MODEL QUESTION Biology Ultra short Questions

vYVªk ‘kkWVZ iz’u

1-

What is the function of Endosperm?

2-

What is formed by the entire ovary?

345678910111213141516171819202122-

mark: 1 Each

vad% izR;sd 1

Hkwz.kiks”k dk D;k dk;Z gS\ iq"i ds vaMk’k; ls D;k curk gS\ Meiosis occurs in which type of cells?

v/kZlw=hfoHkktu fdl izdkj dh dksf’kdkvksa esa gksrk gS\ What do you mean by Syngamy?

;qXe.k fdls dgrs gS\a What is micropropagation?

lw{e&iztuu D;k gS\ What do you mean by Amphimixis?

mHk;feJ.k ls vki D;k le>rs gS\a What is Apomixis?

v&;qXed iztuu D;k gS\ In which common plant asexual reproduction occurs by Corm?

fdl ikS/ks esaq vySfxd iztuu dUn ds }kjk ik;k tkrk gS\ What do you mean by homozygous?

Le;qXed dk D;k vFkZ gS\ What is genotype?

^ thuksVkbi^ D;k gS\ What is monohybrid cross?

,dy^&ladj.k ØkWl D;k gS\ Who first reported Mutation?

fdl oSKkfud us lcls igys mRifjorZu dh [kkst dh\ Who proposed the Chromosomal theory of inheritance?

fdl oSKkfud us oa’kkuqØe ds xq.klw= fl)kUr dk izLrko j[kk\ What is meant by the term ‘Locus’?

vkuqoaf'kdh esa ^yksdl^^dk D;k vFkZ gS\ ‘Why do grey body and red eyes occur in the same individual of Dropsphila?

D;ksa Hkwjk ‘kjhj vkSj yky vkW[ksa ,d lkFk MªkslksfQyk esa ik, tkrs gS\a What are contrasting pairs of factors in Mendelian crosses called?

esaMy s ds ØkSlst esa fo”ke tksMh+ dkjdksa dks D;k dgk tkrk gS\ Why do we carry out analysis of traits in several generations of a family?

ge fdlh ifjokj esa dbZ ihf<+;ksa esa y{k.kksa dk fo’ys”k.k D;ksa djrs gSa\ Which type of genetic interaction the dihybrid ratio 9:7 belongs?

9%7 fdl tsusfVd ijLij.k dk vuqikr gS\ Name an organism in which Single stranded DNA is a common feature?

,dy Mh,u, yM+ fdl tho esa lkekU;r;k ik;k tkrk gS\ What is central Dogma?

^lsUVªy MkSxek^ D;k gS\ How many nucleotides a genetic codon carries?

,d tsusfVd dksMksu esa fdrus uqfDy;ksVkbZM gksrs gS\a What do you mean by “Junk DNA”?

2324252627282930313233343536373839404142434445-

vki ^tad Mh,u,^ ls D;k le>rs gS\a Which type of Replication takes place in DNA?

Mh,u, dh izfrd`fr fdl izdkj curh gS\ Who gave the term Cistron Recon and Muton?

^^flLVjkSu^ ^jsdksu^ vkSj ^E;qVksau^ ^VEZl fdlus fn;k\ Name the pyrimidine bases of RNA?

vkj0,u0,0 esa ikbZfjfeMhu {kkjksa ds uke crk,a\ Define nucliosides?

^uqfDy;kslkbM^ ^dks ifjHkkf”kr djs\a What is cellular totipotency?

dks'kdh; ^VksVhiksVsalh^ ^D;k gS\ What is emasculation?

iq"Ik ca/;kdj.k D;k gS\ Which Bacteria causes curdling of milk production?

dkSu thok.kq nw/k dks ngh esa :ikarfjr djrk gS\ What is the full form of NDRI?

,u0Mh0vkj0vkbZ0 dk iwjk uke D;k gS\ Where does Plasmid occur?

^IykfTeM^ ^dgka gksrk gS\ What is the terminology which is popular for Recombinant DNA technology?

la;kstd Mh,u, izkS|ksfxdh ds fy, yksdfiz; ‘kCn D;k gS\ Who proposed the term Biotechnolgy?

tSo izkS|ksfxdh dk uke fdlus izLrkfor fd;k\ What is the full form of PCR?

ih0lh0vkj0 dk iwjk uke D;k gS\ Triticale the first synthetic Cereal Crop was obtained by crossing wheat with?

igyk fØf=e vukt VªhVhdsy xsgwa ds lkFk fdl ikS/ks dks ØkWl dj izkIr fd;k\ Why Escherichia coli is important for genetic experiments?

D;ksa ^^Lpsfjfpvk dksykbZ^ ^vkuqoaf’kd iz;ksxks ds fy, egRoiw.kZ gS\ Name the antiviral Protein?

,aVhok;jy izksVhu dk uke crk,a\ What is Cry Protein?

^dk;^ izksVhu D;k gS\ In Bt-Cotton ‘Bt’ indicates what?

ch0Vh0dikl esa ^^ch0Vh0^^D;k bafxr djrk gS\ Which enzyme is used as scissor to cut DNA?

dkSu ,atkbe Mh,u, esa dVkSrh ds fy, dSaph ds :i esa iz;ksx fd;k tkrk gS\ Golden Rice’ís rich in which vitamine?

^^xksYMu jkbl^ fdl foVkfeu eas le``) gS\ Which disease is detected by ELISA?

dkSu lk jksx ^,fylk^ ls irk yxk;k tkrk gS\ Which cell produces insulin?

dkSu lh dksf’kdk,a balqfyu iSnk djrh gS\ Due to which response antibodies are secreted against antigen?

fdl izfrfØ;k ds dkj.k ,aVhckWMh izfrtu ds f[kykQ lzkfor gksrs gS\a What is Biofortification?

Ck;ksQksfVZfQds’ku D;k gS\

46-

Which cells are involved in inhancing the Immune Mechanism?

47-

AEDES mosquito is the vector of which discase?

4849505152535455565758596061-

dksf'kdkvksa ds izfrj{kk ra= dks c<+kus esa dkSu lh dksf’kdk,a ‘kkfey gS\ ,Mht ePNj fdl jksx ds osDVj gS\a The first transgenic crop was?

Igyh Vªkaltsfud Qly dkSu lh Fkh\ What type of cells are found in abundance in hydrophytes?

fdl izdkj dh dksf’kdk;sa gkbMªksQkbV~l esa cgqrk;r esa ikbZ tkrh gS\ Which plants possess sunken Stomata and thick cuticle?

/kWlk ja/kz vkSj eksVh NYyh dkSu ls ikS/kksa esa ik, tkrs gS\ Which plants have Pneumatophores?

IuqekVksQkslZ fdu ikS/kksa dh fo’ks”krk gS\ Which plants have hanging roots?

dkSu ls ikS/kksa ds tM+ gok esa yVds gksrs gS\a Describe the functon of fimbrac.

fQaczh ds dk;Z dks cryk,WA Differentiate between menarche and menopause.

ehukdZ ¼jtksn’kZu½ rFkk esuksikSt ¼jtksfuo`fr½ esa vUrj Li”V djsaA Differentiate between spermiogenesis and spermiation.

‘kqØk.kq&:ikarj.k rFkk ‘kqØk.kq ifjiDork esa foHksn Li”V djsaA Mention the site where fertilization usually takes place in human female..

L=h esa ml LFky dks crk,Wa tgk¡ lkekU; :i ls fu”ksp.k gksrk gSA Define Parturition.

izlc dks ifjHkkf”kr djsaA Define blaslocyst.

iks"k dksjd ¼dksjd iqVh½ dks ifjHkkf”kr djsaA Define capacitation with reference to spermatozoa.

‘kqØk.kq ds lanHkZ esa dSisflVs’ku dks ifjHkkf”kr djsaA Define contraception.

xHkZfujks/k dh ifjHkk”kk fy[ksaA

62-

Expand the abbreviation IUD. IUD laf{kIr :i dk fcLrkj djsaA What is amniocentesis.

63-

Define Homology.

646566676869-

,sfEu;kslsVsfll D;k gSA ifjHkkf”kr djsa% letkUrkA Define adaptive radiation.

ifjHkkf”kr djsa% vuqdy w h fofdj.kA Define parallelism.

ifjHkkf”kr djs% lekukUrj.kA Define living fossil.

ifjHkkf”kr djsa% thfor thok’eA Who gave he idea of Natural Selection ?

izkd`frd oj.k dk flf)kUr fdlus fn;kA Define mutation.

ifjHkkf”kr djsa% mIifjorZuA The term Modern synthefic theory of evolution was given by.

7071727374757677787980818283848586878889909192-

fodk'k dk vk/kqfud la’ys”k.k fl)kUr in fdlus fn;kA Give scientific name of Modern man.

vk/kqfud ekuo dk oSKkfud uke fy[ksaA Define male heterogametity.

uj fo”e;qXedrk dks ifjHkkf”kr djsaA Name one sex-linked disease.

fdlh ,d fyax&lgyXu jksx dk uke fy[ksaA What in genome?

thukse D;k gSA Give full form of HGP.

,p th ih dk iw.kZ :i fy[ksaA Who invented DNA fingerprinting.

Mh,u, vaxqfyNkih dk vkfo””dkj fdlus fd;k\ Define Immunity.

ifjHkkf”kr djsa% izfrj{kkA What is Pashmina?

ik'kehuk D;k gS\ What is Anthrax?

,UFkzkDl D;k gS? What is communicable discase.

laØked jksx D;k gS\ Name a disease caused by helmin.

d`fe }kjk tfur ,d jksx dk uke nsaA Name the causative agent of Malaria.

eysfj;k jksx mRiUu djus okys dkjd uke nsaA Define allergy.

,ythZ dh ifjHkk”kk nsaA Give full form of AIDS.

,M~l dk iw.kZ :i fy[ksasA What in white revolution?

lQsn ØkfUr D;k gS\ What is Opioids.

vksfivkbMl D;k gS\ What in metastasin?

esVkLVSfll D;k gSA What is epidemiology.

,fiMsfevkyksth D;k gSA Define adolescence.

fd'kksjkoLFkk dks ifjHkkf”kr djs\a Define Ecology.

ikfjfLFkfrdh dh ifjHkk”kk fy[ksaA What is commensalism?

LkgHkksftrk D;k gS\ define adaptation?

vuqdwyu dh ifjHkk”kk fy[ks\a What is carrying capacity of population?

vkcknh dh ogu {kerk fdls dgrs gS\a

93-

Define population.

94-

Who coined the term “Ecosystem”?

9596-

vkcknh dh ifjHkk”kk fy[ksaA ^^ikfjra=^^ ’kCn dk O;ogkj loZizFke fdlus fd;k Fkk\ Define food chain.

vkgkj J`a[kyk dks ifjHkkf”kr djsaA What is meant by 10% low of energy transfer? 10% dk mtkZ&izokg fu;e D;k gS\

Biology Very Short Questions Marks - 2 Each 1.

Draw a well labeled diagram of Androecium and Gynoecium.

iaqdls j vkSj tk;ax ds vPNh rjg ls yscy fd;s gq, vkjs[k cuk;sa A 2.

Draw a neat diagram showing structure and germination of Pollen grain.

ijkx d.k dh lajpuk vkSj vadjq .k fn[kkrs gq, ,d LoPN vkjs[k cuk;sa A 3.

In algae and fungi which structures help in asexual reproduction?

'kSoky vkSj dod esa dkSu lh lajpuk,a vySafxd iztuu esa enn djrh gS \ 4.

What is double fertilization?

nksgjk fu"kspu D;k gS \ 5.

What is the pollination by bat is called? Give an Example.

pexknM+ }kjk ijkx.k dks D;k dgk tkrk gS \ ,d mnkgj.k nsa A 6.

What are the parts of angiospermic seed?

,fUtvksLiHkZ ds cht ds fgLls d;k d;k gksrs gS\a \ 7.

What type of fruit develops from hypanthodium ?

fdl izdkj dk Qy ^gSiaFkksfn;e* iq"iØe ls fodflr gksrk gS\ 8.

Why vegetative reproduction is also considered as a type of asexual reproduction?

D;ksa okuLifrd iztuu Hkh vySafxd iztuu dk ,d izdkj ekuk tkrk gS \ 9.

Describe the laws of heredity?

vkuqoaf'kdrk ds fu;eksa dk o.kZu djsa A 10.

Name any two reasons for Mendal's success?

esaMy s dh lQyrk ds ihNs dk;Zjr fdUgha nks dkj.kksa ds uke crk,a 11.

What is the genotypic and Phenotypic ratio of Monohybrid and Dihybrid?

,dy&ladj.k vkSj f}&ladj.k ds ^thuksVkbi* vkSj ^fQuks Vkbi* ds vuqikr D;k gS\a 12.

Define Polyploidy.

^iksyhIyksbZMh* dks ifjHkkf"kr djsa A 13.

What is DNA ? Name different types of DNA.

Mh0 ,u0 ,0 D;k gS\ fofHkUu izdkj ds Mh0 ,u0 ,0 ds uke crk,a 14.

What are complimentary genes ?

iwjd thu D;k gS \ 15.

What are multiple alleles ?

cgq&vyhy D;k gSa \ 16.

Give two main differences between DNA and RNA ?

Mh0 ,u0 ,0 vkSj vkj0 ,u0 ,0 esa nks eq[; Hksn crk,¡ A 17.

What are Okazaki fragments and what enzymes join them ?

^vksdktkdh* VqdM+s D;k gS\a mUgsa dkSu lk ,atkbe tksMr+ k gS\ 18.

Define Operon.

^vksizksu* dks ifjHkkf"kr djsa 19.

What is reverse transcription ?

myV izfrys[ku D;k gS \ 20.

List the two major functions of the gene.

thu dh nks ize[q k dk;ksZa dh lwph nsa A

21.

AUGCUGAUAUGAAAAGACCCG is the base sequence in m-RNA. Write the base sequence of DNA stands from which it has been transcribed. AUGCUGAUAUGAAAAGACCCG {kkj okys vkj0 ,u0 ,0 dks cukus okys Mh0 ,u0 ,0 dk vk/kkj vuqØe fy[ksaA

22.

What are Penpide bonds?

isIVkbM ckaM D;k gS \ 23.

What are the two main sources of variations in the gene pool ?

thu iwy esa cnyko ds nks eq[; Jksr D;k gSa \ 24.

How the gene expression is carried out at translation level.

dSls thu izfrys[ku vuqokn ds Lrj ij fd;k tkrk gS A 25.

What are the terms given by Benzor for genes ?

thu ds fy, csatj }kjk fn, x, 'kCn D;k gSa \ 26.

What do you mean by tissue culture ?

fV'kw dYpj dk D;k vFkZ gS \ 27.

Name some genetically engineered Crop plants.

dqN vuqokaf'kd iz|ksfrdh ls fodflr Qlyksa ds uke crk,a 28.

What is apiculture and Sericulture ?

e/kqeD[kh ikyu vkSj js'ke mRiknu D;k gS \ 29.

What is special about Bacillus thuringensis?

csflyl Fkwfjft;safll ds ckjs esa [kkl D;k gS\ 30.

What do you mean by Biopiracy ?

vki ck;ksikbjslh ls D;k le>rs gSa \ 31.

What is the role of Bacillus thuringens is in the production of pest resistant plant ?

dhV izfrjks/kh ikS/kksa ds mRiknu esa csflyl Fkwfjft;safll dh D;k Hkwfedk gS \ 32.

What is gene therapy ?

thu Fksjsih D;k gS \ 33.

What are vaccines ?

Vhds D;k gS\a 34.

Name some antibiotics produced by micro-organisms.

lw{e thoksa }kjk mRikfnr dqN ,aVhck;ksfVd nokvksa ds uke crk,a 35.

What do you mean by isolation of genetic material ?

vkuqoaf'kd lkexzh ds vyxko dk vFkZ vki D;k le>rs gSa \ 36.

What are the differences between transformation and transduction ?

ifjorZu vkSj ikjxeu ds chp varj D;k gS \ 37.

What is the function of restriction endonuclease and ligase enzyme in transfer and manipulation of genetic material ?

izfrca/k baMksuqfoy,t vkSj fyxst ,atkbe dk vkuqoaf'kd lkexzh ds gLrkarj.k vkSj tksM&+ rksM+ esa D;k ;ksxnku gS\ 38.

What is complementory DNA (c-DNA)?

iwjd Mh0 ,u0 ,0 D;k gS\ 39.

Give the name of some antibiotics.

,athck;ksfVd nokvksa ds dqN uke crk,a 40.

Give the name of four antibiotic producing organisms.

pkj ,aVhck;ksfVd mRiknu djus okys lw{e thoksa dk uke crk,a 41.

What are the differences between cybrid and hybrid ?

lkbfczM vkSj ladj ds chp varj D;k gS\a 42.

What is retrovirus ?

jsVªksok;jl d;k gS \ 43.

What is DNA probe ?

[kksth Mh0 ,u0 ,0 tk¡p d;k gS \ 44.

What do you mean by the term in vitro and in vivo experiments ?

^bufDVªks* vkSj ^bufooks* iz;ksxksa ls D;k eryc gS \ 45.

How a recombinant DNA is formed by the help of genetic engineering ?

dSls ,d la;kstd Mh,u, tsusfVd bathfu;fjax dh enn ls cuk;k tkrk gS \ 46.

What is DNA primer ?

Mh0 ,u0 ,0 izkbej D;k gS \ 47.

Give the name of natural polymer which is extracted from sea weed.

leqnzh 'kSoky ls izkIr izkÑfrd cgqyd dk uke crk,a A 48.

DNA and proteins are macromolecules, which among the two is bigger and how ?

Mh0 ,u0 ,0 vkSj izksVhu esa dkSu cM+k v.kq dkSu gS vkSj dSl\s 49.

What is Symbiosis ? Name two types of symbiosis.

lgthou D;k gS \ lgthou ds nks izdkj ds uke nsa A 50.

Name the types of ecological pyramid.

ifjfLFkfrd fijkfeM ds izdkj ds uke nsa A 51.

What are the biotic components of ecosystem ?

ifjffLFkfrdh rU= ds tSfod ?kVd D;k gSa \ 52.

Why are the testes of human males considered extra-abdominal ? What is the significance of this condition ?

ekuo uj ds o`"k.k dks oká&mnjh; D;ksa ekuk tkrk gS\ bl ifjfLFkfr dk D;k egRo gS \ 53.

Define ovulation. On which day it occur in a menstrual cycle ?

vaMksRlxZ dh ifjHkk"kk fy[ksa A ekfld pØ esa fdl fnu ;g izfØ;k gksrh gS \ 54.

Mention two differences between spermatogenesis and oogenesis.

'kqØk.kqtuu ,oa vaMtuu esa nks vUrj Li"V djsa A 55.

Name the chemicals released by the acrosome during fertilization and describe their roles.

fu"kspu ds nkSjku ,Økslkse }kjk Jkfor jklk;fud inkFkksZa ds uke fy[ksa ,oa muds dk;Z crk,¡ A 56.

Defferentiate between trophoectoderm and ectoderm.

VªksQks,DVksMeZ ,oa ,DVksMeZ esa foHksn LFkkfir djsa A 57.

Name the hormones secreted by human placenta.

ekuo vijk }kjk Jkfor gkWeksZu dk uke crk,¡ A 58.

What is coloastrum ? Why is it essential for new born babies ?

dksyksLVªe D;k gS \ uotkr f'k'kqvksa ds fy, ;g D;ksa vko';d gS \ 59.

Differentiate between vasectomy and tubectomy.

iq:"k ulcanh rFkk L=h ulcanh esa vUrj Li"V djsa A 60.

Name the devices which are used under the barrier method of contraception.

xHkZ fujks/k ds vUrxZr jks/kd fof/k ds fy, iz;qDr lk/kuksa dk uke cryk,¡ A 61.

Name any four STDs and their causative agents.

fdUgha pkj ;kSu&lapkfjr jkskxsa ,oa muds dkjdksa ds uke fy[ksa A 62.

Comment upon genetic equilibrium.

fVi..h djsa % vkuqokaf'kdh larqyu

63.

Write main prints of Lamarckism.

ykekdZokg ds eq[; fcUnqvksa dks fy[ksa 64.

Differentiate between homology and analogy.

letkrrk vkS rqO;:irk esa vUrj Li"V djsa 65.

Name four living fossils.

fdlh pkj thfor thoké dk uke fy[ksa 66.

Name two features of Australapithccus.

vkLVªsyksihfFkdl ds nks xq.k fy[ksa A 67.

Comment upon H.M.S. Beagle.

,p0 ,e0 ,l0 chxy dk c[kku djsa A 68.

Differentiate between convergent and divergent evolution.

vilkjh vkSj vfHklkjh fodkl dk vUrj Li"V djsa A 69.

Mention two evidences of organic evolution.

dkcfuZd fodkl ds nks izek.k dk mYys[k djsa A 70.

Which in responsible for sex determination in chick-sperm or ovum ? Explain in ewords.

pwtksa esa fyax fu/kkZj.k ds fy, dkSu ftEesnkj gS & 'kqØk.kq ;k vaMk.kq \ dqN 'kCnksa esa O;k[;k djsa A 71.

What is sickle-cell anemia ?

nk= dksf'kdk vjDrrk D;k gS \ 72.

What is bioinformatics ?

tSo&lwpuk foKku D;k gS \ 73.

What is repetetive DNA.

iqujko`fÙk Mh0 ,u0 ,0 D;k gS\ 74.

Explain Chiru

^dh:* dh O;k[;k djsa A 75.

Name four indigenous cow.

pkj Hkkjrh; xk; dk uke nsa A 76.

What is neurosis

U;wjksflfl D;k gS \ 77.

Enumerate the symptoms of syphilis.

flfQfyl ds y{k.k D;k&D;k gS \ 78.

What in Opsoneization ?

vkIlksykbts'ku D;k gS \ 79.

What do you mean by cellular immunity ?

dksf'kdh;&izfrj{kk ls vki D;k le>rs gS\a 80.

Discuss about sarcoma. Sacroma dk o.kZu djsa A

81.

Name four Indian common carp.

fdUgha pkj Hkkjrh; lkekU; dk;Z dk uke nsa A 82.

Name four types of silk.

pkj fdLe ds js'ke dk uke fy[ksa % 83.

What is artificial insemination ?

Ñf=e oh;Zlspu D;k gS \ 84.

What is inbreeding ?

var% iztuu D;k gS \ 85.

Which birds are use for poultry farming.

dqDdqV QkeZ ds fy, fdu if{k;ksa dk mi;ksx gksrk gS \ 86.

Name four carcinogens.

fdlh pkj dSalj dkjdksa dk uke fy[ksa A 87.

Differentiate between population and community.

vkcknh vkSj leqnk; esa vUrj Li"V djsa A 88.

Enumerate any four characteristics of population.

vkcknh dh fdUgha pkj fo'ks"krkvksa dks fxuk,¡ A 89.

Differentiate between hibernation and aestivation. Give one example of each.

'khr&fuf"Ø;rk vkSj x`"e&fuf"Ø;rk esa vUrj crk,¡ A izR;sd dk ,d&,d mnkgj.k nsa A 90.

Mention any two adaptations found in organisms of desert.

e:LFky esa ik;s tkusokys thoksa ds nks vuqdwyu dks crk,¡ A 91.

Construct a grazing food chain or detritus food chain using the following : Easthworm, bird, snake, eagle, grass, grasshopper, frog, microbes.

fuEufyf[kr dh lgk;rk ls ,d xzsthax QwM psu ;k MªsfVVl ¼vijn½ vkgkj J`a[kyk dk fuekZ.k djsa % dsapqvk] fpfM+;k] liZ] phy] ?kkl] fVìk] es<+d] lw{etho A 92.

Destinguish between primary productivity and secondary producturity.

izkFkfed mRikndrk ,oa f}rh;d mRikndrk esa vUrj crk,¡A 93.

Construct pyramid of numbers of grassland ecosystem.

?kkl&LFky ikfjfLFkfrd ra= ds la[;k dk fijkfeM dk fuekZ.k djsa A 94.

Distiinguish between primary succession and secondary succession.

izkFkfed vuqØe.k vkSj f}rh; vuqØe.k esa vUrj Li"V djsaA 95.

Describe two factors for loss of biodivercity.

tSo fofo/krk ds kl ds nks dkjdksa dks crk,¡A 96.

What is Red Data Book ? Who published it in India and what does it contain ?

^^jsM MkVk cqd** D;k gS\ bls Hkkjr esa fdlus izdkf'kr fd;k rFkk blesa D;k lfEefyr fd;k x;k gS\ 97.

What is main difference between in sit conservation and ex sity conservation.

LoLFkkus laj{k.k rFkk cká LFkkus laj{k.k ds chp eq[; varj D;k gS \ 98.

Name and assign the aim of different zones of biosphere reserve.

lqjf{kr tSo eaMy ds fofHkUu {ks=ksa dk uke ,oa muds mís'; dks crk,¡ A 99.

Giving example of each differentiate between biodegradable and non-degradable pollutants.

,d&,d mnkgj.k dh lgk;rk ls tSo fuEuhdj.kh; iznw"kd vkSj tSo vfuEuhdj.kh; iznw"kd ds chp vUrj crk,¡A 100. Mention any two effects of air pollution on plants.

ikS/kksa ij iM+usokys ok;w iznw"k.k ds izHkko dks fy[ksa A 101. Mention four sources of pollution due to radiations.

fofdj.k iznw"k.k ds pkj Jksrksa dk mYys[k djsa A 102. Describe Chipko movement in four sentences.

fpidks vkUnksyu dks pkj okD;ksa esa fy[ksa A

BIOLOGY Marks : 3 Each Short Questions

1-

Draw the structure of Embryo Sac and label it.

2-

Differentiate between the following. a. Herkogamy and Dichogamy. b.Anemophily and Hydrophily.

34567891011121314151617-

Hkzw.kdks’k dh lajpuk fn[kkrs gq, js[kkafdr fp= cuk;sAA

fuEUufyf[kr esa vUrj djsaA a. Lo;a :)rk ,oa i`Fkd iDork b. ok;w ij ijkx.k ,oa ty ij ijkx.k

What do you understand by Parthenogenesis?

vfu”ksd tuu ls vki D;k le>rs gSaA Name the types of endosperm on the bases of their development.

Hkwz.kiks”k ds fodkl ds vk/kkj ij mlds izdkj dks crk;saA Which part of flower forms the fruit in Apple? Why it is called false fruit?

Lkso dk Qy iq”Ik ds fdl Hkkx ls curk gS\ lso dks feF;k Qy D;ksa dgrs gS\a What are Aggregate and Composite fruits?

Lksdy Qy vkSj laxzfFkr Qy esa vUrj dks crk;saA Differentiate between Dicot and Monocot seeds of angiosperms.

,dchti=h vkSj f}chti=h chtks ds chp vUrj dks crk;s\a What do you mean by sporophytic and gametophytic generations?

LiksjksQkbZV ,oa xSehVksQkbZV thou pØ ds chp ds vUrj dks crk;saA What were the seven distinct characters of garden Pea considered by Mendel?

esMy s }kjk fd;s x;s iz;ksxksa esa eVj ds fdu lkr fo’ks”krkvksa ij dke fd;k Fkk\ Describe the incomplete dominance in Mirabilis jalapa.

fejkfcfyl tykik ds mnkgj.k dks ysrs gq, crk;s fd viw.kZ vkuqoaf’kDrk D;k gS\ Explain the structure of chromosome.

xq.klw=ksa dh lajpuk dks crk;saA Describe the replication of DNA.

Mh0,u0,0 dh f}xq.ku dh fØ;kfof/k dh O;[;k djsaA Explain the role of m-RNA and t-RNA with labelled figures.

fp=ksa dh enu ls lan’s kokgd vkj0,u0,0 vkSj LFkkukarj.k vkj0,u0,0 ds jksy dks crk;saA What is coupling and repulsion concept? Who proposed it?

;qXeu vkSj fod”k.kZ dh ifjdYiuk D;k gS\ fdl oSKkfud us ;g ifjdYiuk nh\ What are peptide bonds? How are they formed?

isjVkbZM ckW.M D;k gS\ bldk fuek.kZ dSls gksrk gS\ What is epistasis? Define.

,fiLVSfll D;k gS\ O;k[;k nsaA Dfferentiate between: a. B-DNA and Z-DNA b. Coding and Non-Coding sequences. c. Linear and Circular DNA. d. A-DNA and C-DNA

fueUufyf[kr esa vUrj djsa %& a. ch0Mh0,u0,0 vkSj tsM Mh0,u0,0 b. dksfMax vkSj uu dksfMax Øe c. yEc Mh0,u0,0 vkSj o`rkdj Mh0,u0,0

18-

d. ,0Mh0,u0,0 vkSj lh0Mh0,u0,0 Give the differences between prokaryotic and Eukaryotic genes.

19-

What is reverse transcription?

20212223242526-

izksdfS j;ksfVd vkSj ;wdSfj;ksfVd thu ds chp vUrjksa dks crk;saA more vuqy[s ku d;k gS\ Describe Rho-factor.

jks dkjd ds ckjs esa crk;s\a Give the significance of linkage.

lgyXurk ds egRcksa dh ppkZ djsaA What is mutation?

mRifjorZu D;k gS\ What is polymerisation? How is amplification of a gene of interest carried out using polymerase chain reaction?

psu o`f) D;k gS\ ih0lh0vkj0 dh enr ls fdlh Mh0,u0,0 dh yEckbZ dh psuo`f) dSls djrs gS\a What are the roles of ribosome?

jkbckslkse ds egRcksa dks fy[ksaA What are operator gene and promoter gene?

vkWijkSu esa vkWijsVj vSj izkseksVj thu D;k gksrs gS\a

27-

What do you mean by SCP? ,l0lh0ih0 ¼S.C.P.½ ls vki D;k le>rs gS\a What are the harmful effect of pesticides?

28-

Name high yielding varieties of Wheat, rice and Maize. Give two examples each.

29303132-

33-

dhVuk'kdksa ds gkfudkjd izHkkoksa dks crk;saA xsgw¡ /kku vkSj eDdksa ds vfr Qfyr fodflr iztkfr;ksa dks nks&nks mnkgj.kksa ds }kjk crk;saA Who played a major role in bringing green revolution in India and how?

Hkkjro”kZ esa gfjr Økafr esa eq[; Hkwfedk fdudh Fkh vkSj dSl\s How the genetically modified plants are useful?

vkuqoaf’kdh ifjofrZr ikS/kksa dk mi;ksx D;k gS\ nks&rhu lkFkZd mi;ksfxrk dks fy[ksaA What are tools and techniques of genetic engineering?

vkuqoaf’kdh baUthfu;fjax ds fl)kUr vkSj mi;ksa dks crk;saA Write one/two-line note on: a. Restriction Enzyme b. Palindromes c. Cloning vector

fuEufyf[kr ds ckjs esa 2&3 iafDr;ksa esa fy[ksaA a. izfrcaf/kr jlk;u ¼jsLVªhdlu bZutkbZe½ b iSfyuMªkse c Dysfuax jksxokgd Write one/two-line note on: a. PCR b. Down-stream processing c. Bioreactor d. Gel electrophoresis

2&3 iafDr;ksa esa O;k[;k nsaA a. ihlh0vkj0 a. Mkmu LVªhe izkslsflax a. ck;ksfj;SDVj a. tsy fo|qr ys[ku

343536373839-

40-

41-

42434445-

46-

What are transgenic animals? Describe their benefits giving example.

vUrj ifjofrZr tUrq D;k gksrs gS\ budh fo’ks”krk vkSj ykHk dks crk;saA Differentiate between PCR and ELISA.

Ikh0lh0vkj0 vkSj ,yhlk ds vUrj dks js[kkafdr djsaA Discuss the use of microbes in industry and fermentation.

‘k{e thok.kqvksa dh mi;ksfxrk dks m/kksx vkSj fdUo.k ds lanHkZ esa crk,aA What are the effects of alcohol on human? Discuss.

vkneh ds LokLF; ij vYdksgy ds izHkkoksa ds ckjs esa fy[ksaA What do you mean by Gene library?

thu laxzg ls vki D;k le>rs gS\ What are basic techniques of tissue culture? Name them. 0r, Name the programme and the method involved in improving success rate of production Of desired hybrid.

Mrd lao/kZu ds lkekU; rduhdksa dh tkudkjh nsaA vFkok ladj thoksa ds fodkl dh izfØ;k dks la{ksi esa crk;saA Differentiate between the following. a. Bioherbicides and Bioinsecticides b. Biofertilizer and Manure

fuEufyf[kr esa vUrj crk;saA a. tSo ‘kkd uk’kd vkSj pSo dhVuk’kd b. tSfod [kkn ,oa gfjr [kkn Explain the following: a. Cloning Vector b. Vectorless gene transfer.

fuEufyf[kr dh O;k[;k nsaA a. Dyksfuax jksxokgd b. okgd ds fcuk thu LFkkukUrj.k Differentiate between exonuclease and endonuclease.

,XtksU;qfDy;t vkSj bUMks U;qfDy;t bUtkbZe ds vUrj dks fy[ksaA Name the transgenic cow. What Protein does it contain?

vUrj ifjofrZr xk; dk uke crk;s\ blesa dkSu lk izksVhu fo’ks”k gS\ What do you mean by vaccines and antibiotics?

Vhdk vkSj izfrj{kh esa vUrj djsaA Name the following: a. Antiviral protein b. Bt-toxin producing bacterium. c. Genes which control cotton ball formation d. Transgenic cow which gave protein enriched milk. e. Genetically modified hormone.

fuEufyf[kr ds uke crk,WA a. izfr fo”kk.kq b. ch0Vh0 VkDlhu cukus okyk ‘kq) thok.kq c. dkWVu ckWy cukus okyk thu d. vUrjifjofrZr xk; e. vkuqoaf’kdh; ifjofrZr gkWjeksu

Drow well labelled diagram of Normal bacterial cell.

,d lkekU; thok.kq dh dksf’kdk dk js[kkfdar fp= cuk;saA

47-

Differentiate between Epiphytes and paraphytes.

48-

What are the ecological adaptations among xerophytes?

4950-

vf/kekni vkSj cfgZ;kni esa vUrj crk,WA e:LFkyh; ikS/kksa esa ikfLFkfrd vuqdyu ds ckjs esa fy[ksaA What are the ecological adaptations among Hydrophytes?

tyh; ikS/kksa esa ikfLFkfrd vuqdyu ds ckjsa esa fy[ksaA What are the ecological adaptations in plants of Mangroove forest?

xjku ou ds ikS/kksa ds ikfLFkfrd vuqDyu D;k&D;k gksrs gS\a

Unit –I Short answer questions

¼y?kq mÙkjh; iz’u½

51-

Part -A marks: 1 Each Draw a well Labelled diagram of the transuerse section of a seminiferous tubule..

52-

Deseribe the structure of mammary gland of a human female.?

53-

54-

555657585960-

,d ‘kqØtuu ufydk dk vuqizLFk dkV dk lqukekafdr fp= cuk,WA L=h ds Lru xzafFk dh lajpuk dk o.kZu djsaA Mention the names and characters of different layers of uterine wall in humans. Which one of them undergoes cyclic changes during menstrual cycle.

euq"; ds xHkkZ’k;h fnoky ds fofHkUu Lrjksa dk uke vkSj pfj= dks crk,saA buesa ls fdl Lrj esa pØh; Øe esa ifjorZu gksrk gSA

Represent diagrammatically the process of Oogenesis in a human female indicating different stages as well as the number of chromosomes in different stages. ?

ukjh ¼L=h½ esa gksus okyh vaMtuu izfØ;k dks fp= }kjk crk,W ftlesa blds fofHkUu voLFkkvksa rFkk xq.klw=ksa dh la[;k iznf’kZr gksA Describe the post fertilization of events occurring in eggs.

vaMk esa gksus okyh fu”kspuksÙkj ?kVukvksa dk o.kZu djsaA Describe the formation of blast cyst.

,d Lruik;h esa eslksMeZ ds Hkfo”; dk o.kZu djsaA Describe the fate of mesoderm in a mammal.

dksjd iqVh ds fuekZ.k dk o.kZu djsaA Has reproductive health improved in our country? If yes mention some areas of improvement.

D;k gekjs ns’k esa tuu LokLF; lq/kjk gS\ ;fn gkW] rks lq/kkj ds dqN {ks=ksa dh ppkZ djsaA Suggest some methods to assist infertile couple to have children.

ckW> ;qxy ds larkuksRifr esa lgk;rk djus okyh dqN fof/k;ksa dks crk,WA What is the hormonal composition of oral contraceptive pills. How do they act as a contraceptive.

XHkZ fujks/kd xksfy;ksa dk gkWekZsuy laxBu D;k gS\ xHkZfujks/kd dh rjg os dSls dk;Z djrs gS\

Unit –I Short answer questions

¼y?kq mÙkjh; iz’u½

616263646566676869707172-

Part -A marks: 3 Each

Describe the ‘Big Bang theory’ of origin of universe.

czgek.M ds fodkl esa ^fcx cSax^ dk fl)kUr dk o.kZu djsaA Discuss about he association of A.R. Wallace with Charles Darwin.

vYQzMs oSyls ds pkYlZ Mkjfou ls lEc)rk dk mYys[k djsaA Comment upon the Darwin’s finches.

Mkjfou ds fQUp i{kh ds ckjs esa fVIi.kh djsA Name six marsshupials of Australia.

fdlh N% vkLVªsfy;kbZ f’k’kq/kkuh dk uke fy[ksaA Comment upon the oparin-Haldane theory of origin of life.

thou dh mRifr ds vksiSfju gkYMsu fl)kUr ij fVIi.kh djsaA Enumerate the factors responsible for organic evolution as per the modern synthetic theory of evolution .

vk/kqfud la’ys”k.k fl)kaUr ds vuqlkj dkcZfud fodkl ds mÙkjnk;h dkjdksa dks lwfpc) djsaA Differentiate between stabilizing and disruptive selection.

LFkk;hdkjd vkSj fonkjd esa vUrj Li”V djsaA Draw a labelled diagram of Miller’s experimental apparatus.

feyj ds iz;ksx & midj.k dk vkjsf[k; fp= cuk,W A Enumerate the features of Homo habilis.

gkseks gSfcfyl ds xq.kksa dks lwphc) djsaA What is VNTR (Variable Number Tandem Repeat).

vuqc) iqujkrZd dh fofHkUu la[;k D;k gSA Comment Upon Rh-Factor.

vkj ,p dkjd ds ckjs esa fy[ksaA What is cystic fibrosis haemophilia and phenyl ketonuria.

flLVhd QkbZczksfll ] gheksQhfy;k vkSj QhukbZy dhVksuqfj;k D;k gSA

Unit –III Short answer questions

¼y?kq mÙkjh; iz’u½

73747576777879808182838485-

Enumerate the benefits of bee keeping .

e/kqeD[kh ikyu ds D;k Qk;ns gS\ What in interspecies breeding.

var fof’k”V ladj.k D;k gS\ What is the role of super ovulation in cattle breeding.

LkqijvksHkqy’s ku ds D;k Hkwfedk gS i'kq&iztuu es\a What is drug addiction ?

Mªx&O;lu D;k gSA What are the bad effects of alcoholism ?

,Ydksgy dqiz;ksx ds D;k dqiHz kko gS\ What is masculization and how is it caused?.

iqLaRou D;k gS ,oa ;g dSls gksrk gSA Explain contact inhibition.

lLai'kZ laneu dh O;k[;k djsaA Discus about mucous associated lymphoid tissue (MALT).

bys"e lca) ylhdke mÙkd dk o.kZu djsA What in SCID.

lhM ¼,l lh vkbZ Mh½ D;k gSA Differentiate between active and passive immunity.

lfØ; vkSj fuf”Ø; izfrj{khdj.k dk vUrj crk,WA Define types of pathogenic agents..

fHkUu izdkj ds jksxtudksa dks ifjHkkf”kr djsaA Differentiate between benign and malignant sumons.

lqne vkSj nqnZe vcqZn dk vUrj crk,WA Explain about the psychological dependenee on drug.

Mªx dh ekufld fuHkZjrk dh O;k[;k djsA

Part -A marks: 3 Each

Unit –V Short answer questions marks: 3 Each 86.

Describe different divisions of biosphere.

87.

What are ecological factors? Enumerate its types and describe any of those briefly.

88.

Explain beneficial types of interspecific interactions.

89.

Explain with the help of a graph the growth pattern of most populations.

thoeaMy ds fofHkUu ‘kk[kkvksa dk o.kZu djsaA

IkfjfLFkfrd dkjd D;k \ blds izdkjksa dk mYys[k djsa vkSj buesa ls fdlh ,d dk FkksM+s ‘ksCnksa esa o.kZu djsaA vUrtkZfr; ikjLifjd izfrfØ;k ds ykHknk;d izdkjksa dk o.kZu djsaA T;knkrj vkcknh ds o`f) Øe dks xzkQ }kjk le>k,WA

90.

Mention abiotic component of an ecosystem.

91.

What is food web? Explain it with the help of suitable example.

92.

Explain ten percent law of energy transfer.

93.

What is primary productivity? Describe its types.

94.

Describe different types of ecological biodiversity.

95.

what is the importance of biodiversity?

96.

UNC has classified plants and animals into four categories for the sake of their conservation. Describe those. IUCN us ikS/ks vkSj tUrqvksa dks laj{k.k dh n`f”Vdks.k ls pkj Jsf.k;ksa esa oxhZd`r fd;k gSA mudk o.kZu

fdlh ikfjfFkfrd ra= ds vtSo dkjdksa dks crk,WA vkgkj tky D;k gS \ mi;qZDr mnkgj.k }kjk bls Li”V djsaA nl izfr’kr dk mtkZ&izokg fu;e dks Li”V djsaA izkFkfed mRikndrk D;k gS\ blds fofHkUu izdkjksa dk o.kZu djsA IkfjfLFkfr ra= fofo/krk ds fofHkUu izdkjksa dk o.kZu djsaA tSo fofo/krk dk D;k egRo gS\

djsaA 97.

Differentiate between national park and sanctuary. Give four names of each of the two categories.

jk"Vªh; m|ku vkSj vkHk;kj.k esa foHksn Li”V djsaA nksuksa ‘kj.k LFkyksa ds pkj&pkj ukeksa dks crk,WA 98.

What is “Global warming”? How it can be reduced?

99.

What do you mean by Ozone depletion and Ozone hole? Mention reasons for the depletion.

100.

What is deforestation? Describe its impact on environment.

101.

Write a short note on eutrophication and accelerated eutrophication.

Xykscy okfeZax D;k gS\ bls dSls de fd;k tk ldrk gS\

vkstksu vo{k; rFkk vkstksu fNnz ls D;k le>rs gS\ vo{k; ds dkj.kksa dks crk,WA cuksUewyu D;k gS\ Ik;kZoj.k ij blds izHkko dk o.kZu djsaA lqiks"k.k rFkk Rofjr lqiks”k.k ij fVIi.kh fy[ksaA

BIOLOGY LONG QUESTIONS MARKS-5 1.

What do you mean by polyembryony ? Discuss.

2.

Differentiate between the following:

3.

cgqHkzw.kuk ls vki D;k le>rs gS\a O;k[;k djsaA fuEufyf[kr esa vUrj crk,a & a.

Oviparous and viviparous

b.

Unisexual and bisexual

c.

Homothallus and Heterothallus

vaMksRiUu ,oa ekr``dk;o`f/kr -,d fyaxh ,oa f} fyaxh

le &i``f”V vkSj fo”ke&i`f”V

Discuss the adaptations for cross pollination.

Ikj& ijkx.k ds fy, iq”iksa esa vuqdy w u fo’ks”krkvksa dks fy[ksa A 4.

What is apomixes ? Discuss its importance.

5.

Discuss the structure of monocot seed with diagrams.

6.

Whar are dry indehiscent fruit? Give examples.

7.

Discuss the adaptations for seed pollination.

8.

What do you mean by tests cross and Back cross? Explain.

9.

Differentiate between any three pairs of terms:

vlaxtuu D;k gS blds egRoksa dks crk,a A

,d& ohti=h cht dh lajpuk dks js[kkfp=ksa dh enn ls crk,a A ‘kq”d vLQqVu’khy Qy D;k gS mnkgj.kksa ds lkFk fy[ksa A Lo & ijkx.k ds vuqdy q d dkjdksa dh ppZk djsa A Ijh{kkFkZ izladj.k vkSj ijh{kkfkZ izladj.k dk D;k vFkZ gS O;k[;k djsaA fdUgha rhu tksM+ksa esa vUrj djsa & a.

Heterozygous and Homozygous

b.

Monohybrid and Dihybrid

c.

Dominance and Recessive

d.

Genotype and Phenotype

fo”ke;qXeh vkSj le;qXeh ,dladj vkSj f}ladj izHkqRo vkSj vizHkqRo

thu iz:i vkSj y{k.k iz:i

10.

Explain linkage and crossing over with examples.

11.

List various steps involved in Protein biosynthesis.

12.

What are three types of RNA? Mention their role in protein synthesis.

13

Who and how it was proved that the replication of DNA is semi- conservative?

lgyXurk vkSj thu fofu;e dh O;k{;k djsa A

izksVhu la’ys”k.k izfdz;k ds fofHkUu pj.kksa dks lwphc) djsa A vkj0 ,u0 ,0 ds rhuks izdkjksa dks crkrs gqq, izksVhu la’ys”k.k esa mudh Hkwfedk dk mYys[k djsaA fdlus vkSj dSlS Mh0 ,u0 ,0 ds v)Z&izfrdj.k ds ckjs esa crk;k Fkk \

14. Explain the structure of DNA and give its importance.

Mh0 ,u0 ,0 dh lajpuk vkSj egRo dks fy[kasA

15.

What is point mutation ? Discuss.

16.

Discuss the chromosome theory of inheritance?

17.

Describe incomplete dominance by citing the example of Mirabailis jalapa.

fcUnq mRifjorZu D;k gS\ O;k[;k djsa A vkuqoaf’kdh ds xq.k lw= fl)kUr ij O;k[;k djsa A

ejkfcfyl tykik ¼la/;k iq”i½ ds mnkgj.k dk gokyk nsrs gq, viw.kZ izHkqRo dh ppkZ djsa A

18.

With the help of suitable diagrams explain the DNA is genetic material.

19.

What is the Central Dogma? Give the basic mechanism of Protein synthesis.

20.

What are the types of Chromosome based on the positon and number of centromere.

21.

Diferentiate between Heterochromatin and Euchromatin.

22.

Explain the gene structure.

Mh0 ,u0 ,0 vkuqokaf’kd lkexzh gS A vkjs[kksa dh enn ls fl) djsa A

dsUnzh; fln~|kar D;k gS \ izksVhu la’ys”k.k dh izfdz;k dk mYys[k djsa A

lw= dsUnz dh fLFkfr vkSj la[;k ds vk/kj ij xq.klw= ds izdkj crk,a A gsVsjksØkz seSfVu vkSj ;wØkseSfVu ds cho vUrj dks crk,a A thu lajpuk ds ckjs esa crkosa A

23.

what is pleiotropism? Give an example to show how the classical Mendelion phenotypic ratio is greatly modified.

24.

Explain how the dominant epistasis modifies the classical ratio of 9:3:3:1 to 12:3:1?

cgq;keh izHkko D;k gS \ ,d mnkgj.k ds }kjk fn[kk;sa fd esaMy ds y{k.kizk:i ds vuqikr dks dSls cnyrk gS A izHkqRod ,ihLVSfll esa fdl rjg ls 9%3%3%1 dk vuqikr 12%3%1 esa cny tkrk gS \ O;k[;k nsa A

25.

Differentiate Epistasis and Hypostasis? Discribe the types of Epistasis.

26.

What are the aims of plant breeding?

27.

What is polyploidy ? Name the types of Polypooidy

28

What is tissue culture and what are the advantages of tissue culture over traditional method of propagation.

29.

Explain the role of microbes in house hold food processing and industrial production. Or, What is sewage ? Discuss its treatment.

,ihLVSfll vkSj gkbiksLVSfll esa vUrj crk;s\ ,ihLVSfll ds izdkj dh O;k[;k djssa A ikni iztuu ds mns’; D;k gS \

Cgqxqf.krk D;k gS \ blds izdkj dks mnkgj.k ds lkkFk crk,a A mÙkd lao/kZu D;k gS \ blds ykHk dks crk,a A ikjEifjd rjhdksa ls dSls vyx gS ;g \.

?kjsyq [kk+| mRiknu vkSj vkS|ksfxd mRiknuksa esa thok.kqvksa dh Hkwfedk crk,a A vFkok eSyk d;k gS\ blds mipkj ds ckjs esa ppkZ djsA 30.

‘Biotechnology is a revolution of modern times ‘. Comment.

vk/kqfud le; dk tSo izk|ksfxdh dzkafr gS A O;k[;k djsa A 31- ih0 lh0 vkj0 ds fl)kUr vkSj dk;Z dh ppkZ djsaA Discuss the principle nad work of PCR.

32. What are the applications of Biotechnology ? Discuss.

tSo izk|ksfxdh dh vk/kqfud mi;ksfxrkvksa ds ckjs esa mYys[k djsa A

33.

Justify the statement theat ‘Plasmid is the Boon to Biotechnology’ citing the example of human insulin production.

IyktfeM tSo izkS|kfxdh ds fy, vR;ko’;d gS bldk lR;kiu ekuo balwfyu ds cuus dh fØ;k dk m)kgj.k nsrs gq; s djsaA 34.

What are the processes involved in Recombinnant DNA

35.

Discuss the role of Biotechnology in agriculture.

36.

What is Cry Protein ? Which organism produce it and how this protein is utilized through Biotechnology ?

37.

What is micropropagation ? What are the processes involved in it.

38.

How is Biotechnology useful for industry and fermentation products ?

39.

What do you mean by Sterilization ? How it is used in experiments related to Biotechnology ?

40.

What is the role of Biotechnology in crop improvement?

la;kstu Mh0,u0 ,0 dh cukus dh izfdz;k dk mYys[k djsa A

technology?

—f”k esa tSo izk+|ksfxdh dh Hkwfedk ds ckjs esa fy[ksaA

^ØkbZ* izksVhu D;k gS \+ ;g fdl tho ds }kjk fuekZ.k fd;k tkrk gS vkSj bldk tSo&izk|ksfxdh esa dks crk,aA ’kq)&iztuu D;k gS \ bldk mi;ksx fdl izfdz;k esa gksrk gS A

tSo&izk|ksfxdh fdl rjg ls m+|ksx vkSj fdUo.k esa mi;ksx esa vkrk gS \ o.kZu djsa A ca/;kdj.k D;k gS \ tSo& izk|ksfxdh ds iz;ksxksa esa bldk D;k mi;ksx gS \

mi;ksfxrk

Qly lq/kkj esa tSo izk|ksfxdh dh D;k Hkwfedk gS \ 41 . What ar transgenic animals ? Describe its benefits ?

vUrj&ifjofrZr tUrw D;k gS \ buds ykHk dks crk,a A

42.

43.

Write short notes on the following

fuEufyf[kr ij uksV nsa &&&&&&&&&& a.

Golden rice

b.

Biopiracy

c.

Transgenic animals

d.

Antibodies

lqugyk pkoy tSo &pksjh

vUrj &ifjofrZr tUrq ,UVh cMht

Write shorts on any three:

fdUgha rhu ij uksV nsa &&&&& a.

PCR

ih0 lh0 vkj0 b.

ELISA

c.

Vaccines

,yhlk Vhds

d.

Antigen

e.

Acquired immunity

,aVhtu

vftZr izfrj{kk

44.

What are Monoclonal antibodies? What are its application ?

45.

What are controversies regarding Bt-crops ? Discuss.

46

Give an account of Genetically Modified Organisms (GMOs).

47.

Differentiate between Biopatenting ,Bioethics and Biopiracy.

48.

What is Complementory DNA ? And how it is formed .

49.

Give the name of five antibiotics. Where are they obtained from?

50.

What is DNA probe ?Give its application in Biotechnology.

51.

What are positive and negative population interactions between organisms? Explain with an example.

52.

Explain the following:

euksDyksuy ,aVhcMh D;k gS \ bldk mi;ksx D;k gS \ ch0 Vh0 Qlyksa ds ckjs esa fooknksa dh ppZk djsa A

vkuqoaf’kd #i ls vUrj& ifjofrZr tho dh O;k[;k djsa A

tSo& iSVsaV tSo uSfrdrk vkSj tSo pksjh ds chp vUrj Li”V djsa A

dEiyhes.Vjh Mh0 ,u0 ,0 D;k gS \ ;g dSls fodflr fd;k tkrk gS \ ikap ,aVhck;skVhd dk uke nsa A fdu thoksa ls ;s izkIr gksrs gSa \ Mh0 ,u0 ,0 [ksk=h D;k gS \ blds ukeksa dh ppZk djsa A

thoksa ds chp ldkjkRed vkSj udkjkRed tula[;k vUrj& fdz;k;sa D;k gS \ mnkgj.k ds lkFk O;k[;k djsa A fuEufyf[kr dh O;k[;k nsa &&& a.

Notality rate

b.

Mortality rate

c.

Age distribution

uksVsyhVh nj e`R;q nj

mez forj.k d.

Population growth rate

tula[;k o`f) nj

53.

What is ecosystem ? Explain Biotic and Abiotic components of ecosystem.

54.

What is ecologicl spectrum ? Describe it with lebelled diagram.

55.

What is Pedogenesis ? Explain.

56.

What is plant succession ? Name the types and the general process of plant succession.

57-

Describe the structures of the male reproductive organs .

ifjfLFkrh ra= D;k gS \ ltho vkSj futhZo vaxksa dk o.kZu djsa A ikfjfLFkfrd LisDVªe D;k gS \ lfp= o.kZu djsaA Hkw&c)Zu D;k gS \ O;k[;k djsa A

ikS/kksa dk le;kuqdy q ikfjfLFkfrd fodkl ¼lDlslu½ D;k gS \ izdkj vkSj izfdz;k dks crk,a A uj tuu vaxksa dh lajpuk ,oa dk;ksZa dk o.kZu djsa A

58. Draw a well- labeled diagram of cross section of human ovary.

euq”; ds vaMk’k; ds dzkWl dkV dk lqukekafdr fp= cuk,a A

59.

What is menstruation ? Describe the role of different hormones in different phases of the menstrual cycle.

60.

Study the following flow chart. Name the hormone(s) involved at each stage and explain their functions. Hypothalamus---------Hypophysis----------Testes---------------Spermatozoa

esaLVªq,’ku D;k gS \ ekfld pdz ds fofHkUu voLFkkvksa esa fofHkUu gkWeksZUl ds dk;Z dk o.kZu djsa A

fuEufyf[kr cgko &fp= dk v/;;u djsa A izR;sd pj.k ij ‘kkfey gkWeksZu dk uke cok,a ,oa mudk dk;Z crk,a A 61.

Draw a neat and well-labelled diagram of human placenta and enumerate its functions.

62.

Describe the fate of primary germ layers in a human foetus.

63-

Mention the differences between spermatogenesis and Oogenesis.

64-

ekuo vijk dk lqLi”V ukekafdr fp= cuk,a rFkk blds dk;ksZa dk o.kZu djsa A ekou Hkwz.k ds izkjafHkd tuu ijrksa ds Hkfo”; dk o.kZu djsa A ‘kqdkz .kqtuu ,oa vaMtuu esa foHksn LFkkfir djsa A Write a note on parturition and lactation.

izlo ,oa nqX/kL=o.k ij fVIi.kh fy[ksa A

65-

What is reproductive health ? Mention some problems and strategies of reproductive health.

66-

Describe various methods of birth control.

Tkuu &LokLF; D;k gS \tuu &LokLF; lEca/kh leL;kvksa rFkk ;kstukvksa dk o.kZu djsa aA Lakrfr fu;a=.k ds fofHkUu mik;ksa dk o.kZu djsa A

Unit –II PART –D LONG QUESTIONS MARKS-5 67.

686970-

Explain the chromosomal theory of sex determination.

xq.klw= ds }kjk fyax fu/kkZj.k dh fof/k dh O;k[;k djsa A Explain the Hardy-Weimberg law.

gkfMZ&okbucxZ ds fu;e dh O;k[;k djsa A Explain Darwin’s principal of Natural selection .

Mkjfou ds izk—frd oj.k ds fl)kUr dh O;k[;k djsa A What is colorblindness ?How it is transmitted from one generation to another ?

o.kkZU/krk D;k gS\ bldh oa’kkxhr fdl izdkj ls gksrh gSA

71.

Comment upon Morphological and Palaeontological evidences of organic evolution.

72-

Discuss different types of selection with diagrams.

7374-

dkcZfud fodkl ds iqjkthoh izek.k vkSj vk{dkfjdh izek.k ij fVIi.kh djsa A

fHkUu izdkj ds oj.k dk fp= &;qDr o.kZu djsa Explain adoptive radiation with examples.

vuqdy w h fofdj.k dh lmnkgj.k o.kZu djsa A Give an account of human evolution in brief.

ekuo fodkl dh izfdz;k dk laf{Ir fooj.k djsa A

75.

Explain the phenomenon of Industrial melanism.

76-

Explain analogy with examples and diagrams.

7778-

vkS|ksfx esykfuTe dh O;k[;k djsa A

rqY;#irk dh lsknkgj.k vkSj fp= lfgr O;k[;k djsa A Discuss about the main features of human genome.

ekuo thukse ds eq[; fo’ks”krkvksa dk o.kZu djsa A Discuss about the basic steps and uses of DNA finger printing.

Mh0 ,u0 ,0 vaxqyhNkih ds ewy pj.kksa ,oa mi;ksfxrk dk o.kZu djsa A

UNIT III

79. 80.

PART –D LONG QUESTIONS MARKS-5 Discuss about the different aspects of cattle farm management.

Ik’kq& QkeZ izca/kd ds fofHkUu vk;keksa dk o.kZu djsa A

Discuss about the different types of fishes used in Indian fisheries and mention about the process of culturing of fish

Hkkjr esa eNyhikyu ds fy, fdu izdkj ds eNfy;ksa dks fy;k tkrk gS rFkk eNyhikyu dh fof/k dk o.kZu djsa A 81.

What are the main features of cancer-cell explain ?

82.

Draw a neat : well labelled diagram of an antibody molecule

83.

Give a brief account of Apiculture in India.

dSalj dksf’kdk ds dkSu &dkSu ls eq[; y{k.k gksrs gSa O;k[;k djsa A ,UVhckMh v.kq dk lkQ % js[kkafdr fp= n’kZk,a A Hkkjr esa e/kqeD[kh ikyu dk laf{Ir o.kZu djsa A

84.

Explain in detail about the drug addiction and the withdrawal syndrom.

85.

Discuss about different aspects of AIDS.

86.

Explain diagramatically the life cycle of malaria parasite in man.

87.

Discribe the symptoms of Ascariasis and elephantiasis

88.

Discuss about the features of innate immunity. How is it different from acquired immunity ?

89.

Give an account of different types of drugs and their effects.

Mªx&O;lu vkSj fofuorZu lay{k.k ds foLrkj ls O;k[;k djsa A ,M~l dh fofHkUu vk;keksa dk o.kZu djsa A

euq”; ds eysfj;k ijthoh ds thou pdz dk fp= lfgr O;k[;k djsa A ,Ldsfj,fll vkSj Qhy ik¡o ds y{k.kksa dk o.kZu djsa A

Lkgt izfrj{kk ds y{k.kksa dk o.kZu djsa A ;g mikfZZtr izfrj{kk ls dSls fHkUu gS \ fHkUu izdkj ds MªXl vkSj muds dqizHkkoksa dk o.kZu djsa A

90.

Give an account of five types of viral diseases in man and their mode of transmission.

91.

What are the measures for prevention and control of communicable diseases ?

ik¡p idkj thok.kq&tfur jksxksa rFkk buds lapj.k fof/k dk o.kZu djsa A ladkz ed jksxksa ds fujks/k vkSj fu;U+=.k ds mik;ksa dk o.kZu djsa A

UNIT -IV PART –D LONG QUESTIONS MARKS-5

92-

Discribe various characteristics of population.

93-

Describe different types of interspecific interactions with suitable examples.

949596979899100101102103104-

105106107-

vkcknh dh fofHkUu fo’ks”krkvksa dk o.kZu djsa A vUrtkZrh; ikjLifjd izfrfdz;k ds fofHkUu izdkjksa dk lksnkgj.k o.kZu djsa A Define adaptation. Give an account of desort adaptations found in animals.

vuqdwyu dh ifjHkk”kk crk,a A tUrqvksa esa ik;s tkusokys e#LFkyh; vuqdwyu dk o.kZu djsa A What is species ? Describe the mechanism of origin of species.

Lih’kht D;k gS \ Lih’kht dh mRifr dh izfdz;k dk o.kZu djsa A Describe the structure of an ecosystem.

ikfjfLFkfrd ra= dh lajpuk dk o.kZu djsa A Define ecological succession. Describe its different types.

ikfjfLFkfrd vuqdze.k dh ifjHkk”kk nsa A blds fofHkUu izdkjksa dk o.kZu djsa A What is biogeochemical cycle ? What are its types? Describe carbon cycle.

Hkw &tSfod jlk;fud pdz D;k gS \ blds fdrus izdkj gSa \ dkcZu pdz dk o.kZu djsa A Describe a pond ecosystem with diagram.

,d rkykch; ikfjfLFkfrd ra= dk lfp= o.kZu djsa A Define biodiversity. Describe different types of biodiversity.

tSo fofo/krk dh ifjHkk”kk fy[ksa A tSo fofo/krk ds fofHkUu izdkjksa dk o.kZu djsa A Explain the importance of biodiversity.

tSo fofo/krk ds egRo dk o.kZu djsa A Describe briefly the strategies of conservation of biodiversity.

tSo fofo/krk&laj{k.k dh ;qfDr;ksa dk laf{Ir fofoj.k nsa A Describe the loss of biodiversity and its possible remedy.

tSo fofo/krk ds âkl dk o.kZu djsa rFkk blds lEHkkfor mipkj dks crk,a A What is global warming ? Write about the factors and effects of global warming. How it can be controlled ?

Xykscy okfeZax D;k gS \Xykscy okfeZax ds dkj.ksak ,oa izHkko ds ckjs esa fy[ksa A bls dSls fu;af=r fd;k tk ldrk gS \ Define pollution. Explain briefly the main factors of air pollution and their effects.

izn”w k.k dh ifjHkk”kk fy[ksa A ok;q izn”w k.k ds eq[; dkjdksa ,oa buls gksusokyh leL;kvksa dsk la{ksi es le>k,aA What are solid wastes ? Classify it. Write a note on management of waste disposal.

Bksl vif’k”V D;k gS \ budk oxhZdj.k djsa A vif’k”Vksa ds fuiVkjs ds izca/ku ij ,d fVII.kh fy[ksa A Describe briefly the main factors of water pollution and their effects.

ty izn”w k.k ds eq[; dkjdksa ,oa buls gksus okyh leL;kvkssa dk la{ksi esa o.kZu djsa A

Bihar-Board-Intermediate-Biology-Model-Question-Paper-2014.pdf ...

Page 2 of 26. MODEL QUESTION. Biology. Ultra short Questions mark: 1 Each. vYVak 'kkWVZ iz'u vad% izR;sd 1. 1- What is the function of Endosperm?

447KB Sizes 5 Downloads 266 Views

Recommend Documents

No documents