2003). Topics in Flourescence Spectroscopy: DNA Technology. Volume: 7. Kluwer Academic/ Plenum Publisher, New York. 7:10-15. Landolfo, S.; Gariglio, M.; Gribaudo, G. and Lembo, D. (2003). The human cytomegalovirus. Pharmacol. Ther. 98:269-297. Landry, M.L. and Ferguson, D. (1993). Comparison of quantitative cytomegalovirus antigenemia assay with culture methods and correlation with clinical disease. J. Clin. Microbiol. 31:2851-2856. Lang, D.; Gebert, S.; Arlt, H. and Stamminger, T. (1995). Functional interaction between the human cytomegalovirus 86-kilodalton IE2 protein and the cellular transcription factor CREB. J. Virol. 69:6030-6037. Lazzarotto, T.; Gabrielli, L.; Lanari, M.; Guerra, B.; Bellucci, T.; Sassi, M. and Landini, M.P. (2004). Congenital Cytomegalovirus Infection: Recent Advances in the Diagnosis of Maternal Infection. Human Immun. 65:410-415. Lee, A.H.; Suh, Y.S.; Sung, J.H.; Yang, S.H. and Sung, Y.C. (1997). Comparison of various expression plasmids for the induction of immune response by DNA immunization. Mol. Cells. 7:495-501. Legler, T.J.; Kohler, M. and Heermann, K.H. (1999). High-throughput extraction, amplification, and detection (HEAD) of HCV-RNA in individual blood donations. J. Clin. Virol. 13:95-103. Lengerova, M.; Racil, Z.; Volfova, P.; Lochmanova, J.; Berkovcova, J.; Dvorakova, D.; Vorlicek, J. and Mayer, J. (2007). Real-Time PCR Diagnostics Failure Caused by Nucleotide Variability within Exon 4 of the Human Cytomegalovirus Major Immediate-Early Gene. J. Clin. Microbio. 45(3):1042-1044. Leruez-Ville, M.; Ouachee, M.; Delarue, R.; Sauget, A.S.; Blanche, S.; Buzyn, A. and Rouzioux, C. (2003). Monitoring cytomegalovirus infection in adult and
106
References
pediatric bone marrow transplant recipients by a real-time PCR assay performed with blood plasma. J. Clin. Microbiol. 41:2040-2046. Levine, M. and Tjian, R. (2003). Transcription regulation and animal diversity. Nat. 424: 147–151. Lewin, B., (1997). Genes VI. Oxford University Press and Cell Press. 623:117:513. Li, H.; Dummer, J.S.; Estes, W.R.; Meng, S.; Wright, P.F. and Tang, Y.W. (2003). Measurement of human cytomegalovirus loads by quantitative realtime PCR for monitoring clinical intervention in transplant recipients. J. Clin. Microbiol. 41:187-191. Li, H.; Trang, P.; Kim, K.; Zhou, T.; Umamoto, S. and Liu F. (2006). Effective inhibition of human cytomegalovirus gene expression and growth by intracellular expression of external guide sequence RNA. RNA. 12:63–72. Li, L.; Kosugi, I.; Han, G.P.; Kawasaki, H.; Arai, Y.; Yakeshita, T. and Tsutsui, Y. (2008). Infection of cytomegalovirus-infected labyrinthitis in newborn mice by lipopolysaccharide: a model for hearing loss in congenital CMV infection. Lab. Invest. 88(7):722-730. Limaye, A.P.; Kirby, K.A.; Rubenfeld, G.D.; Leisenring, W.M.; Bulger, E. M.; Neff, M.J.; Gibran, N.S.; Huang, M.; Santo Hayes, T.K.; Corey, L. and Boeckh, M. (2008). Cytomegalovirus Reactivation in Critically Ill Immunocompetent Patients. JAMA. 300(4):413-422. Lin, M.T.; Wang, F.; Uitto, J. and Yoon, K. (2001). Differential expression of tissuespecific promoters by gene gun. The British journal of dermatology. 144:34-39. Lin, W.; Su, M.; Hsu, C.; Ho, Y.; Ngan, K.; Chiu, C. and Chen, P. (2005). Clinical and Endoscopic Features for Alimentary Tract Cytomegalovirus Disease: Report of 20 Cases with Gastrointestinal Cytomegalovirus Disease. Chang Gung Med. J. 28:476-484. Liu, J.W.; Pernod, G.; Dunoyer-Geindre, S.; Fish, R.J.; Yang, H.; Bounameaux, H. and Kruithof, E.K. (2006). Promoter dependence of transgene expression by lenti virus transduced human blood-derived endothelial progenitor cells. Stem Cells. 24: 199-208. Lockwood, M.R.; Liddle, J. and Kitsanta, P. (2006). Cytomegalovirus colitis-an unusual cause for diarrhea in an elderly woman. Oxford J. Age Agi. 35:198200.
107
References
Lodish, H.; Berk, A.; Matsudaira, P.; Koiser, C.A.; Krieger, M.; Scott, M.P.; Zipursky, S.L. and Darnell, J. (2004). Molecular cell biology. 5th ed. W.H. Freeman and company. New York. 160:115:377:363. Loginov, R. (2007). CMV-, EBV-, and HHV-6- DNAemia after liver transplantation. Academic dissertation. University of Helsinki. Loveland, A.N.; Nguyen, N.L.; Brignole, E.J. and Gibson, W. (2007). The aminoconserved domain of human cytomegalovirus UL80a proteins is required for key interactions during early stages of capsid formation and virus production. J. Virol. 81:620-628. Luganini, A.; Caposio, P.; Mondini, M.: Landolfo, S. and Gribaudo, G. (2008). New cell-based indicator assays for the detection of human cytomegalovirus infection and screening of inhibitors of viral immediate-early 2 protein activity. J. Appl. Microbiol. 105:1791-1801. Lukac, D.M.; Manuppello, J.R. and Alwine, J.C. (1994). Transcriptional activation by the human cytomegalovirus immediate-early proteins: requirements for simple promoter structures and interactions with multiple components of the transcription complex. J. Virol. 68:5184-5193. Mach, M.; Kropff, B.; Dal Monte, P. and Britt, W. (2000). Complex formation by human cytomegalovirus glycoproteins M (gpUL100) and N (gpUL73). J. Virol. 74:11881-11892. Macias, M.P. and Stinski, M.F. (1993). An in vitro system for human cytomegalovirus immediate early 2 protein (IE2)-mediated site-dependent repression of transcription and direct binding of IE2 to the major immediate early promoter. Proc. Natl. Acad. Sci. USA. 90:707-711. Macias, M.P.; Huang, L.; Lashmit, P.E. and Stinski, M.F. (1996). Cellular and viral protein binding to a cytomegalovirus promoter transcription initiation site: effects on transcription. J. Virol. 70(6):3628-3635. Maine, G.T.; Lazzarotto, T. and Landini, M.P. (2001). New developments in the diagnosis of maternal and congenital CMV infection. Expert Rev. Mol. Diagn. 1(1):19-29. Makrides, S.C. (1999). Components of vectors for gene transfer and expression in mammalian cells. Protein Expr. Purif. 17:183-202.
108
References
Marchini, A.; Liu, H. and Zhu, H. (2001). Human cytomegalovirus with IE-2 (UL122) deleted fails to express early lytic genes. J. Virol. 75:1870-1878. Maschmann, J.; Hamprecht, K.; Weissbrich, B.; Dietz, K.; Jahn, G. and Speer, C.P. (2006). Freeze-thawing of breast milk does not prevent cytomegalovirus transmission to a preterm infant. Arch. Dis. Child Fetal Neonatal. 91: 288-290. Mattes, F.M.; McLaughlin, J.E.; Emery, V.C.; Clark, D.A. and Griffiths, P.D. (2000). Histopathological detection of owl's eye inclusions is still specific for cytomegalovirus in the era of human herpesviruses 6 and 7. J. Clin. Pathol. 53:612-614. McPherson, M.J. and Møller, S.G. (2006). PCR the Basics. 2nd edition. Taylor & Francis Group, New York. McVoy, M.A.; Nixon, D.E.; Hur, J.K. and Adler, S.P. (2000). The Ends on herpesvirus
DNA
replicative
concatemers
contain
pac2
cis
cleavage/packaging elements and their formation is controlled by terminal cis sequences. J. Virol. 74:1587-1592. Meier, J. L. and Stinski, M. F. (1996). Regulation of human cytomegalovirus immediate-early gene expression. Intervirol. 39:331-342. Meier, J.; Lienicke, U.; Tschirch, E.; Krüger, D.H.; Wauer, R.R. and Prösch, S. (2005). Human Cytomegalovirus Reactivation during Lactation and Mother-toChild Transmission in Preterm Infants. J. Clin. Microbiol. 43(3):1318-1324. Mendelson, M.; Monard, S.; Sissons, P. and Sinclair, J. (1996). Detection of endogenous human cytomegalovirus in CD34+ bone marrow progenitors. J. Gen. Virol. 77(12):3099-102. Mendez, J.; Espy, M.; Smith, T.F.; Wilson, J.; Wiesner, R. and Paya, C.V. (1998). Clinical significance of viral load in the diagnosis of cytomegalovirus disease after liver transplantation. Transplantation. 65:1477-1481. Mengelle, C.; Sandres-Saune, K.; Pasquier, C.; Rostaing, L.; Mansuy, J.-M.; Marty, M.; Da Silva, I.; Attal, M.; Massip, P. and Izopet, J. (2003). Automated Extraction and Quantification of Human Cytomegalovirus DNA in Whole Blood by Real-Time PCR Assay. J. Clin. Microbiol. 41(8):3840-3845. Mersseman, V.; Böhm, V.; Holtappels, R.; Deegen, P.; Wolfrum, U.; Plachter, B. and Reyda, S. (2008). Refinement of strategies for the development of a human cytomegalovirus dense body vaccine. Med. Microb. Immuno. 197:97-107.
109
References
Minagawa, H.; Tanaka, S.; Toh, Y. and Mori, R. (1994). Detection of herpes simplex virus type 1-encoded RNA by polymerase chain reaction: different pattern of viral RNA detection in latently infected murine trigeminal ganglia following in vitro or in vivo reactivation. J. Gen. Virol 75:647-650. Mocarski, E.S., and Courcelle. C.T. (2001). Cytomegalovirus and their replication. In: Knipe, D.M. and Howley, P.M. (ed.), Fields Virology, 4th ed, Philadelphia, Lippincott Williams and Wilkins. 2:2629-2673. Mullis, K.B. and Faloona, F.A. (1987). Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 155:335-350. Munro, S.C.; Hall, B.; Whybin, L.R.; Leader, L.; Robertson, P.; Maine, G.T. and Rawlinson, W.D. (2005). Diagnosis of and screening for cytomegalovirus infection in pregnant women. J. Clin. Microbiol. 43(9):4713-4718. Murphy, E. and Shenk, T. (2008). Human Cytomegalovirus Genome. In: Shenk, T. and Stinski, M.F. (Eds.). Human cytomegalovirus; current topics in Microbiology and Immunology. Spring-Verlag Berlin Heidelberg. 325:1-19. Murphy, E.; Yu, D.; Grimwood, J.; Schmutz, J.; Dickson, M.; Jarvis, M.A.; Hahn, G.; Nelson, J.A.; Myers, R.M. and Shenk, T.E. (2003). Coding potential of laboratory
and
clinical
strains
of
human
cytomegalovirus.
PNAS.
100(25):14976-14981. Musiani, M.; Roda, A.; Zerbini, M.; Pasini, P.; Gentilomi, G.; Gallinella, G. and Venturoli, S. (1996). Chemiluminescent in situ hybridization for the detection of cytomegalovirus DNA. Am. J. Pathol. 148:1105-1112. Nelson, J.A. (2007). Small RNAs and Large DNA Viruses. New England J. Med. 357:25. Nevels, Μ.; Brune, W. and Shenk, T. (2004). SUMOylation of the human cytomegalovirus 72-kilodalton IE1 protein facilitates expression of the 86kilodalton IE2 protein and promotes viral replication. J. Virol. 78:7803-7812. Newcomb, W.W.; Juhas, R.M.; Thomsen, D.R.; Homa, F.L.; Burch, A.D.; Weller, S.K. and Brown, J.C. (2001). The UL6 gene product forms the portal for entry of DNA into the herpes simplex virus capsid. J. Virol. 75:10923-10932. Nitsche, A.; Steuer, N.; Schmidt, C.A.; Landt, O. and Siegert, W. (1999). Different real-time PCR formats compared for the quantitative detection of human cytomegalovirus DNA. Clin. Chem. 45:1932-1937.
110
References
Numazaki, K. (2005). Human cytomegalovirus infections in premature infants by breast fedding. African J. Biotech. 4(9):867-872. Nye, M.B.; Leman, A.R.; Meyer, M.E.; Menegus, M.A. and Rothberg, P.G. (2005). Sequence diversity in the glycoprotein B gene complicates real-time PCR assays for detection and quantification of cytomegalovirus. J. Clin. Microbiol. 43:4968-4971. Pande, H.; Campo, K.; Tanamachi, B.; Forman, S.J. and Zaia, J.A. (1995). Direct DNA immunization of mice with plasmid DNA encoding the tegument protein pp65 (ppUL83) of human cytomegalovirus induces high levels of circulating antibody to the encoded protein. Scand. J. Infect. Dis. Suppl. 99:117-120. Pang, X.L.; Foxa, J.D.; Fentona, J.M.; Millere, G.G.; Caliendof, A.M. and Preiksaitisa, J.K. (2009). Inter laboratory Comparison of Cytomegalovirus Viral Load Assays. Am. J. Transplantation. 9:258-268. Paradies, M.A.; Grishkat, H.; Smeyne, R.J.; Oberdick, J.; Morgan, J.I. and Eisenman, L.M. (1996). Correspondence between L7-lacZ-expressing Purkinje cells and labeled olivocerebellar fibers during late embryogenesis in the mouse. J. Comp. Neurol. 374:451-466. Pass, R.F. (2001). Cytomegalovirus, pp. 2675-2705. In: Knipe, D.M. and Howley, P.M. (ed.), Fields Virology, 4th ed, vol. 2. Philadelphia, Lippincott Williams and Wilkins. Pass, R.F.; Zhang, C.; Evans, A.; Simpson, T.; Andrews, W.; Huang, M.; Corey, L.; Hill, J.; Davis, E.; Flanigan, C. and Cloud, G. (2009). Vaccine Prevention of Maternal Cytomegalovirus Infection. New England J. Med. 360:1191-1199. Paya, C.V.; Holley, K.E.; Wiesner, R.H.; Balasubramaniam, K.; Smith, T.F.; Espy, M.J.; Ludwig, J.; Batts, K.P.; Hermans, P.E. and Krom, R.A. (1990). Early diagnosis of cytomegalovirus hepatitis in liver transplant recipients: role of immunostaining, DNA hybridization and culture of hepatic tissue. Hepatol. 12:119-126. Pellet, P.E. and Roizman, B. (2006). The family Herpesviridae: a brief information. Lippicott, William and Wilkins, Philadelphia. Pérez-Pinera, P.; Menéndez-González, M. and Vega, J.A. (2006). Deletion of DNA sequences of using a polymerase chain reaction based approach. Mol. Biol. Gen. 9(5).
111
References
Petrik, D.T.; Schmitt, K.P. and Stinski, M.F. (2006). Inhibition of cellular DNA synthesis by human cytomegalovirus IE86 protein is necessary for efficient virus replication. J. Virol. 80(8):3872-3883. Pfeffer, S.; Sewer, A.; Lagos-Quintana, M.; Sheridan, R.; Sander, C.; Grasser, F.A.; van Dyk, L.F.; Ho, C.K.; Shuman, S.; Chien, M.; Russo, J.J.; Ju, J.; Randall, G.; Lindenbach, B.D.; Rice, C.M.; Simon, V.; Ho, D.D.; Zavolan, M. and Tuschl, T. (2005). Identification of microRNAs of the herpesvirus family. Nat. Methods. 2:269-276. Pignatelli, S.; Dal Monte, P.; Rossini, G. and Landini, M.P. (2004). Genetic polymorphisms among human cytomegalovirus (HCMV) wild-type strains. Rev. Med. Virol. 14:383–410. Piiparinen, H. (2004). Quantitative PCR in the Diagnosis and Monitoring of Human Cytomegalovirus
Infection
in
Organ
Transplant
Patients.
Academic
Dissertation. University of Helsinki. Plachter, B.; Sinzger, C. and Jahn. G. (1996). Cell types involved in replication and distribution of human cytomegalovirus. Adv. Virus Res. 46:195-261. Plotkin, S.A. (2001). Vaccination against cytomegalovirus. Arch. Virol. Suppl. 121134. Plotkin, S.A.; Starr, S.E.; Friedman, H.M.; Brayman, K.; Harris, S.; Jackson, S.; Tustin, N.B.; Grossman, R.; Dafoe, D. and Barker, A. (1991). Effect of Towne live virus vaccine on cytomegalovirus disease after renal transplant. a controlled trial. Annals Inter. Med. 114:525-531. Pouria, S.; State, O.I.; Wong, W. and Hendry, B.M. (1998). CMV infection is associated with transplant renal artery stenosis. Q. J. Med. 91:185-189. Prichard, M.; Duke, G. and Mocarski, E. (1996). Human cytomegalovirus uracil DNA glycosylase is required for the normal temporal regulation of both DNA synthesis and viral replication. J. Virol. 70:3018-3025. Prichard, M.N.; Penfold, M.E.; Duke, G.M.; Spaete, R.R. and Kemble, G.W. (2001). A review of genetic differences between limited and extensively passaged human cytomegalovirus strains. Rev. Med. Virol. 11:191-200. Prince, H.E. and Leber, A.L. (2002). Validation of
In-House assay for
cytomegalovirus Immunoglobulin G (CMV IgG) avidity and relationship of avidity to CMV IgM level. Clin. Diagn. Lab. Immunol. 9(4):824-827.
112
References
Proença, J.T.; Coleman, H.M.; Connor, V.; Winton, D.J. and Efstathiou, S. (2008). A historical analysis of herpes simplex virus promoter activation in vivo reveals distinct populations of latently infected neurons. J. Gener. Virol. 89:2965-2974. Radhakrishnan, P.; Basma, H.; Klinkebiel, D.; Christman, J.; Cheng, P.-W. (2008). Cell type-specific activation of the cytomegalovirus promoter by dimethyl sulfoxide and 5-Aza-2´-deoxycytidine. Int. J. Biochem. Cell Biol. 40(9):19441955. Razonable, R.R.; Brown, R.A.; Wilson, J.; Groettum, C.; Kremers, W.; Espy, M.; Smith, T.F. and Paya, C.V. (2002). The clinical use of various blood compartments for cytomegalovirus (CMV) DNA quantitation in transplant recipients with CMV disease. Transplantation. 73:968-973. Reeves, M.B.; Davies, A.A.; McSharry, B.P.; Wilinson, G.W. and Sinclair, J.H. (2007). Complex I binding by virally encoded RNA regulates mitochondriainduced cell death. Sci. 316(5829):1345-1348. Reeves, M.B.; MacAry, P.A.; Lehner, P.J.; Sissons, J.G. and Sinclair, J.H. (2005). Latency, chromatin remodeling, and reactivation of human cytomegalovirus in the dendritic cells of healthy carriers. Proc. Natl. Acad. Sci. USA. 102:41404145. Revello, M.G.; Zavattoni, M; Sarasini, A.; Percivalle, E.; Simoncini, L. and Gerna. G. (1998). Human cytomegalovirus in blood of immunocompetent persons during primary infection: prognostic implications for pregnancy. J. Infect. Dis. 177:1170-1175. Robain, M.; Carre, N.; Dussaix, E.; Salmon-Ceron, D. and Meyer. L. (1998). Incidence and sexual risk factors of cytomegalovirus seroconversion in HIVinfected subjects. The SEROCO Study Group. Sex Transm. Dis. 25:476-480. Roizman, B. (2000). Redefining virology. Sci. 288:2327–2328. Ryckman, B.J.; Jarvis, M.A.; Drummond, D.D.; Nelson, J.A. and Johnson, D.C. (2006). Human cytomegalovirus entry into epithelial and endothelial cells depends on genes UL128 to UL150 and occurs by endocytosis and low-pH fusion. J. Virol. 80:710-722. Saiki, R.K.; Gelfand, D.H.; Stoffel, S.; Scharf, S.J.; Higuchi, R.; Horn, G.T.; Mullis, K.B. and Erlich, H.A. (1987). Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Sci. 239:487-491.
113
References
Saiki, R.K.; Scharf, S.; Faloona, F.; Mullis, K. B.; Horn, G.T.; Erlich, H.A. and Arnheim, N. (1985). Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Sci. 230:1350-1354. Sambrook, J.; Fritsch, E. F. A. and Maniatis, T. (1989). Molecular cloning: a laboratory manual. 2nd edition. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, NY. Sanders, R.L.; Clark, C.L.; Morello, C.S. and Spector, D.H. (2008). Development of Cell Lines that Provide Tightly Controlled Temporal Translation of the Human Cytomegalovirus IE2 Proteins for Complementation and Functional Analyses of
Growth-Impaired
and
Non-Viable
IE2
Mutant
Viruses.
J.
Virol.
doi:10.1128/JVI.00675-08. Sandrine, F.; Philippe, R.; Viviane, M.; Elodie, S.; Yvon, E.; Corinne, L. (2009). Human cytomegalovirus seroprevalence and risk of seroconversion in a fertility clinic population. Obstetrics and Gynecology. 114(2): 285-291. Sarisky, R. and Hayward, G. (1996). Evidence that the UL84 gene product of human cytomegalovirus is essential for promoting oriLyt-dependent DNA replication and formation of replication compartments in cotransfection assays. J. Virol. 70:7398-7413. Schafer, P.; Tenschert, W.; Gutensohn, K. and Laufs, R. (1997). Minimal effect of delayed sample processing on results of quantitative PCR for cytomegalovirus DNA in leukocytes compared to results of an antigenemia assay. J. Clin. Microbiol. 35:741-744. Scholz, M.; Wilhelm Doerr, H. and Cinatl, J. (2001). Inhibition of cytomegalovirus immediate early gene expression: a therapeutic option?. Antiviral Res. (Rev.). 49:129-145. Schwartz, R.; Helmich, B. and Spector, D.H. (1996). CREB and CREB-binding proteins play an important role in the IE2 86-kilodalton protein-mediated transactivation of the human cytomegalovirus 2.2-kilobase RNA promoter. J. Virol. 70:6955-6966. Scully, A.L.; Sommer, M.H.; Schwartz, R. and Spector, D.H. (1995). The human cytomegalovirus IE2 86 kDa protein interacts with an early gene promoter via site-specific DNA binding and proteinprotein associations. J. Virol. 69:65336540.
114
References
Sekerkova, G.; Katarova, Z.; Joo, F.; Wolff, J.R.; Prodan, S. and Szabo, G. (1997). Visualization of beta-galactosidase by enzyme and immunohistochemistry in the olfactory bulb of transgenic mice carrying lacZ transgene. J. Histochem. Cytochem. 45:1147-1155. Sia, I.G. and Patel, R. (2000). New strategies for prevention and therapy of cytomegalovirus infection and disease in solid-organ transplant recipients. Clin. Microbiol. Rev. 13:83-121. Simon, C.O.; Seckert, C.K.; Grzimek, N.K.A. and Reddehase, M.J. (2006). Murine model of cytomegalovirus latency and reactivation: the silencing/desilencing and immune sensing hypothesis, p. 483-500. In: Reddehase, M.J. (ed.), Cytomegalovirus Molecular Biology and Immunology. Caister Academic Press, Norfolk, UK. Sinclair, J. and Sissons, P. (2006). Latency and reactivation of human cytomegalovirus. J. Gen. Virol. 87:1763-1779. Singal, R. and Ginder, G.D. (1999). DNA methylation. Blood. 93:4059-4070. Sinzger, C.; Grefter, A.; Plachter, B.; Gouw, A.S.; The, T.H. and Hahn, G. (1995). Fibroblasts, epithelial cells, endothelial cells and smooth muscle cells are major targets of human cytomegalovirus infection in lung and gastrointestinal tissues. J. Gen. Virol. 76:741-750. Smale, T. and Kadonaga, T. (2003). The RNA polymerase II core promoter. Annu. Rev. Biochem. 72:449-479. Smyth, R.L.; Sinclair, J.; Scott, J.P.; Gray, J.J.; Higenbottam, T.W.; Wreghitt, T.G.; Wallwork, J. and Borysiewicz, L.K. (1991). Infection and reactivation with cytomegalovirus strains in lung transplant recipients. Transplantation. 52:480482. Soetens, O.; Vauloup-Fellous, C.; Foulon, I.; Dubreuil, P.; De Saeger, B.; GrangeotKeros, L. and Naessens, A. (2008). Evaluation of Different Cytomegalovirus (CMV) DNA PCR Protocols for Analysis of Dried Blood Spots from Consecutive Cases of Neonates with Congenital CMV Infections. J. Clin. Microbiol. 46(3):943-946. Sommer, M.H.; Scully, A.L. and Spector, D.H. (1994). Transactivation by the human cytomegalovirus IE2 86-kilodalton protein requires a domain that binds to both the TATA box-binding protein and the retinoblastoma protein. J. Virol. 68:6223-6231. 115
References
Stagno, S.; Pass, R.F.; Cloud, G.; Britt, W.J.; Henderson, R.E.; Walton, P.D.; Veren, D.A.; Page, F. and Alford. C.A. (1986). Primary cytomegalovirus infection in pregnancy. Incidence, transmission to fetus, and clinical outcome. JAMA. 256:1904-1908. Stenberg, R.M. (1996). The human cytomegalovirus major immediate-early gene. Intervirol. 39: 343-349. Stenberg, R.M. and Kerry, J.A. (1995). Cytomegalovirus genes: their structure and function. Scand. J. Infect. Dis. Suppl. 99:3-6. Stinski, M.F. and Isomura, H. (2008). Role of the cytomegalovirus major immediate early enhancer in acute infection and reactivation from latency. Med. Microbiol. Immunol. 197:223-231. Stocher, M.; Leb, V.; Bozic, M.; Kessler, H.H.; Halwachs-Baumann, G.; Landt, O.; Stekel, H. and Berg, J. (2003). Parallel detection of five human herpes virus DNAs by a set of real-time polymerase chain reactions in a single run. J. Clin. Virol. 26:85-93. Streblow, D.N.; Varnum, S.M. and Smith, R.D. (2006). A proteiomics analysis of human cytomegalovirus particles. P: 91-110. In Reddehase, M.J. (ed.), Cytomegalovirus Molecular Biology and Immunology. Caister Academic Press, Norfolk, UK. Sullivan, V.; Talarico, C.L.; Stanat, S.C.; Davis, M.; Coen, D.M. and Biron, K.K. (1992). A protein kinase homologue controls phosphorylation of ganciclovir in human cytomegalovirus-infected cells. Nat. 358:162-164. Sweet, C. (1999). The pathogenicity of cytomegalovirus. FEMS Microbial. Rev. 23(4):457-482. Tamashiro, J.C. and Spector, D.H. (1986). Terminal structure and heterogeneity in human cytomegalovirus strain AD169. J. Virol. 59:591-604. Tang, Q. and Maul, G.G. (2003). Mouse cytomegalovirus immediate-early protein 1 binds with host cell repressors to relieve suppressive effects on viral transcription and replication during lytic infection. J. Virol. 77:1357-1367. Tarragó D.; Mateos, M.-L.; Avellón, A.; Pérez-Vázquez, M.-D. and Tenorio, A. (2004). Quantitation of Cytomegalovirus DNA in Cerebrospinal Fluid and Serum Specimens From AIDS Patients Using a Novel Highly Sensitive Nested
116
References
Competitive PCR and the Cobas Amplicor CMV Monitor. J. Med. Virol. 72:249256. Tawfeeq, H.M. (2009). Identification of Human cytomegalovirus by Polymerase Chain Reaction (PCR) compared with Enzyme Linked Immunosorbent Assay (ELISA). Diploma thesis. Sulaimani University. Tencomnao, T.; Rakkhitawatthana, V. and Sukhontasing, K. (2008). Evaluation of a novel luciferase reporter construct: a positive control plasmid for reporter gene assay. African J. Biotech. 7(13):2124-2127. Tomasec, P.; Wang, E.C.; Davison, A.J.; Vojtesesk, B.; Armstrong, M.; Griffin, C.; McSharry, B.P.; Morris, R.J.; Llewellyn-Lacey, S.; Rickards, C.; Nomoto, A.; Sinzger, C. and Wilkinson, G.W. (2005). Down regulation of natural killer cellactivating ligand CD155 by human cytomegalovirus UL141. Nat. Immunol. 6:181-188. Tucker, C.; Endo, M.; Hirono, I. and Aoki, T. (2000). Assessment of DNA vaccine potential for juvenile Japanese flounder Paralichthys olivaceus, through the introduction of reporter genes by particle bombardment and histopathology. Vaccine. 19:801-809. Van den Berg, A.P.; van der Bij, W.; van Son, W. J.; Anema, J.; van der Giessen, M.; Schirm, J.; Tegzess, A.M. and The, T.H. (1989). Cytomegalovirus antigenemia as a useful marker of symptomatic cytomegalovirus infection after renal transplantation-a report of 130 consecutive patients. Transplantation. 48:991995. Van den Pol, A.N. and Ghosh, P.K. (1998). Selective Neuronal Expression of Green Fluorescent Protein with Cytomegalovirus Promoter Reveals Entire Neuronal Arbor in Transgenic Mice. J. Neurosci. 18(24):10640-10651. Van der Bij, W.; Schirm, J.; Torensma, R.; van Son, W.J.; Tegzess, A.M. and The, T.H. (1988). Comparison between viremia and antigenemia for detection of cytomegalovirus in blood. J. Clin .Microbiol. 26:2531-2535. Vander Strate, B.W.; Harmsen, M.C.; Schäfer, P.; Swart, P.J.; The, T.H.; Jahn, G.; Speer, C.P.; Meijer, D.K.F. and Hamprecht, K. (2001). Viral load in breast milk correlates with transmission of human cytomegalovirus to preterm neonates, but lactoferrin concentrations do not. Clin. Diagn. Lab. Immunol. 8(4):818-821. Varnum, S.M.; Streblow, D.N.; Monroe, M.E.; Smith, P.; Auberry, K.J.; Pasa-Tolic, L.; Wang, D.; Camp, D.G.; Rodland, K.; Wiley, S.; Britt, W.; Shenk, T.; Smith, 117
References
R.D. and Nelson, J.A. (2004). Identification of
proteins in human
cytomegalovirus (HCMV) particles: the HCMV proteome. J. Virol. 78:1096010966. Vince, A.; Poljak, M. and Seme, K. (1998). DNA extraction from archival Giemsastained bone-marrow slides: comparison of six rapid methods. Br. J. Haematol. 101:349-351. Vincent, E.; Gu, Z.; Morgenstern, M.; Gibson, C.; Pan, J. and Hayden, R.T. (2009). Detection of Cytomegalovirus in Whole Blood Using Three Different Real-Time PCR Chemistries. J. Mol. Diagn. 11:54-59. Wang, X.; Huong, S.M.; Chiu, M.L.; Raab-Traub, N. and Huang E.S. (2003). Epidermal growth factor receptor is a cellular receptor for human cytomegalovirus. Nat. 424:456-61. Wanishsawad, C.; Zhou, Y.F. and Epstein, S.E. (2000). Chlamydia pneumonia: induced
transactivation
of
the
major
immediate
early
promoter
of
cytomegalovirus: potential synergy of infectious agents in the pathogenesis of atherosclerosis. J. Infect. Dis. 181(2):787-790. Wheeler, D.G. and Cooper, E. (2001). Depolarization Strongly Induces Human Cytomegalovirus Major Immediate-Early Promoter/Enhancer Activity in Neurons. J. Biol. Chem. 276(34):31978-31985. White, E.A. and Spector, D.H. (2005). Exon 3 of the Human Cytomegalovirus Major Immediate-Early Region Is Required for Efficient Viral Gene Expression and for Cellular Cyclin Modulation. J. Virol. 79(12):7438-7452. White, E.A.; Del Rosario, C.J.; Sanders, R.L. and Spector, D.H. (2007). The IE2 60Kilodalton
and
40-Kilodalton
Proteins
Are
Dispensable
for
Human
Cytomegalovirus Replication but Are Required for Efficient Delayed Early and Late Gene Expression and Production of Infectious Virus. J. Virol. 81(6):25732583. Winter, P.C.; Hickey, G.I. and Fletcher, H.L. (1998). Instant Notes in Genetics. Bios scientific publisher, P: 275. Witz, C.A.; Duan, Y.; Burns, W.N.; Atherton, S.S. and Schenken, R.S. (1999). Is there a risk of cytomegalovirus transmission during in vitro fertilization with donated oocytes?. Fertil. Steril. 71:302-307.
118
References
Wu, W.; Welsh, M.J.; Kaufman, P.B. and Zhang, H.H. (2003). Gene Biotechnology. 2nd edition. CRC Press LLC, Florida. Xu, Z.L.; Mizuguchi, H.; Ishii-Watabe, A.; Uchida, E.; Mayumi, T. and Hayakawa, T. (2001). Optimization of transcriptional regulatory elements for constructing plasmid vectors. Gene. 272:149-156. Yan, H.; Koyano, S.; Inami, Y.; Yamamoto, Y.; Suzutani, T.; Mizuguchi, M.; Ushijima, H.; Kurane, I. and Inoue, N. (2008). Genetic variations in the gB, UL144 and UL149 genes of human cytomegalovirus strains collected from congenitally and postnatally infected Japanese children. Arch. Virol. 153:667-674. Yee, L.F.; Lin, P.L. and Stinski, M.F. (2007). Ectopic expression of HCMV IE72 and IE86 proteins is sufficient to induce early gene expression but not production of infectious virus in undifferentiated promonocytic THP-1 cells. Virol. 363:174188. Yoo, Y.D.; Chiou, C-J.; Choi, K.S.; Yi, Y.; Michelson, S.; Kim, S.; Hayward, G.S. and Kim, S-J. (1996). The IE2 regulatory protein of human cytomegalovirus induces expression of the human transforming growth factor beta 1 gene through an Egr-1 binding site. J. Virol. 70:7062-7070. Yu, D.; Ellis, H.M.; Lee, E.C.; Jenkins, N.A.; Copeland, N.G. and Court, D.L. (2000). An efficient recombination system for chromosome engineering in Escherichia coli. Proc. Natl. Acad. Sci. USA. 97:5978-5983. Yu, D.; Silva, M.C. and Shenk, T. (2003). Functional map of human cytomegalovirus AD169 defined by global mutational analysis. Proc. Natl. Acad. Sci. USA. 100:12396-12401. Zhang, Z.; Huang, Y. and Zhu, H. (2008). A highly efficient protocol of generating and analyzing VZV ORF deletion mutants based on a newly developed luciferase VZV BAC system. J. Virol. Methods. 148:197-204. Zhu, J.; Quyyumi, A.A.; Norman, J.E.; Csako, G. and Epstein, S.E. (1999). Cytomegalovirus in the Pathogenesis of Atherosclerosis: The Role of Inflammation as Reflected by Elevated C - reactive protein Levels. J. Am. Coll. Cardiol. 34(6):1738-1743. Ziyaeyan, M.; Sabahi, F.; Alborzi, A.; Mahboudi, F.; Karimi, M.; Ramzi, M.; Abbasian, A. and Kazemnejad, A. (2005). Development of a Sensitive Quantitative Competitive PCR Assay for Detection of Human Cytomegalovirus DNA. Iranian Biomed. J. 9(4):187-191. 119
التحليل بالتسلسل النيوكلوتايدي لبروموترات فيروس المضخم لخاليا اإلنسان
رسالة مقدمة إلى مجلس كلية العلوم /جامعة السليمانية كجزء من متطلبات نيل شهادة ماجستير في علوم الحياة /علم الفيروسات الجزيئي
من قبل
ثةيوةست جمال جالل على بكالوريوس علوم الحياة 3002 - دبلوم عالي أحياء مجهرية السريرية 3007 -
بإشراف
األستاذ المساعد د .فرهاد معروف البرزنجي
شعبان 0120هـ
آب 3000م
الخـالصة االختبارات المصلية هي الطرق الوحيدة المتاحة حاليا على نطاق واسع في هذا البلد. ولكن الكشف الخاص باستخدام PCRتعتبر من الطرق الذهبية لالتكتشا
حتى في المراح
المبكرة قب الكشف عن المستضدات .واظهرت النتائج ان من 031عينة من مص الدم والتي شخصت بتقنية ELISAوتكانت إيجابيتها مختلفة للغلوبولين المناعي Mو %75.51, Gمن
الخالصة
جينوم هذه العينات شخصت ب .PCRاظهرت 75عينة اإلصابة بالفيروس بال ، ELISAبينما عند استخدام PCRاظهرت % 81.73من العينات نتيجة إيجابية للجينوم ،ومن 47عينة ايجابية للغلوبولين ,Mبتقنية PCRشخصت %83.33من جينوم هذه العينات ,في حين من 33عينة سلبية عند استخدام ال )%77.77( 08 ، ELISAمنها اظهرت نتيجة إيجابية عند استخدام .PCR نفذت عمليتي التضخيم بال PCRو ربط بروموترات الفيروس الماخوذة من ستة مواقع مختلفة على بالزميدات ، pJET1.2/Bluntوبعد قراءة لتتباع النيوتكلوتيدى للبالزميدات المكونة و مقارنتها بتسلس
البروموترات المضخمة لعزالت HCMVالمحلية مع تسلس
النيوتكلوتيدات المنشورة للعزالت الطبيعية والمختبرية أظهرت العديد من االختالفات في تسلس البروموترات المحلية المعزولة مقارنة مع السالالت المنشورة. صنعت بالزميدتين حديثتين عن طريق ربط البروموترات بناقالت مختلفة ,واحدة على ناقلة pTZ57Rواالخر على ناقلة pBR322بعد حذ
جين tetمن هذا الناق .وتكان الهد
من إعادة الربط هذه وصنع هذه النواق لتحديد ما اذا تكان توجه الكاسيتات على هذه النواق له تاثير على التعبير الجيني ,ولدراسة اختالفات التعبير في ناقالت مختلفة تحت سيطرة بروموترات الفيروس .واستخدمت هذه النواق في فحص أنزيم β–galactosidaseولكن البينات لم تظهر في هذه الدراسة ,ألن النتائج أظهرت قدرة البروموترات نشطة على دفع جين LacZ للتعبير في الخاليا البكتيرية على نواق مختلفة العدد في هذه الخاليا ,لهذا لم تظهر البيانات هنا لكونها تحتاج الى مزيد من العم لتوثيق النتائج.
أ
تورةكانى شيكارى ِريزبةندى نيوكلي َوتايدى ث ِر َوم َو َ مروظ ظايروسى سايت َوميطال َوى َ َ نامةيةكة ثيَشكةش بة ئةنجومةنى كؤليَجى زانست /زانكؤى سليَمانى كراوة بروانامةى ماستةر لة وةكو بةشيَك لة ثيَداويستييةكانى بةدةستهيَنانى ِ لوجى /طةردي ظاير َوسي بايو َ مايكر َو َ
لةاليةن
ثةيوةست جمال جالل عةلي بةكالؤريؤس لة بايؤلؤجيدا 3002 - دبل َومى باالَ لة مايكر َوباي َول َوجى كلينيكيدا 3007 -
بةسةرثةرشتى ثرؤفيسؤرى ياريدةدةر
د .فةرهاد معروف بةرزنجى
ئادار 3000
طةالو َيذ 3700
زايينى
ثوخـتـــــــة
كوردى
ثوخـتـــــة
بو دةست نيشانكردنى دذةتةن و جياكردنةوةى لة ئيَستادا تيَستةكانى سيرةم تةنيا ِريَطةية َ نةخوشيةكة .بةالَم دةست نيشانكردن و دياريكردنى جين َومى طلوبيولينى بةرطرى دذى َ جورةكانى َ َ قوناغة سةرةتاييةكانى تووشبوون تةنانةت ثيَش ظاير َوسةكة بة بةكارهيَنانى PCRلة َ بو دةست نيشانكردن .ئةنجامةكانى دروستبوونى دذة تةنةكان ،بة ريَطةيةكى زيَ ِرين دادةنريَت َ ثوزةتيظيتيان جياواز بوو 031سيرةمى نةخوش كة بة تةكنيكى ELISAدةست نيشانكرابوون و َ َ بو طل َوبيولينى بةرطرى Mو Gبةالَم بةه َوى دةست نيشانكردن بة PCRدةركةوت كة َ ظايروسةكةيان تياداية .لة 64نمونةى دةستنيشانكراو بة جينومى %75.71ى ئةم نمونانة َ َ طلوبيولينى بةرطرى Mو ,Gبة تةكنيكى PCR بو هةردوو َ ثوزةتيظ بوون َ ELISAكة َ ثوزةتيظ دةركةوت كة %81.63ى ئةم نموونانة جينومى ظاير َوسةكةيان تياداية ,لة 46نموونةى َ َ جينومى بو طل َوبيولينى بةرطرى Mبة تةكنيكى PCRدةركةوت كة %83333ى ئةم نموونانة َ َ َ ظاير َوسةكةيان تياداية ,بةالَم لة 33سامثلدا كة نيَطةتيظ بوون بة تةكنيكى 08 ,ELISAيان ظايروسةكةيان تيادا دةست نيشانكرا بة .PCR جينومى ()%76.76 َ َ تورى هةلَبذيَردراو لة شويَنى جياواز لة مو َ ثر َو َ فرةكردن بة PCRو كلَ َونكردنى شةش ِ ميطالو لةسةر ثالزميدى pJET1.2/Bluntو ثاش ِريزبةندى ئةم سايتو جينومى ظاير َوسى َ َ َ ظايروسى خوجيي يانةى HCMVو بةراوردكردنيان بة ِريزبةندية بالَوكراوةكانى َ جياكراوة َ سايتوميطال َوى سروشتي و تيرةى تاقيطةيى ئةنجامةكان دةريانخست كة لة نيَوان جياكراوةكانمان َ و ئةو تيرانةى كة ثيَشتر بالَوكراونةتةوة جياوازى هةية. طالو لة سةر تورةكانى ظاير َوسى سايت َومي َ ثر َوم َو َ دوو ثالزميدى تازة دروستكرا بة لكاندنى ِ دوو ثالزميدى جياواز ,يةكيَكيان لة سةر ثالزميدى pTZ57Rو ئةوىتريان لة سةر ثالزميدى pBR322دواى البردنى جينى tetلةم ثالزميدة .مةبةستى دروستكردنى ئةم ثالزميدانة ب َو دةربرين و هةروةها زانينى كاريطةرى ِريَرةوى لكاندنى ئةم كاسيَتة دروستكراوانة لةسةر تواناى ِ دةربرين لة ثالزميدى جياوازدا ,ئةم ثالزميدة تازة طو ِرانكارى لة تواناى ب َوتاقيكردنةوةى َ ِ دروستكراوانةلة تاقيكردنةوةى β-galactosidaseبةكارهيَنران بةالَم ليَرةدا داتاكانمان تورةكانى ثر َوم َو َ نةخستونةتة ِروو ,لةبةرئةوةى ئةنجامى ئةم تاقيكردنةوةية دةريخست كة ِ دةرببريَت لة خانة ناوك ميطالو ضاالكةو تواناى ئةوةى هةية كة جينى LacZ سايتو ظاير َوسى َ َ ِ جورى ثالزميدى بةكارهيَنراودا ,ئةم ئةنجامةش ثيَويستى بة سةرةتاييةكانى بةكتريادا ولة هةردوو َ بوية ليَرةدا داتاكانمان نةخستونةتة ِروو. كارى زياترة َ
ب
