745

Corticosterone impairs the mRNA expression and activity of 3b- and 17b-hydroxysteroid dehydrogenases in adult rat Leydig cells R. Badrinarayanan, S. Rengarajan, P. Nithya, and K. Balasubramanian

Abstract: Clinical and experimental studies, including our own observations, have shown the adverse effects of excess glucocorticoids on testicular steroid hormone production. The present study was designed to gain insight into the molecular mechanisms by which excess corticosterone impairs Leydig cell steroidogenesis. To achieve this, adult rats were administered with corticosterone-21-acetate (2 mg/100 g body weight) twice daily for 15 days. After the treatment period, rats were killed by decapitation. The testes were removed, decapsulated aseptically and used for the isolation of Leydig cells. Purified Leydig cells were used for assessing the activity of 3b- and 17b-hydroxysteroid dehydrogenases (HSDs) and total RNA isolation. For in vitro studies, purified Leydig cells (7.5  106 cells) of control rats were plated in culture flasks and exposed to different concentrations (50, 100, 200, 400, and 800 nmol/L) of corticosterone for 24 h. At the end of incubation, total RNA was isolated from cultured Leydig cells, and the mRNA of 3b- and 17b-HSDs was quantified by RT– PCR. A significant reduction in the activities and levels of 3b-HSD type-I and 17b-HSD type-III mRNAs in Leydig cells were observed. In vitro studies demonstrated a dose-dependent significant impairment in both the activity and mRNA expression of these enzymes. These results suggest that corticosterone might have a direct effect on the transcription of the genes of 3b- and 17b-HSD. It is inferred from the present in vivo and in vitro studies that one of the molecular mechanisms by which excess corticosterone decreases the steroidogenic potency of Leydig cells is by suppressing the mRNA expression of 3b-HSD type-I and 17b-HSD type-III enzymes. Key words: Leydig cell, corticosterone, 3b-HSD, 17b-HSD. Re´sume´ : Des e´tudes cliniques et expe´rimentales, incluant nos propres e´tudes, ont de´montre´ qu’un exce`s de glucocorticoı¨des produit des effets secondaires sur la production des hormones ste´roı¨diennes par le testicule. La pre´sente e´tude a e´te´ conc¸ue afin de comprendre les me´canismes mole´culaires par lesquels un exce`s de corticoste´rone inhibe la ste´roı¨dogene`se ` cette fin, des rats adultes ont e´te´ traite´s avec 2 mg/100 g de poids corporel de corticoste´dans les cellules de Leydig. A rone-21-ace´tate 2 fois par jour, pendant 15 jours. Apre`s la pe´riode de traitement, les rats ont e´te´ sacrifie´s par de´capitation et les testicules pre´leve´s, de´capsule´s de fac¸on aseptique et les cellules de Leydig isole´es. Les cellules de Leydig purifie´es ont e´te´ utilise´es pour quantifier l’activite´ des 3b- et 17b-HSD et isoler l’ARN. Lors des e´tudes in vitro, les cellules de Leydig purifie´es (7,5  106 cellules) de rats te´moins ont e´te´ ensemence´es dans des flacons de culture et expose´es a` diffe´` la fin de la pe´riode d’incurentes concentrations (50, 100, 200, 400, et 800 nmol/L) de corticoste´rone pendant 24h. A ´ ´ ´ ` bation, l’ARN total a ete isole a partir des cellules de Leydig et l’ARNm des 3b- et 17b-HSD a e´te´ quantifie´ par RT– PCR. Des re´ductions significatives de l’activite´ et du niveau d’ARNm de la 3b-HSD de type I et de la 17b-HSD de type III ont e´te´ observe´es dans les cellules de Leydig. Les e´tudes in vitro ont de´montre´ une alte´ration significative de l’activite´ et du niveau de l’ARNm de ces enzymes de fac¸on de´pendante de la concentration de corticoste´rone. Ces re´sultats sugge`rent que la corticoste´rone peut avoir un effet direct sur la transcription des ge`nes codant les 3b- et 17b-HSD. On peut de´duire de ces e´tudes in vivo et in vitro qu’un des me´canismes mole´culaires par lequel un exce`s de corticoste´rone diminue le potentiel ste´roı¨doge`ne des cellules de Leydig est par la suppression de l’expression de l’ARNm des enzymes 3b-HSD de type I et 17b-HSD de type III. Mots cle´s : cellules de Leydig, corticoste´rone, 3b-HSD, 17-HSD. [Traduit par la Re´daction]

Introduction The male reproductive system encompasses a pair of testes, epididymides, and other accessory sex organs. Any

impairment in the functions of these organs due to various internal and external factors results in reproductive dysfunction. Glucocorticoid is one such factor, which, in excess (McKenna et al. 1979; Monder et al. 1992), has been shown

Received 21 February 2006. Revision received 3 May 2006. Accepted 10 May 2006. Published on the NRC Research Press Web site at http://bcb.nrc.ca on 11 October 2006. R. Badrinarayanan, S. Rengarajan, P. Nithya, and K. Balasubramanian.1 Department of Endocrinology, Dr. ALM Post Graduate Institute of Basic Medical Sciences, University of Madras, Taramani, Chennai 600113, Tamilnadu, India. 1Corresponding

author (e-mail: [email protected]).

Biochem. Cell Biol. 84: 745–754 (2006)

doi:10.1139/O06-074

#

2006 NRC Canada

746

to cause reproductive disorders in human and experimental animals. High levels of glucocorticoids due to Cushing’s syndrome/disease (McKenna et al. 1979), therapeutic administration (MacAdams et al. 1986; Veldhuis et al. 1992), and stress (Monder et al. 1992; Orr et al. 1994; Maric et al. 1996) decrease plasma testosterone. These reciprocal changes in the levels of steroid hormones have immense physiological consequences, which include muscular atrophy and gonadal dysfunctions (McKenna et al. 1979; Sapolsky 1985). Excess glucocorticoid has been shown to suppress Leydig cell steroidogenesis and many authors have attempted to explain the mechanisms of the inhibitory effects of glucocorticoid (Orr et al. 1994; Maric et al. 1996). While few studies have suggested that glucocorticoids decreased testosterone production indirectly via a defective hypothalamo-hypophyseal axis (Dubey and Plant 1985; Rosen et al. 1988), contemporary studies have demonstrated that glucocorticoids act directly on Leydig cells through specific receptors (Hales and Payne 1989; Payne and Sha 1991; Orr et al. 1994; Maric et al. 1996). Leydig cells have been shown to possess glucocorticoid receptors (Evain et al. 1976; Stalker et al. 1989). Hydroxysteroid dehydrogenases (HSDs) play a pivotal role in the biosynthesis and inactivation of all steroid hormones. In steroidogenic tissues, they catalyze the final steps in androgen, estrogen, and progesterone biosynthesis (Penning 1997). In peripheral tissues, including steroid hormone target tissues, they convert potent steroid hormones into inactive metabolites and regulate the amount of hormone that can bind to members of the nuclear receptor superfamily, ultimately regulating gene expression. Target cells may depend on these reactions to control specificity of response to steroid hormones (Penning 1997). The enzyme 3b-hydroxysteroid dehydrogenase (3b-HSD; EC 1.1.1.145) /
5-
4 isomerase (EC 5.3.3.1) is required for the biosynthesis of all classes of steroid hormones, namely progesterone, glucocorticoids, mineralocorticoids, androgens, and estrogens (Zhao et al. 1991). It is a membrane-associated protein located in the microsomal and mitochondrial membranes (Luu-The et al. 1990) of classical steroidogenic tissues and peripheral tissues (Simard et al. 1991). The enzyme catalyzes 2 reactions: the dehydrogenation of 3b-equatorial hydroxyl groups and the subsequent isomerization of the
5-3-ketosteroid products to yield a,b-unsaturated ketones. The majority of steroid hormones, with the exception of estrogens and the 5a-reduced androgens, contain this functional group. Multiple 3b-HSD mRNA types have so far been described in the rat (Zhao et al. 1991). The rat typeI, -II, and -IV proteins are genuine NAD+/H-dependent isoenzymes. On the other hand, the liver-specific type-III protein is a 3-ketosteroid reductase (3-KSR) that catalyzes the conversion of 5a-androstane-3-one-17 beta-ol (DHT) and 5a-androstane-3,17-dione into their 3b-hydroxy metabolites (Sanchez et al. 1994). In rats, only 3b-HSD types I and II are expressed in gonads (Labrie et al. 1994). In vitro studies have demonstrated that the activity of type-I enzyme is higher than that of the type-II enzyme, a finding attributed to the absence of a putative membrane-spanning domain in the type-II sequence, which leads to the lower affinity to substrates (Simard et al. 1991). Both types encode a 372-amino acid protein. The sequences of type-I and -II cDNAs have an open reading

Biochem. Cell Biol. Vol. 84, 2006

frame of 1119 nucleotides, with only 33 mismatches between the 2 sequences (Zhao et al. 1991). The overall nucleotide similarity between the 2 types of rat 3b-HSD cDNAs is 96.5%. The deduced amino acid sequences of rat 3b-HSD types I and II share 93.8% similarity with only 23 nonidentical residues. 17b-hydroxysteroid dehydrogenase (EC 1.1.1.62) / 17ketosteroid reductase (17b-HSD/KSR) are NAD(H)- and (or) NADP(H)-dependent enzymes that catalyze the oxidation and reduction of 17b-hydroxy- and 17-ketosteroids, respectively (Peltoketo et al. 1999). Both estrogens and androgens have the highest affinity for their receptors in the 17b-hydroxy form, and hence, 17b-HSD/KSR enzymes regulate the biological activity of the sex hormones. Certain 17b-HSD/KSRs are also involved in the catabolic cascades of sex steroids. 17-KSR activities are essential for estradiol and testosterone biosynthesis in the gonads, but they are also present in certain extra-gonadal tissues and can convert low-activity precursors to their more potent forms in peripheral tissues (Peltoketo et al. 1999). 17bHSDs, which by conversion at position 17, modulate the biological potency of estrogens and androgens, are inactive in their keto form, whereas they are active in their hydroxy form and access the receptors (Mindnich et al. 2004). At present, 12 forms of 17b-HSDs are known, most of which are members of the short chain dehydrogenase/reductase protein superfamily. One exception is 17b-HSD type V, which belongs to the aldoketo-reductase family (Deyashiki et al. 1995). Members of these families utilize NADPH nucleotides as cofactors for steroid reduction or oxidation reactions. 17b-HSD/KSR3 is essential for testosterone biosynthesis (Geissler et al. 1994). Rat 17b-HSD type-III mRNA was observed in the Leydig cells and it catalyzes the reductive reaction almost exclusively with substrate preference for androstenedione over dehydroepiandrosterone. The enzyme prefers NADPH as cofactor. The cDNA encodes a 310-amino-acid protein. Northern analysis revealed the presence of a single mRNA transcript of 1.4 kb in rat Leydig cells (Tsai-Morris et al. 1999). Rat 17b-HSD type-III activity is under ATP control and intracellular glucose plays an important role in the regulation of the enzyme. The contribution of the glycolytic pathway to meet optimal provision of ATP for 17b-HSD activity has been demonstrated by Khanum et al. (1997). In rat Leydig cells, 3b-HSD type I and 17b-HSD type III are predominantly expressed (Tang et al. 1998; Tsai-Morris et al. 1999). 3bHSD is involved in the conversion of pregnenolone to progesterone and 17b-HSD catalyzes the conversion of androstenedione to testosterone. An in vivo study from our laboratory has shown the adverse effect of chronic corticosterone treatment on Leydig cellular 3b- and 17b-HSD enzyme activity (Sankar et al. 2000a). An in vitro study has also demonstrated a significant reduction in the activity of 3b-HSD in the Leydig cells of prepubertal, pubertal, and adult rats following a treatment with dexamethasone (DEX), a synthetic glucocorticoid (an analogue of cortisol) (Agular and Vind 1995). However, it is not known whether these changes are due to the defective expression of the genes of 3b- and 17b-HSD. Studies on the gene expression of steroidogenic enzymes is expected to #

2006 NRC Canada

Badrinarayanan et al.

shed light on the mechanism by which glucocorticoids inhibit Leydig cell testosterone synthesis. Therefore, in the present study, an attempt has been made to identify the effects of chronic administration of corticosterone (in vivo) and the dose-dependent effects of corticosterone (in vitro) on the activity and mRNA expression of Leydig cell 3bHSD type-I and 17b-HSD type-III enzymes.

Materials and methods Animals Male Wistar albino rats (Rattus norvegicus) weighing 175–240 g and aged about 120 days were maintained in a well ventilated, temperature-controlled animal facility with a 12 h light : 12 h dark schedule. Rats were fed ad libitum with standard balanced rat pellets purchased from Brooke Bond Lipton India Ltd (Mumbai, India) and drinking water was also made available ad libitum. Chemicals Dulbecco’s modified Eagle’s medium + Hams F12 nutrient mixture (1:1) (DMEM + F12), corticosterone, corticosterone21-acetate, collagenase (type IV), Percoll, bovine serum albumin (BSA), isopropanol, pregnenolone, 4-androstene-3,17-dione, absolute alcohol, and chloroform were purchased from Sigma Chemical Co. (St. Louis, Missouri). Total RNA isolation reagent (TRIR) was purchased from AB gene (Surrey, UK) and a One-step RT–PCR kit was purchased from Qiagen (Hilden, Germany). The primers for 3b- and 17b-HSDs were purchased from AlphaDNA (Que´bec) primers for RPS-16 and rat b-actin were purchased from Integrated DNA technologies (Coralville, Indiana), and other fine chemicals were obtained from US Biological (Swampscott, Massachusetts). NAD, NBT, and other chemicals and reagents were purchased from Sisco Research Laboratories Ltd (Mumbai, India). Experimental design for in vivo studies Rats were divided into 2 groups of 6 animals each. Group I comprised control rats that received equal volumes of vehicle (water) only. Group II rats received corticosterone-21acetate (2 mg/100 g body weight, intra muscular, twice daily at 0900 and 1800 for 15 days). The selection of dose of corticosterone-21-acetate was based on previous studies in our laboratory (Balasubramanian et al. 1987; Sankar et al. 2000a, 2000b). The control (vehicle treated) and corticosterone-treated rats were maintained under identical conditions. After the treatment period, rats were anesthetized by sodium pentobarbital injection and killed by decapitation. The testes were removed, decapsulated under aseptic conditions, and used for Leydig cell isolation. Leydig cell isolation Leydig cells were isolated as described previously (Rigaudiere et al. 1988). Testes were decapsulated and digested in collagenase-containing medium (0.25 mg/mL) at 37 8C for 15 min in a shaking water bath. The resulting crude Leydig cell preparations were further purified on discontinuous Percoll gradients. The purity of Leydig cells was assessed by histochemical staining for 3b-HSD

747

activity (Aldred and Cooke 1983) and viability was determined by trypan blue exclusion. The purity of the Leydig cells was 80%–90% and viability was 85%–90%. The purified Leydig cells were used for total RNA isolation and RT–PCR analysis of 3b- and 17b-HSD mRNA. Experimental design for in vitro studies Normal rats were anesthetized by sodium pentobarbitol injection and killed by decapitation. Testes were removed, decapsulated under aseptic conditions, and used for the isolation of Leydig cells. Leydig cell culture and corticosterone treatment Purified Leydig cells from normal rats were plated in culture flasks at the density of 7.5  106 cells using DMEM/F12 medium with 1% (v/v) FCS overnight. The cells were then exposed to different concentrations (50, 100, 200, 400, and 800 nmol/L) of corticosterone using FCS-free fresh medium and incubated for 24 h. At the end of incubation, cells were used for determining the activities of 3b- and 17bHSDs and isolation of total RNA for assessing the expression of 3b- and 17b-HSD mRNA. Assay of 3b- and 17b-HSD activity Cultured Leydig cells were immediately processed for the assay of 3b- and 17b-HSD enzymatic activity, based on the established spectrophotometric method (Bergmeyer 1974). Briefly, Leydig cells (2  106 cells) were homogenized, sonicated in ice-cold Tris–HCl buffer (0.1 mmol/L; pH 7.2), and centrifuged at 16 000g and 10 000g for 5 min at 4 8C for 3band 17b-HSD, respectively. The supernatant was taken as the enzyme extract. The reaction mixture contained 0.6 mL pyrophosphate buffer (100 mmol/L), 0.2 mL NAD (0.5 mmol/L), 2 mL distilled water, and 0.1 mL pregnenolone (0.1 mmol/L) for the 3b-HSD assay, and 0.6 mL pyrophosphate buffer (100 mmol/L), 0.2 mL NADPH (0.5 mmol/L), 2 mL distilled water, and 0.1 mL 4-androstene-3,17-dione (0.8 mmol/L) for the 17b-HSD assay. After the addition of the enzyme extract (0.1 mL), the absorbance at 340 nm was measured at 20 and 30 s intervals for 3b- and 17b-HSD assays, respectively, for 5 min in a spectrophotometer against a blank sample. Total RNA isolation After in vivo and in vitro treatments, Leydig cells were lysed directly by adding the total RNA isolation reagent (TRIR) and were used for the isolation of total RNA using an acidic phenol–chloroform extraction procedure (Chomczynski and Sacchi 1987) and precipitation with 100% isopropanol. Total RNA was washed twice with 70% ethanol, dried, solubilized in autoclaved Millipore (Millipore, Molsheim, France) water, and quantified by absorbance at OD260/280. Only samples with a ratio of 1.8– 2.0 were used for RT–PCR analysis, which ensures that all the RNA was not degraded and free of protein and DNA contamination. Reverse transcription – polymerase chain reaction Total RNA (2 g) was subjected to RT–PCR with reverse transcription for 30 min at 50 8C followed by PCR in a total volume of 50 mL. The PCR conditions were as follows for #

2006 NRC Canada

748

Biochem. Cell Biol. Vol. 84, 2006 Table 1. Oligonucleotide Primers used for RT–PCR. Gene product 3b-HSD type I

17b-HSD type III

RPS-16

b-actin

Oligonucleotide 5’-Primer (238–256) TTGGTGCAGGAGAAAGAAC 3’-Primer (784–766) CCGCAAGTATCATGACAGA 5’-Primer (112–131) TTCTGCAAGGCTTTACCAGG 3’-Primer (764–745) ACAAACTCATCGGCGGTCTT 5’-Primer (83–102) AAGTCTTCGGACGCAAGAAA 3’-Primer (230–212) GACAAGACGAAGACCCGTT 5’-Primer (472–491) GCCATGTACGTAGCCATCCA 3’-Primer (846–828) GAACCGCTCATTGCCGATAG

all genes: an initial denaturation step at 95 8C for 15 min and then cycling through denaturation at 94 8C for 1.5 min; annealing at 57 8C for 1.5 min, extension at 72 8C for 3 min for 40 cycles, and a final extension step at 72 8C for 10 min. Table 1 shows the primer sequences and product size for each gene. The optimal number of cycles needed to quantify the mRNA for each gene was determined by preliminary experiments using Leydig cellular total RNA from control rats. The RT–PCR products were electrophoresed in 2% agarose gel and detected by ethidium bromide staining. Densitometric analysis of RT–PCR products for 3b-HSD type I and 17b-HSD type III was performed using Bio-Rad Quantity One Imaging Software (Bio-Rad, Hercules, California) and normalized to that of RPS-16 or b-actin and relatively quantified.

Gen Bank Accession No. M38178

Amplicon size (bp) 547

Reference Sakaue et al. 2002

NM054007

653

Sakaue et al. 2002

XM341815

148

Shan et al. 1995

NM012969

374

Oaks and Raff 1995

Fig. 1. Effects of the chronic administration of corticosterone (2 mg/100 g body weight, intra muscular, twice daily for 15 days) on Leydig cellular 3b-HSD activity. Each bar represents the mean ±SEM of 5 observations. (p < 0.05.) a, significantly different from control.

Statistical analysis The data were subjected to statistical analysis using oneway ANOVA and Duncan’s multiple range test to assess the significance of individual variations among the treatment groups. A p value less than 0.05 was considered to be significant.

Results Corticosterone treatment effectively decreased Leydig cell 3b- and 17b-HSD activity (Figs. 1 and 2) compared with the control (in agreement with previously published data from our laboratory) (Sankar et al. 2000a). The expression of 3b- and 17b-HSDs mRNA showed a marked decrease following corticosterone treatment compared with the control (Figs. 3, 4, and 5). When compared with the basal level, a significant reduction in the activity of 3b-HSD was recorded at all doses of corticosterone. Nevertheless, there was no significant difference between the activities associated with corticosterone doses of 400 and 800 nmol/L. (Fig. 6). 17b-HSD activity declined at higher doses of corticosterone compared with the basal level, with the exception of the 50 nmol/L dose. Nevertheless, the activity of the enzyme

did not significantly vary when doses of corticosterone were between 400 and 800 nmol/L (Fig. 7). Corticosterone exposure caused a significant reduction in the levels of 3b-HSD type-I mRNA at all concentrations when compared with the basal level, but the magnitude of decrease was similar among 50, 100 and 200 nmol/L doses. However, when compared with the 50 nmol/L dose of corticosterone, 400 and 800 nmol/L doses showed a marked decrease in mRNA, whereas when compared with the 100 nmol/L dose, only the 800 nmol/L dose showed a significant decrease (Fig. 8). When compared with basal and 50 nmol/L doses, the expression of 17b-HSD type-III mRNA was significantly reduced at all concentrations of corticosterone tested. Nevertheless, no significant decrease was recorded among the treatment groups, except for those between 100 and 800 nmol/L doses of corticosterone (Figs. 9 and 10). #

2006 NRC Canada

Badrinarayanan et al.

749

Fig. 2. Effects of chronic administration of corticosterone (2 mg/ 100 g body weight, intra muscular, twice daily for 15 days) on Leydig cellular 17b-HSD activity. Each bar represents the mean ±SEM of 5 observations. (p < 0.05.) a, significantly different from control.

Fig. 4. Effects of chronic administration of corticosterone on the mRNA expression of 3b-HSD type I in the Leydig cells of adult albino rats. Each bar represents the mean ± SEM of 3 separate experiments (n = 6  3). (p < 0.05.) a, significantly different from control.

Fig. 3. Agarose gel electrophoretic pattern showing the effects of chronic administration of corticosterone on the mRNA expression of 3b-HSD type I and 17b-HSD type III in the Leydig cells of adult albino rats. Lane1, 100 bp DNA ladder; lane 2, control; lane 3, corticosterone treated.

Fig. 5. Effects of chronic administration of corticosterone on the mRNA expression of 17b-HSD type III in the Leydig cells of adult albino rats. Each bar represents the mean ± SEM of 3 separate experiments (n = 6  3). (p < 0.05.) a, significantly different from control.

Discussion Our in vivo study clearly demonstrates that elevated levels of corticosterone resulting from exogenous administration decreased testicular 3b-HSD type-I and 17b-HSD typeIII mRNA expression. Glucocorticoids impair Leydig cell function indirectly via a defective hypothalamo-pituitary axis and by acting directly on Leydig cells through their receptors (Dubey and Plant 1985; Rosen et al. 1988; Hales and Payne 1989; Orr et al. 1994; Maric et al. 1996). Testicular testosterone output was shown to be markedly reduced following levels of glucocorticoids that were elevated as a result of Cushing’s syndrome/disease, stress, and exogenous administration (Veldhuis et al. 1992; Orr et al. 1994; Horiba 1997). 3b- and 17b-HSDs are the 2 important enzymes involved in testosterone biosynthesis. In the present study, the expression of 3b-HSD type-I and 17b-HSD type-III mRNA was significantly reduced in Leydig cells of rats as a result of chronic corticosterone admin-

istration. Our previous study demonstrated a significant reduction in the activities of both these steroidogenic enzymes in Leydig cells of adult albino rats that were subjected to the same dose and duration of corticosterone administration (Sankar et al. 2000a). These findings suggest that the decreased enzyme activity is the result of impaired transcription of the genes. Glucocorticoid receptors (GRs) have been identified in Leydig cells (Evain et al. 1976), implying that these cells are one of the targets for glucocorticoid action (Stalker et al. 1989). An earlier study from our laboratory has shown that the concentration of corticosterone is higher in the testicular interstitial fluid of rats treated with corticosterone (2 mg/100 g body weight, twice daily) for 15 days compared with that of control rats (Sankar et al. 2000b). These observations prompt us to propose that corticosterone directly suppresses the expression of 3b- and 17b-HSD mRNAs in Leydig cells. #

2006 NRC Canada

750 Fig. 6. Dose-dependent effects of corticosterone on Leydig cellular 3b-HSD activity in vitro. Each bar represents the mean ± SEM of 5 observations. (p < 0.05.) a, compared with the basal level; b, compared with 50 nmol/L corticosterone; c, compared with 100 nmol/L corticosterone; d, compared with 200 nmol/L corticosterone.

Fig. 7. Dose-dependent effects of corticosterone on Leydig cellular 17b-HSD activity in vitro. Each bar represents the mean ± SEM of 5 observations. (p < 0.05.) a, compared with the basal level; b, compared with 50 nmol/L corticosterone; c, compared with 100 nmol/L corticosterone; d, compared with 200 nmol/L corticosterone.

LH is the prime stimulator of Leydig cell steroidogenesis. Serum LH was found to be significantly decreased in corticosterone treated rats (Sankar et al. 2000a). Positive regulation of 3b- and 17b-HSDs by LH is apparent at several levels from transcription of these genes to translation of their mRNAs into functional enzymes (Tang et al. 1998; Tsai-Morris et al. 1999). Since circulating levels of LH have been shown to be low in corticosterone-treated rats (Sankar et al. 2000a), the same thing may be responsible for the diminished expression of 3b- and 17b-HSD mRNAs in Leydig cells. Apart from LH, prolactin and insulin also modulate the functions of Leydig cells (Blanco et al. 1981; Gunasekar et al. 1988). Prolactin increases the number of LH receptors on Leydig cells and potentiates the action of LH on testosterone production. These effects seem to be mediated through specific prolactin receptors on Leydig cells (Barkey et al. 1987).

Biochem. Cell Biol. Vol. 84, 2006

Corticosterone treatment of male rats resulted in a decrease in the circulating level of prolactin (Balasubramanian et al. 1987; Taylor et al. 1995), which may be due to the inhibition of pituitary bioactive prolactin secretion. The repression of mammalian prolactin gene expression by glucocorticoids in both pituitary and nonpituitary cell lines is well documented (Adler et al. 1988; Berwaer et al. 1991; Nalda et al. 1997; Subramaniam et al. 1998). Furthermore, glucocorticoids have been shown to possess suppressive effects on prolactin secretion (Taylor et al. 1995) and lactotroph differentiation in rats (Sato and Watanabe 1998). Our ongoing in vitro studies demonstrated a significant reduction in Leydig cell surface prolactin receptors following exposure to different doses of corticosterone (S. Rengarajan, T. Malini, R. Sivakumar, and K. Balasubramanian, unpublished observation). In view of these findings, the reduction in 3b- and 17b-HSDs mRNA may partly be due to the defective action of prolactin on Leydig cells. Insulin stimulated the activity of 3b-HSD in Leydig cells of diabetic rats (Sudha et al. 2000). Hypercortisolism is recognized as one of the causative factors of insulin resistance or type II diabetes mellitus (Catargi et al. 2003). Buren et al. (2002) reported that DEX (0.3 mol/L) brought about a reduction in cell surface 125I-insulin binding by *40% in primary cultures of rat adipocytes. In rats treated with DEX, insulin binding to adipocytes was shown to be inhibited (De Pirro et al. 1981). A recent in vitro study in our laboratory showed a significant reduction in the concentration of cell surface insulin receptors in adult rat Leydig cells exposed to higher concentrations (200–800 nmol/L) of corticosterone (S. Rengarajan, T. Malini, R. Sivakumar, and K. Balasubramanian, unpublished observation). It is therefore suggested that the corticosterone-induced defective action of insulin may be another factor responsible for the impaired expression of 3b- and 17b-HSD mRNA. The in vitro study also clearly indicates that exposure of Leydig cells to corticosterone suppresses the activity, as well as the mRNA expression, of 3b- and 17b-HSDs. This is consistent with the previous in vivo study from our laboratory on the activities of 3b- and 17b-HSDs in Leydig cells of rats treated with corticosterone (Sankar et al. 2000a). The conversion of pregnenolone to progesterone catalysed by 3bHSD is an important step in Leydig cell steroidogenesis (Tang et al. 1998), and it results in the formation of a precursor for testosterone. In support of the present study, evidence can be drawn from the report of Agular and Vind (1995), who have shown that DEX, a synthetic glucocorticoid, diminished the activity of 3b-HSD in Leydig cells from 3, 5, 7, and 10 week old rats. The dose-dependent reduction in the activity of 3b-HSD recorded in the present study may be attributed to the direct genomic (reduction in mRNA expression) and nongenomic (reduction in the availability of co-factor) actions of corticosterone. 17b-HSD is involved in the conversion of androstenedione to testosterone and requires ATP, which is produced through glucose oxidation for its optimal activity (Khanum et al. 1997). A recent in vitro study from our laboratory has revealed a significant dose-dependent reduction in glucose oxidation in Leydig cells exposed to various doses of corticosterone (S. Rengarajan, T. Malini, R. Sivakumar, and K. Balasubramanian, unpublished observation). This suggests #

2006 NRC Canada

Badrinarayanan et al.

751

Fig. 8. Agarose gel electrophoretic pattern showing the dose-dependent effects of corticosterone on the mRNA expression of 3b-HSD type I and 17b-HSD type III in Leydig cells in vitro. Lane 1, 100 bp DNA ladder; lane 2, control; lanes 3–7: corticosterone treated (50– 800 nmol/L).

Fig. 9. Dose-dependent effects of corticosterone on the mRNA expression of 3b-HSD type I in Leydig cells in vitro. Each bar represents the mean ± SEM of 3 separate experiments (n = 6  3). (p < 0.05.) a, compared with the basal level; b, compared with 50 nmol/ L corticosterone; c, compared with 100 nmol/L corticosterone.

Fig. 10. Dose-dependent effects of corticosterone on the mRNA expression of 17b-HSD type III in Leydig cells in vitro. Each bar represents the mean ± SEM of 3 separate experiments (n = 6  3). (p < 0.05.) a, compared with the basal level; b, compared with 50 nmol/L corticosterone.

that reduced glucose oxidation would have resulted in reduced ATP production, which in turn might have affected the activity of 17b-HSD. In addition to this, since corticosterone was shown to decrease the availability of NADPH (Kavitha et al. 2006), the co-factor essential for optimal activity of 17b-HSD, the same may be responsible for the reduction in the activity of 17b-HSD. The dose-dependent effects of corticosterone on 3b- and 17b-HSD mRNA expression are not quite comparable with those on the enzyme activity observed because both enzymes showed significant reduction in activity, even with higher doses of corticosterone, unlike mRNA expression. The most plausible reason for the increased adverse effect of corticosterone on 3b-HSD activity at higher doses may be that there is a reduction in the availability of NAD+, since the activity of enzyme 3b-HSD is dependent on

NAD+ (Mason et al. 1998). In addition to this, the reduced activity of 3b-HSD could be cuased by the defective translation of its mRNA. Nonetheless, further studies on the rate of transcription (nuclear run on assay) and mRNA stability would be interesting. The possible differential influence of excess corticosterone on levels of mRNA expression and enzyme activity is also evident from the study of Akinbami et al. (1999), who showed that there is a reduction in the protein levels of cytochrome P450scc and 3b-HSD in the testis of rats subjected to immobilization stress, but the levels of their mRNA expression remain unchanged. In the present in vitro study, the adverse effect of corticosterone on Leydig cell 3b- and 17b-HSD mRNA expression was much more pronounced at higher doses. In this regard, it is worthwhile to recall the work of Lim et al. (1996), who showed a marked decrease in the mRNA expression of an#

2006 NRC Canada

752

drogen binding protein (ABP) in Sertoli cells exposed to higher doses of DEX (1 and 10 mmol/L). Since the promoter regions of rat 3b- and 17b-HSD genes have not yet been fully characterized, the molecular mechanism by which corticosterone would have brought about its inhibitory effect on 3b- and 17b-HSD gene transcription is intriguing. The many mechanisms by which GR can downregulate transcription have been documented, and different types of negative glucocorticoid response elements (nGREs) within the promoter of target genes have been identified (Newton 2000). One of these mechanisms is the binding of ligand-bound homodimers of GR to GREs consisting of palindromic half sites, which results in the activation or repression of the target genes (Tsai and O’Malley 1994). Another mechanism by which the GR can affect transcription is through protein–protein interactions with heterologous transcription factors independent of this type. GR has been shown to modulate AP-1 action by physical association with c-jun (Yang-Yen et al. 1990). In addition, GR interacts with CREB (Imai et al. 1993) and GATA-1 (Chang et al. 1993). In this regard, Olswang et al. (2003) have demonstrated that, in 3T3-F442A adipocyte cell lines, glucocorticoid (>10–7 mol/L or 100 nmol/L) repressed the transcription of the phosphoenol pyruvate carboxykinase gene by inhibiting the CCAAT/enhancer binding protein (C/EBP)-mediated activation. Members of the C/EBP family have been shown to bind directly to the ligand-binding domain of a number of nuclear receptors, including GR (Hu et al. 2001). These interactions resulted either in the induction or inhibition of the target genes, and did not necessarily involve the binding of GR to the DNA (Boruk et al. 1998). In view of these reports, it is suggested that excess corticosterone would have impaired the expression of 3b- and 17b-HSD mRNA by any one of the above-mentioned mechanisms. In contrast to the results obtained in the present study, Feltus et al. (2002) have reported that, at a concentration of 100 nmol/L, DEX increased 3b-HSD and StAR protein mRNA levels in H295R cells (human adrenal cortical cell line), and this effect seems to be mediated through the functional Stat5 response element (Feltus et al. 1999). Moreover, erythropoietin has also been shown to influence the expression of specific genes in immature rat Leydig cells, as well as in Leydig tumour cell lines, through the activation of Stat5 (Yamazaki et al. 2004). Furthermore, Chandran et al. (1999) provided evidence that glucocorticoid-repressible transcription of the gonadotropin-releasing hormone gene is mediated through a multiprotein complex in which GR does not directly bind to the negative regulatory region, but rather, is tethered to DNA bound octamer binding protein (oct-1). Thus, it is obvious from the available reports that glucocorticoids have tissue-specific positive or negative effects on the expression of genes. The exact mechanism by which GR executes these opposite effects in different tissues is unknown. In view of the lack of information on the presence of GRE in the promoter regions of 3b- and 17b-HSD genes, and based on the existing reports, we suggest that corticosterone impairs the mRNA expression of 3b-HSD type I and 17b-HSD type III in Leydig cells, although the exact mechanism by which it does so remains unclear. Further investigations of these lines would be of great interest.

Biochem. Cell Biol. Vol. 84, 2006

Collectively, the results of the present study reveal that one of the molecular mechanisms that mediates the inhibitory effects of corticosterone on Leydig cell steroidogenesis is the defective expression of 3b- and 17b-HSD mRNA. Furthermore, the present study shows that corticosterone has a direct genomic effect in rat Leydig cells, since the expression of 3b- and 17b-HSD genes is impaired.

Acknowledgement The financial assistance from the Department of Science and Technology, New Delhi DST-FIST, UGC-SAP-DRS, and UGC-ASIST programmes is gratefully acknowledged.

References Adler, S., Waterman, M.L., He, X., and Rosenfeld, M.G. 1988. Steroid receptor-mediated inhibition of rat prolactin gene expression does not require the receptor DNA binding domain. Cell, 52: 685–695. doi:10.1016/0092-8674(88)90406-0. PMID:3345568. Agular, B.M., and Vind, C. 1995. Effects of dexamethasone on steroidogenesis in Leydig cells from rats of different ages. J. Steroid Biochem. Mol. Biol. 54: 75–81. PMID:7632619. Akinbami, M.A., Philip, G.H., Sridaran, R., Mahesh, V.B., and Mann, D.R. 1999. Expression of mRNA and proteins for testicular steroidogenic enzymes and brain and pituitary mRNA for glutamate receptors in rats exposed to immobilization stress. J. Steroid Biochem. Mol. Biol. 70: 143–149. PMID:10622402. Aldred, L.F., and Cooke, B.A. 1983. The effect of cell damage on the density and steroidogenic capacity of rat testis Leydig cells, using an NADH exclusion test for determination of viability. J. Steroid Biochem. 18: 411–414. doi:10.1016/0022-4731(83) 90059-6. PMID:6572768. Balasubramanian, K., Michael Aruldhas, M., and Govindarajulu, P. 1987. Effects of corticosterone on rat epididymal lipids. J. Androl. 8: 69–73. PMID:3583909. Barkey, R.J., Weiss-Messer, E., Mandel, S., Gahnem, F., and Amit, T. 1987. Prolactin and antiprolactin receptor antibody inhibit steroidogenesis by purified rat Leydig cells in culture. Mol. Cell. Endocrinol. 52: 71–80. doi:10.1016/0303-7207(87)90098-0. PMID:3622921. Bergmeyer, M.U. 1974. Steroid dehydrogenases. In Methods of enzymatic analysis. Edited by M.U. Bergmeyer. Academic Press, New York. pp. 476–47. Berwaer, M., Monget, P., Peers, B., Mathy-Hartert, M., Bellefroid, E., Davis, J.R., Belayew, A., and Martial, J.A. 1991. Multihormonal regulation of the human prolactin gene expression from 5000 bp of its upstream sequence. Mol. Cell. Endocrinol. 80: 53–64. doi:10.1016/0303-7207(91)90142-F. PMID:1955081. Blanco, F.L., Fanjul, L.F., and Ruiz de Galarreta, C.M. 1981. The effect of insulin and luteinizing hormone treatment on serum concentrations of testosterone and dihydrotestosterone and testicular 3 beta-hydroxysteroid dehydrogenase activity in intact and hypophysectomized rat. Endocrinology, 109: 1248–1253. PMID:7026221. Boruk, M., Savory, J.G., and Hache, R.J. 1998. AF-2-dependent potentiation of CCAAT enhancer binding protein beta-mediated transcriptional activation by glucocorticoid receptor. Mol. Endocrinol. 12: 1749–1763. doi:10.1210/me.12.11.1749. PMID:9817600. Buren, J., Liu, H.X., Jensen, J., and Eriksson, J.W. 2002. Dexamethasone impairs insulin signaling and glucose transport by depletion of insulin receptor substrate-1, phosphatidylinositol 3kinase and protein kinase B in primary cultured rat adipocytes. #

2006 NRC Canada

Badrinarayanan et al. Eur. J. Endocrinol. 146: 419–429. doi:10.1530/eje.0.1460419. PMID:11888850. Catargi, B., Rigalleau, V., Poussin, A., Ronci-Chaix, N., Bex, V., Vergnot, V., et al. 2003. Occult Cushing’s syndrome in type-2 diabetes. J. Clin. Endocrinol. Metab. 88: 5808–5813. doi:10.1210/jc. 2003-030254. PMID:14671173. Chandran, U.R., Warren, B.S., Baumann, C.T., Hager, G.L., and DeFranco, D.B. 1999. The glucocorticoid receptor is tethered to DNA-bound Oct-1 at the mouse gonadotropin-releasing hormone distal negative glucocorticoid response element. J. Biol. Chem. 274: 2372–2378. doi:10.1074/jbc.274.4.2372. PMID:9891005. Chang, T.J., Scher, B.M., Waxman, S., and Scher, W. 1993. Inhibition of mouse GATA-1 function by the glucocorticoid receptor: possible mechanism of steroid inhibition of erythroleukemia cell differentiation. Mol. Endocrinol. 7: 528–542. doi:10.1210/me.7. 4.528. PMID:8502237. Chomczynski, P., and Sacchi, N. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: 156–159. doi:10.1016/00032697(87)90021-2. PMID:2440339. De Pirro, R., Green, A., Kao, M.Y., and Olefsky, J.M. 1981. Effects of prednisolone and dexamethasone in vivo and in vitro: studies of insulin binding, deoxyglucose uptake and glucose oxidation in rat adipocytes. Diabetologia, 21: 149–153. PMID:7021286. Deyashiki, Y., Ohshima, K., Nakanishi, M., Sato, K., Matsumura, K., and Hara, A. 1995. Molecular cloning and characterization of mouse estradiol 17b-dehydrogenase (A-specific), a member of the aldoketoreductase family. J. Biol. Chem. 270: 10461–10467. PMID:7737980. Dubey, A.K., and Plant, T.M. 1985. A suppression of gonadotropin secretion by cortisol in castrated male rhesus monkeys (Macaca mulatta) mediated by the interruption of hypothalamic gonadotropin-releasing hormone release. Biol. Reprod. 33: 423–431. doi:10.1095/biolreprod33.2.423. PMID:3929850. Evain, D., Morera, A.M., and Saez, J.M. 1976. Glucocorticoid receptors in interstitial cells of the rat testis. J. Steroid Biochem. 7: 1135–1139. doi:10.1016/0022-4731(76)90045-5. PMID:1025359. Feltus, F.A., Cote, S., Simard, J., Gingras, S., Kovacs, W.J., Nicholson, W.E., Clark, B.J., and Melner, M.H. 2002. Glucocorticoids enhance activation of the human type II 3beta-hydroxysteroid dehydrogenase/Delta5-Delta4 isomerase gene. J. Steroid Biochem. Mol. Biol. 82: 55–63. doi:10.1016/S0960-0760(02) 00147-4. PMID:12429139. Feltus, F.A., Groner, B., and Melner, M.H. 1999. Stat5-mediated regulation of the human type-II 3b-hydroxysteroid dehydrogenase/delta5–delta4 isomerase gene: activation by prolactin. Mol. Endocrinol. 13: 1084–1093. doi:10.1210/me.13.7.1084. PMID:10406460. Geissler, W.M., Davis, D.L., Wu, L., Bradshaw, K.D., Patel, S., Mendonca, B.B., et al. 1994. Male pseudohermaphroditism caused by mutations of testicular 17b-hydroxysteroid dehydrogenase 3. Nat. Genet. 7: 34–39. doi:10.1038/ng0594-34. PMID:8075637. Gunasekar, P.G., Kumaran, B., and Govindarajulu, P. 1988. Prolactin and Leydig cell steroidogenic enzymes in the bonnet monkey (Macaca radiata). Int. J. Androl. 11: 53–59. PMID:2833448. Hales, D.B., and Payne, A.H. 1989. Glucocorticoid-mediated repression of P450scc mRNA and de novo synthesis in cultured Leydig cells. Endocrinology, 124: 2099–2104. PMID:2539967. Horiba, N. 1997. Sexual and gonadal dysfunction in adrenal disorders. Nippon Rinsho, 55: 2979–2984. PMID:9396299. Hu, X., Li, Y., and Lazar, M.A. 2001. Determinants of CoRNRdependent repression complex assembly on nuclear hormone

753 receptors. Mol. Cell. Biol. 21: 1747–1758. doi:10.1128/MCB. 21.5.1747-1758.2001. PMID:11238912. Imai, E., Miner, J.N., Mitchell, J.A., Yamamoto, K.R., and Granner, D.K. 1993. Glucocorticoid receptor-cAMP response element-binding protein interaction and the response of the phosphoenolpyruvate carboxykinase gene to glucocorticoids. J. Biol. Chem. 268: 5353–5356. PMID:8449898. Kavitha, T.S., Parthasarathy, C., Sivakumar, R., Badrinarayanan, R., and Balasubramanian, K. 2006. Effects of excess corticosterone on NADPH generating enzymes and glucose oxidation in Leydig cells of adult rats. Hum. Exp. Toxicol. 25: 119–125. doi:10.1191/0960327106ht591oa. PMID:16634330. Khanum, A., Buczko, E., and Dufau, M.L. 1997. Essential role of adenosine triphosphate in activation of 17b-hydroxysteroid dehydrogenase in the rat Leydig cell. Endocrinology, 138: 1612–1620. doi:10.1210/en.138.4.1612. PMID:9075722. Labrie, F., Simard, J., Luu-The, V., Pelletier, G., Belghmi, K., and Belanger, A. 1994. Structure, regulation and role of 3bhydroxysteroid dehydrogenase, 17b-hydroxysteroid dehydrogenase and aromatase enzymes in the formation of sex steroids in classical and peripheral intracrine tissues. Baillieres Clin. Endocrinol. Metab. 8: 451–474. doi:10.1016/S0950-351X(05) 80261-7. PMID:8092980. Lim, K., Yoon, S.J., Lee, M.S., Byun, S.H., Kweon, G.R., Kwak, S.T., and Hwang, B.D. 1996. Glucocorticoid regulation of androgen binding protein expression in primary Sertoli cell cultures from rats. Biochem. Biophys. Res. Commun. 218: 490–494. doi:10.1006/bbrc.1996.0087. PMID:8561783. Luu-The, V., Labrie, C., Simard, J., Lachance, Y., Zhao, H.F., Couet, J., Leblanc, G., and Labrie, F. 1990. Structure of two in tandem human 17b-hydroxysteroid dehydrogenase genes. Mol. Endocrinol. 4: 268–275. PMID:2330005. MacAdams, M.R., White, R.H., and Chips, B.E. 1986. Reduction of serum testosterone levels during chronic glucocorticoid therapy. Ann. Intern. Med. 104: 648–651. PMID:3083749. Maric, D., Kostic, T., and Kovacevic, R. 1996. Effects of acute and chronic immobilization stress on rat Leydig cell steroidogenesis. J. Steroid Biochem. Mol. Biol. 58: 351–355. doi:10.1016/ 0960-0760(96)00044-1. PMID:8836169. Mason, J.I., Naville, D., Evans, B.W., and Thomas, J.L. 1998. Functional activity of 3beta-hydroxysteroid dehydrogenase/ isomerase. Endocr. Res. 24: 549–557. PMID:9888536. McKenna, T.J., Lorber, D., Lacroix, A., and Rabin, D. 1979. Testicular activity in Cushing’s disease. Acta Endocrinol. (Copenh.), 91: 501–510. PMID:382726. Mindnich, R., Moller, G., and Adamski, J. 2004. At the Cutting Edge: The role of 17-beta-hydroxysteroid dehydrogenases. Mol. Cell. Endocrinol. 218: 7–20. doi:10.1016/j.mce.2003.12.006. PMID:15130507. Monder, C., Sakai, R.R., Blanchard, R.J., Blanchard, D.C., Lakshmi, V., Phillips, D.M., and Hardy, M.P. 1992. The mediation of testicular function by 11b-hydroxysteroid dehydrogenase. In Stress and reproduction. Edited by K.I. Sheppard, J.H. Boublick, and J.W. Funder. Raven Press, New York. pp. 145–155. Nalda, A.M., Martial, J.A., and Muller, M. 1997. The glucocorticoid receptor inhibits the human prolactin gene expression by interference with Pit-1 activity. Mol. Cell. Endocrinol. 134: 129–137. doi:10.1016/S0303-7207(97)00176-7. PMID:9426156. Newton, R. 2000. Molecular mechanisms of glucocorticoid action: what is important? Thorax, 55: 603–613. doi:10.1136/ thorax.55.7.603. PMID:10856322. Oaks, M.K., and Raff, H. 1995. Differentiation of the expression of aldosterone synthase and 11 beta-hydroxylase mRNA in the rat adrenal cortex by reverse transcriptase-polymerase chain reac#

2006 NRC Canada

754 tion. J. Steroid Biochem. Mol. Biol. 54: 193–199. doi:10.1016/ 0960-0760(95)00143-N. PMID:7577700. Olswang, Y., Blum, B., Cassuto, H., Cohen, H., Biberman, Y., Hanson, R.W., and Reshef, L. 2003. Glucocorticoids repress transcription of phosphoenolpyruvate carboxykinase (GTP) gene in adipocytes by inhibiting its C/EBP-mediated activation. J. Biol. Chem. 278: 12929–12936. doi:10.1074/jbc.M300263200. PMID:12560325. Orr, T.E., Taylor, M.F., Bhattacharya, A.K., Collins, D.C., and Mann, D.R. 1994. Acute immobilization stress disrupts testicular steroidogenesis in adult rat by inhibiting the activities of 17ahydroxylase and 17,20-lyase without affecting the binding of LH/hCG receptors. J. Androl. 15: 302–308. PMID:7982797. Payne, A.H., and Sha, L.L. 1991. Multiple mechanisms for regulation of 3 beta-hydroxysteroid dehydrogenase/delta 5-delta 4isomerase, 17 alpha-hydroxylase/C17–20 lyase cytochrome P450, and cholesterol side-chain cleavage cytochrome P450 messenger ribonucleic acid levels in primary cultures of mouse Leydig cells. Endocrinology, 129: 1429–1435. PMID:1874181. Peltoketo, H., Luu-The, V., Simard, J., and Adamski, J. 1999. 17bHydroxysteroid dehydrogenase (HSD)/17-ketosteroid reductase (KSR) family; nomenclature and main characteristics of the 17HSD/KSR enzymes. J. Mol. Endocrinol. 23: 1–11. doi:10. 1677/jme.0.0230001. PMID:10431140. Penning, T.M. 1997. Molecular endocrinology of hydroxysteroid dehydrogenases. Endocr. Rev. 18: 281–305. doi:10.1210/er.18.3. 281. PMID:9183566. Rigaudiere, N., Loubassou, S., Grizard, G., and Boucher, D. 1988. Characterization of insulin binding and comparative action of insulin and insulin-like growth factor I on purified Leydig cells from the adult rat. Int. J. Androl. 11: 165–178. PMID:3286525. Rosen, H., Jameel, M.L., and Barkan, M.L. 1988. Dexamethasone suppresses gonadotropin-releasing hormone (GnRH) secretion and has direct pituitary effects in male rats: differential regulation of GnRH receptor and gonadotropin responses to GnRH. Endocrinology, 122: 2873–2880. PMID:2836177. Sakaue, M., Ishimura, R., Kurosawa, S., Fukuzawa, N.H., Kurohmaru, M., Hayashi, Y., Tohyama, C., and Ohsako, S. 2002. Administration of estradiol-3-benzoate down-regulates the expression of testicular steroidogenic enzyme genes for testosterone production in the adult rat. J. Vet. Med. Sci. 64: 107–113. doi:10.1292/jvms.64.107. PMID:11913545. Sanchez, R., Rheaume, E., Laflamme, N., Rosenfield, R.L., Labrie, F., and Simard, J. 1994. Detection and functional characterization of the novel missense mutation Y254D in type II 3bhydroxysteroid dehydrogenase (3bHSD) gene of a female patient with nonsalt-losing 3b-HSD deficiency. J. Clin. Endocrinol. Metab. 78: 561–567. doi:10.1210/jc.78.3.561. PMID:8126127. Sankar, B.R., Maran, R.R., Sivakumar, R., Govindarajulu, P., and Balasubramanian, K. 2000a. Chronic administration of corticosterone impairs LH signal transduction and steroidogenesis in rat Leydig cells. J. Steroid Biochem. Mol. Biol. 72: 155–162. doi:10.1016/S0960-0760(00)00019-4. PMID:10775807. Sankar, B.R., Maran, R.R., Sudha, S., Govindarajulu, P., and Balasubramanian, K. 2000b. Chronic corticosterone treatment impairs Leydig cell 11beta-hydroxysteroid dehydrogenase activity and LH-stimulated testosterone production. Horm. Metab. Res. 32: 142–146. PMID:10824710. Sapolsky, R.M. 1985. Stress-induced suppression of testicular function in the wild baboon: role of glucocorticoids. Endocrinology, 116: 2273–2278. PMID:2986942. Sato, K., and Watanabe, Y.G. 1998. Corticosteroids stimulate the

Biochem. Cell Biol. Vol. 84, 2006 differentiation of growth hormone cells but suppress that of prolactin cells in the fetal rat pituitary. Arch. Histol. Cytol. 61: 75–81. PMID:9557970. Shan, L.X., Zhu, L.J., Bardin, C.W., and Hardy, M.P. 1995. Quantitative analysis of androgen receptor messenger ribonucleic acid in developing Leydig cells and Sertoli cells by in situ hybridization. Endocrinology, 136: 3856–3862. doi:10.1210/en.136.9. 3856. PMID:7649092. Simard, J., de Launoit, Y., and Labrie, F. 1991. Characterization of the structure-activity relationships of rat types I and II 3bhydroxysteroid dehydrogenase/
5-
4 isomerase by site-directed mutagenesis and expression in HeLa cells. J. Biol. Chem. 266: 14842–14845. PMID:1831194. Stalker, A., Hermo, L., and Antakly, T. 1989. Covalent affinity labelling, radioautography and immunocytochemistry localize the glucocorticoid receptor in rat testicular Leydig cells. Am. J. Anat. 186: 369–377. doi:10.1002/aja.1001860406. PMID:2589221. Subramaniam, N., Cairns, W., and Okret, S. 1998. Glucocorticoids repress transcription from a negative glucocorticoid response element recognized by two homeodomain-containing proteins, Pbx and Oct-1. J. Biol. Chem. 273: 23567–23574. doi:10.1074/ jbc.273.36.23567. PMID:9722596. Sudha, S., Valli, G., Julie, P.M., Arunakaran, J., Govindarajulu, P., and Balasubramanian, K. 2000. Influence of streptozotocin-induced diabetes and insulin treatment on the pituitary–testicular axis during sexual maturation in rats. Exp. Clin. Endocrinol. Diabetes 108: 14–20. PMID:10768827. Tang, P.Z., Tsai-Morris, C.H., and Dufau, M.L. 1998. Regulation of 3b-hydroxysteroid dehydrogenase in gonadotropin-induced steroidogenic desensitization of Leydig cells. Endocrinology, 139: 4496–4505. doi:10.1210/en.139.11.4496. PMID:9794458. Taylor, A.D., Cowell, A., Flower, R.J., and Buckingham, J.C. 1995. Dexamethasone suppresses the release of prolactin from the rat anterior pituitary gland by lipocortin 1 dependent and independent mechanisms. Neuroendocrinology, 62: 530–542. PMID:8559285. Tsai, M.J., and O’Malley, B.W. 1994. Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu. Rev. Biochem. 63: 451–486. doi:10.1146/annurev.bi.63.070194. 002315. PMID:7979245. Tsai-Morris, C.H., Khanum, A., Tang, P.Z., and Dufau, M.L. 1999. The rat 17b-hydroxysteroid dehydrogenase type-III: molecular cloning and gonadotropin regulation. Endocrinology, 140: 3534–3542. doi:10.1210/en.140.8.3534. PMID:10433209. Veldhuis, J.D., Lizarralde, G., and Iranmanesh, A. 1992. Divergent effects of short term glucocorticoid excess on the gonadotropic and somatotropic axes in normal men. J. Clin. Endocrinol. Metab. 74: 96–102. doi:10.1210/jc.74.1.96. PMID:1727834. Yamazaki, T., Kanzaki, M., Kamidono, S., and Fujisawa, M. 2004. Effect of erythropoietin on Leydig cell is associated with the activation of Stat5 pathway. Mol. Cell. Endocrinol. 213: 193–198. doi:10.1016/j.mce.2003.10.031. PMID:15062567. Yang-Yen, H.F., Chambard, J.C., Sun, Y.L., Smeal, T., Schmidt, T.J., Drouin, J., and Karin, M. 1990. Transcriptional interference between c-Jun and the glucocorticoid receptor: mutual inhibition of DNA binding due to direct protein-protein interaction. Cell, 62: 1205–1215. PMID:2169352. Zhao, H.F., Labrie, C., Simard, J., de Launoit, Y., Trudel, C., Martel, C., et al. 1991. Characterization of rat 3b-hydroxysteroid dehydrogenase/
5-
4 isomerase cDNAs and differential tissuespecific expression of the corresponding mRNAs in steroidogenic and peripheral tissues. J. Biol. Chem. 266: 583–593. PMID:1985917.

#

2006 NRC Canada