Electronic Journal of Plant Breeding, 1(4): 360-369 (July 2010)

Research Article

Cotton transgenics with Antisense AC1 gene for resistance against cotton leaf curl virus J.Amudha, G.Balasubramani, V.G.Malathi, D.Monga, K.C.Bansal and K.R.Kranthi

Abstract: Cotton leaf curl virus is a devastating pest in the North India and in small pockets of Southern states. Cotton leaf curl disease (CLCuD) is caused by a Geminivirus, transmitted by whitefly Bemisia tabaci vector. This is a serious problem in the northern region and leads to yield losses up to 58% and 69% (ICAC recorder, 1999). Genetic engineering for cotton transgenics resistant to leaf curl disease (CLCuD) through antisense RNA approach is potential to tackle the disease in cotton. Cotton transgenics resistant to leaf curl disease (CLCuD) using Antisense (rep) (Replicase protein) gene was developed via Agrobacterium mediated transformation. A binary vector carrying the Antisense rep gene along with the npt II (neomycin phospho transferase) gene driven by CaMV-35S promoter and NOS (nopaline synthase) terminator was used for transformation. The confirmation of the rep and npt II genes in the transgenic plants were verified by PCR and integration of T-DNA into the plant genome was confirmed by Southern analysis. The individual transgenics were raised in the green house and screened for the virus resistance. T2 progeny analysis showed classical Mendelian pattern of inheritance. Key words: Antisense RNA based resistance, Cotton leaf curl virus, rep, npt II, Agrobacterium mediated transformation, G.hirsutum.

Introduction Genetic engineering has the potential to improve the insect and pest management in cotton. A number of genes with potential to confer insect resistance have been introduced through Agrobacterium or by particle bombardment or by a combination of both the methods (Firoozabady et al., 1987; Perlack et al., 1990; McCabe and Martinall, 1993; Rajasekharan et al., 1996; Zapata et al., 1999). The concept of pathogen derived resistance (PDR) (Sanford and Johnston 1985 ) is an effective means of producing virusresistant plants and can be used for a number of different plant virus groups with various viral genes (Powell-Abel et al.,1986; Lomonossoff, 1995; Fuchs and Gonsalves,1997;Varma et al., 2002; Verma et al., 2003). Resistance to plant viruses can be conferred either by expressing part of the viral genome producing the protein (protein-mediated) Central Institute for Cotton Research, Post Box No:2, Shankar Nagar(PO),Nagpur,440 010 Maharashtra,India, Email:[email protected]

which confers resistance to broad range of virus strains and viruses. Viral gene usage as PDR have revealed lack of correlation between transgenic protein expression level and the level of resistance ( Stark and Beachy,1989; Golemboski et al.,1990) suggesting the protein was not essential for resistance. Whereas high level of specific virus resistance through accumulation of viral nucleic acid sequences (RNA-mediated) provides very high levels of specific virus resistance (Beachy, 1997; Baulcombe, 1996; Boogart et al., 1998). RNAmediated resistance interpreted as an example of homology-dependent gene silencing (Flavell, 1994; Dougherty and Parks, 1995). First RNA-mediated resistance blocking the expression of the replicase (rep) gene by Antisense gene constructs was reported by Linbo and Dougherty, (1992) and Smith et al., (1994). AC1 (rep gene) in Begomoviruses (monopartite or bipartite) encodes a multifunctional protein, which is localized in the nucleus of the infected plants, where it plays a key role in the regulation

360

Electronic Journal of Plant Breeding, 1(4): 360-369 (July 2010)

of replication and transcription of viral DNA (Luafs et al. 1995). Rep is a sequence and strand specific endonuclease/helicase/ATPase/ligase that generates the circular viral ssDNA monomers by rolling circle replication from a double stranded replicative form intermediate at a cis-essential origin mapping next to the rep gene (Hanley-Bowdoin et al. 1999; Orozeo et al. 2000). This is a viral protein indispensable for DNA synthesis, which initiates this process by introducing a nick at the origin of replication. The interaction of Rep protein with the viral DNA sequences is well characterized. Rep protein interacts specifically with sequences in the common region (CR) that is conserved between the two genome components, near the sequence involved in the transcription of complementary sense genes encoding BC1 protein and the AC1 protein itself with the viral replication enhancer protein (REn), and plant retinoblastoma homologues, a cell cycle regulatory protein (Kong et al. 2000). The product of Rep gene auto-suppresses its own expression by binding to a sequence between the TATA box of the Rep promoter and the Rep transcription initiation site. The N-terminal region of the Rep gene mediates this binding (Hanley-Bowdoin et al. 1999). Antisense based resistance transgenics have better potential with DNA viruses that transcribe their genome into mRNA in the nuclei (Narayanaswamy and Savithri; 2003). Genetic transformation of cotton has been reported as genotype independent tissue culture methods were followed by several authors (Sunilkumar and Rathore,2001).We have adopted Agrobacterium mediated method of transformation for development of transgenic cotton in the present investigation. Materials and Methods: Seeds of cotton variety F 846 were obtained from Central Institute for Cotton Research (Regional Station), Sirsa, Haryana, India. Transformation system: Agrobacterium tumefaciens strain EHA 105 harboring a binary plasmid pBin AR with antisense rep gene and npt II gene as selection marker in the T-DNA driven by Cauliflower mosaic virus (35S CaMV) promoter and NOSterminator was used as vector system for transformation (Fig 1). Bacteria were maintained on YEMA medium (1.0% w/v Yeast extract,

Mannitol 1.0%w/v, 0.1%w/v Sodium chloride, 0.2% w/v magnesium sulphate, pH-7.0) containing 50mg/l kanamycin and 25mg/l rifampicin. For inoculation, one single colony was grown overnight on liquid YEMA at 28ºC with appropriate antibiotics. Transformation of cotton plants: Cotton variety F 846 seedlings were raised aseptically on half- Murashige and Skoog[1962] (MS) medium. The embryonic axes were excised and trimmed from both the sides and used for cocultivation with A.tumefaciens. The explants were co-cultivated in the half-MS liquid medium with actively growing culture of A.tumefaciens at 1.0 OD and 100mM acetosyringone. After overnight of co-cultivation, shoots were decontaminated in the half MS medium containing cefotaxime 250 mg/l. The explants were then transferred to selection medium containing kinetin 0.1mg/l, BAP 0.1 mg/1 and kanamycin 50 mg/l. The kanamycin resistant shoot were sub-cultured in a media containing 0.1 mg/l BAP 0.1 mg/l for root induction. Rooted plants were rinsed well and transferred to pots containing peat, soil and sand in 1:1:1 ratio. Plants were covered with plastic bags and then to a pot with soil for hardening for 15 days before transferring to the greenhouse under natural condition. The seeds were harvested and the T1 plants were raised in the green house. Screening for transformed plants using PCR: Genomic DNA was isolated as described by Paterson et al., (1993) from the young leaves of T0 plants grown in the polyhouse. PCR amplification of the rep and npt II gene using specific primers was carried out to check the presence of the transgenes, the rep specific primer sequences (5’-3’) ATGCCACGTGATTTAAAAACA and GTGGGGAGAGTTTCAGATCG and npt II specific primer GAGGCTAATTCGGCTATGACTG and ATCGGGAGAGGCGAT ACCGTA. PCR was performed in 20µl (total volume) reaction mixture containing 100ng DNA, 10X reaction buffer, 10mM dNTPs, 100ng of each primer, 25mM MgCl2 and 1U of Taq DNA polymerase. The following conditions 94ºC for 5min, then 35 cycles of 94ºC for 30sec, 56ºC for 1min,72ºC for 1 min and 5 min for final extension at 72ºC. Amplicons were electrophoresed on 1% w/v

361

Electronic Journal of Plant Breeding, 1(4): 360-369 (July 2010)

agarose and detected by ethidium bromide staining. Southern hybridization of transformed plants: The confirmation of gene integration in the transgenic plants was performed in T0 plants by Southern blotting method (Sambrook et al.,1989). Genomic DNA was isolated from the leaves of the T0 plants. For Southern hybridization 10µg of total genomic DNA from the putative transgenics was digested with Eco RI and Hind III resolved by 0.8% agarose gel electrophoresis. The probe rep gene was labeled with non radioactive DIG labeling kit from Roche, Germany. Results: Plant transformation and regeneration: Embryonic axes measuring about 5-10 mm from 2-3 day old cotyledons were trimmed and used for co-cultivation. A total of 685 embryonic axes explants from the 2 -3 day old cotyledons were co-cultivated and selected using kanamycin 50 mg/l as selection agent which allows only the transformants to grow(Fig 2a). The shoot induction was observed after 10 -15 days in the shoot induction medium (Fig 2b). The putatively transformed shoots were sub-cultured twice in the shooting medium and then transferred to rooting medium after shoots attained a height of 5-6 cm (Fig 2c). Rooted plants were rinsed well and transferred to pots containing peat, soil and sand in 1:1:1 ratio (Fig 2d). T1 plants are grown in the green house (Fig 2e). Molecular analysis of transformants: The genomic DNA of the T0 plants were tested for the presence or absence of the npt II gene by specific primers said above by PCR (Fig 3) produced 700bp amplicon. Presence of rep gene was also confirmed by amplifying the gene with the specific primer and the expected 540bp segment was observed (Fig 4). PCR positive T0 plants were further analyzed for the integration of the gene into the plant genome by Southern blot hybridization. Southern hybridization was carried out to confirm the integration of the transgene in the T2 generation with the rep gene probe. The non radioactive dig-labelled rep gene was hybridized with Eco RI and Hind III digested genomic DNA. The blot after washing showed the integration of the gene in the transgenic T1 plants (Fig 5) and no band was

seen in the control. PCR analysis of 56 T2 plants revealed 18 plants for the presence of the gene integration which fits in Mendelian ratio 3:1 of segregation and λ2 value at 1df on 5% level of significance is 0.5. Viruliferous whitefly screening: Individual transgenic events were screened with viruliferous whiteflies (24 hour after acquisition period). The transgenic plants were under screening for one month and they were observed for the disease symptom. The resistant transgenics did not show any symptom and were maintained in the greenhouse. Point of integration of rep gene in the cotton genome To determine the integration of the rep gene in the cotton genome was carried by Chromous Biotech Pvt Ltd, Bangalore as follows. The genomic DNA was isolated from the cotton leaves provided using Plant genomic DNA minispin Kit. The genomic DNA was digested with Hind III and Pst I restriction endonuclease. The digested DNA was ligated to pUC vector digested with same restriction endonuclease enzyme. Using proprietary PCR technique the genome fragment that comprised of rep gene was amplified. The amplification primer used had flanking Hind III and Pst I restriction site. The amplified gene was cloned into pUC18 digested with Hind III and Pst I restriction sites. The clones were sequenced and from the sequence data point of integration was determined. Aligning the sequence data using NCBI BLAST it was found that the rep gene has integrated into Gossypium hirsutum retrotransposon putative copia. (gb|EF457753.1) Gossypium hirsutum retrotransposon putative copia, transposon GORGE3-like, retrotransposon putative gypsy, and transposon putative MuDR, complete sequence; alcohol dehydrogenase A gene, complete cds; transposon copia-like and myosin pseudogene, complete sequence; putative FADdependent oxidoreductase and putative protein disulfide isomerase genes, complete cds; retrotransposon, complete sequence; putative integral membrane protein gene, complete cds; retrotransposon putative gypsy, complete sequence; putative caffeic acid methyltransferase gene, complete cds; transposons, retrotransposons putative gypsy, and transposon, complete sequence; putative caffeic acid methyltransferase gene, complete cds;

362

Electronic Journal of Plant Breeding, 1(4): 360-369 (July 2010)

transposon, complete sequence; and photosystem II protein gene, partial cds. Discussion: Regeneration of cotton and introduction of foreign genes is genotype specific nature.Our methodology is genotype independent. Coker genotypes, which are amenable for regeneration invitro by somatic embryogenesis, are widely used in genetic transformation experiments (Umbeck et al., 1987; Finer and McMullen, 1990; Chaudhary et al., 2004; Gould and Magallanes-Cedeno 1998). Limited success has been obtained with shoot meristems till recently by other with low transformation protocol (McCabe and Martinell, 1993; Zapata et al., 1999; Satyavathi et al., 2002).Genotype independent producers to transform non-coker genotypes have been reported by Gizant and Weintraub (1984).Cotton transgenics with antisense AV2 gene for resistance against cotton leaf curl virus reported by Sanjaya et al., (2005) showed classical Mendelian pattern of inheritance. In this study we have developed successful introduction of rep gene through Agrobacterium mediated method.

with the rep gene will arrest the replication of the invading viral genome by targeting the complementary mRNA produced by the plant. Cotton transgenics obtained in the present study pave the way to develop virus resistance in a recalcitrant system like cotton.

Gemini viruses can cause significant yield losses and they accumulate in the plant cell nuclei where they replicate and develop disease. The antisense RNA technology was first reported by Gizant and Weintraub[1984] as the antisense RNA pairs with the complimentary target mRNA and would inhibit the expression of homologous genes by degrading the target mRNA and prevents translation. The rational of Antisense RNA technology leading to gene silencing, is formation of double stranded RNA from sense/antisense counterparts of endogenous/transgene segments, which initiates the surveillance system within plant, for degradation of transgene mRNA and target RNA (Waterhouse et al., 1995;Yang et al.,2004). Antisense RNA is actually a part of complex natural pathways for gene regulation by homology dependent gene silencing mechanisms where sense transcripts are able to silence gene expression (Asad et al., 2003).

Conclusion: Post-transcriptional gene silencing (PTGS) results in the degradation of RNA from host genes and homologous transgene after transcription in nucleus. Several models have been postulated to explain, observed gene silencing phenomenon, which includes the involvement of antisense RNA(Waterhouse et al., 1998), cosuppression (Palauqui and Vaucheret., 1998) and RNA interference (Susi et al., 2004). Our experiment agrees with most of the strategies for genetically engineered resistance to begomoviruses has involved replication-associated protein. Studies have focused on using partial, entire, sense antisense or mutated begomovirus rep gene (Noris et al .,1996; Bendahmane and Gronenborn, 1997; Yang et al., 2004).The original rationale of antisense RNA technology (Gizant and Weintraub, 1984), leading to gene silencing, presents an effective mechanism against viruses (reviewed by Wassengger 2002). There have been a number of models proposed for induction and operation of gene silencing involved with antisense strategies. In most models it was demonstrated that by pairing with a complementary targeted RNA, the antisense RNA would inhibit expression of homologous gene by preventing translation or promoting degradation of targeting RNA (Fuchs and Gonsalves, 1997; Waterhouse et al., 1998).The antisense rep gene of CLCuV would in principle block the viral rep gene expression either by preventing translation or through homology dependent degradation of target viral RNA (Praveen et al., 2005). The resistance to leaf curl disease demonstrated in this study, with the antisense rep gene construct has antisense RNAmediated that inhibits the expression of sense gene by pairing and leading to the degradation of targeting RNA, which is in agreement with the studies of Yang et al (2004).

The monopartite begomovirus cotton leaf curl virus has DNA A and DNA ß. DNA A codes for AV 1 (CP), AV2 (MP), AC 1 and AC 4 (Rep), AC 2 (TrAP), AC 3 (REn). Transgenic plant

To explain our results, the corner stone of our model is gene silencing, induced by formation of duplex RNA with sense (viral origin) and antisense (transgene), result in recovery of virus-

363

Electronic Journal of Plant Breeding, 1(4): 360-369 (July 2010)

infected plants. For cotton leaf curl virus diaease (CLCuD) an antisense approach seems to have better potential to get specific resistance. The CLCuD has only one molecule of a single stranded DNA, DNA-A which codes for two proteins, AV1 or coat protein, AV2 or movement protein in the sense orientation and four proteins AC1, AC2, AC3 and AC4 in antisense orientation and lacks the DNA-B component (Zhou et al., 1998). Thus the function of DNA-B coded proteins namely BV1 (involved in transport of viral DNA into out of nucleus) and BC1 (involved in cell to cell movement) are performed by the coat protein (CP) AV1 and the movement protein AV2 respectively, in these monopartite Begomoviruses. Thus antisense RNA to AC1 will form duplex RNA with sense (viral origin) and antisense (transgene) would disrupt the function the gene. Therefore viral replication, movement and encapsidation will be affected. Transgenic plants expressing antisense replicase protein gene (AC1) developed in the present investigation could result in the arrest of infection by interference with viral replication, movement and encapsidation. Acknowledgements: We acknowledge the Networking Project on Transgenics funded by Indian Council of Agricultural Research for financial support. Abbreviation : CP: Coat protein, MP: Movement protein, Rep:Replicase protein, REn: Replicase enhancer protein, TrAP : Transcription Active Protein References : Asad S, Haris WAA, Bashir A, Xafar Y, Malik KAA, Malik NN & Lichtenstein CP, 2003. Transgenic tobacco expressing Gemini viral RNAs are resistant to the serious viral pathogen causing cotton leaf curl disease, Arch. Virol. 148. 2341-2352. Baulcombe DC, 1996. Mechanism of pathogenderived resistance to viruses in transgenic plants, Plant Cell. 8. 1833-1844. Beachy RN, 1997. Mechanisms and application of pathogen-derived resistance in transgenic plants,Curt. Opin. Biotech. 8. 215-220.

(TYLCV) using antisense RNA. Plant Mol. Biol.33:351-357. Boogart T V, Lomonosoff GP & Davis JW, 1998. Can we explain RNA mediated virus resistance by homology-dependent gene silencing?. Mol. Plant Microbe Interact. 11. 717-723. Chaudhary B, Kumar S, Prasad KVSK, Oinam GS, Burma BK & Pental D,2004. Slow desiccation leads to high-frequency shoot recovery from transformed somatic embryos of cotton (Gossypium hirsutum L. cv. Coker 310 FR), Plant Cell Rep.21 .955-960. Dougherty W D & Parks TD, 1995. Transgenes and gene suppression: telling us something new? Curr. Opin. Cell Biol. 7 .399-405. Finer JJ & McMullen MD, 1995. Transformation of cotton (Gossypium hirsutum L) via particle bombardment. Plant Cell Rep. 8 . 586-589. Firoozabady E, Deboer DL, Merlo DJ, Halk EL, Amerson LN, Rashka KE & Murray EE, 1987.Transformation of cotton (Gossypium hirsutum L.) by Agrobacterium tumefaciens and regeneration of transgenic plants, Plant Mol. Biol., 10. 105-116. Flavell RB, 1994. Inactivation of gene expression in plants as a consequence of specific sequence duplication, Proc. Natl. Acad. Sc. USA 91. 3490-3496. Fuchs M & Gonsalves D,1997. Environmentally safe approaches to crop disease control, Genetic Engieering. In: Rechcigl NA and Rechcigl JE(eds) Environmentally Safe Approaches to Crop Disease Control, Lewis publishers CRC press, Boca Raton, Florida. 333-368. Gizant & Weintraub H, 1984. Inhibition of thymidine kinase gene expression by Antisense RNA: a molecular approach to genetic analysis, Cell 36. 1007- 1015. Golemboski DB, Lomonosoff GB & Zaitlin M,1990. Plants transformed with tobacco mosaic virus non-structural gene sequence are resistant to the virus, Proc. Natl. Acad. Sci. USA. 87 .6311-6315. Gould JH & Magallanes-Cedeno M, 1998. Adaptation of cotton shoots apex culture to Agrobacterium - mediated ransformation, Plant Mol. Biol. Rep. 16. 1-10.

Bendahmane M & Gronenborn B,1997. Engineering resistance against tomato yellow leafcurl virus

364

Electronic Journal of Plant Breeding, 1(4): 360-369 (July 2010) Hanley-Bowdoin I, Settlage S B, Orozeo, B M, Nagar S, & Robertson D, 1999. Geminiviruses – Models for plant DNA replication, transcription and cell cycle regulation. Cri Rev Plant Sci. 18, 71-106 JKong, I. J, Orozeo, B. M., Roe, J. I., Nagar, S., Ou, S., Feiler, H. S., Durfee, T., Miller, A. B., Guissem, W., Robertson, D., and HanleyBowdoin, L., 2000. A Geminivirus replication protein interacts with the retinoblastoma protein through a novel domain to determine symptoms and tissue specificity of infection implants. EMBO J. 19, 3485-3495 Lindbo JA, Dougherty WG, 1992. Pathogen-derived resistance to a potyvirus: immune and resistant phenotypes in transgenic tobacco plants expressing altered forms of a poty virus coat protein nucleotide sequence, Mol. PlantMicrobe Interact. 5 .144-153. Lomonossoff GP,1995. Pathogen-derived resistace to plants viruses, Annu.Rev. Phylopathol. 33 323343. Luafs, J., Schumacher, S., Gcisler, N., Jupin, I. and Gronenborn, B,1995. Identification of the nicking tyrosine of Geminivirus Rep protein. FEBS letter 18, 2258-2262. McCabe DE & Martinell BJ, 1993. Transformation of elite cotton cultivars via particle bombardment of meristems. Bio/Technology. 11. 596-598. Murashige T & Skoog F, 1962. A revised medium for rapid growth and bioassay with tobacco tissue cultures. Physiol Plant. 15: 473-497.

Orozeo, B. M., Kong, L. J., Batts, L. A., Elledge, S., and Hanley-Bowdoin, L, 2000. The multifunctional character of a geminivirus replication protein is reflected by its complex oligomerization properties. J Biol Chem. 275, 6114-6122 Palauqui JC & Vaucheret H, 1998. Transgene are dispensable for the RNA degradation step of cosuppression. Plant Biol. 95(16):9675-9680. Paterson H,Brubaker CL & Wendel JF, 1993. A rapid method for extraction of cotton (Gossypium spp.) genomic DNA suitable for RFLP or PCR analysis, Plant Mol. Biol. Rep. 11.122-127. Perlak J, Deaton RW, Armstrong TA, Fuchs RL, Sims SR, Greenplate IT & Fischhoff DA, 1990. Insect resistant cotton plants, Bio/Technology 8. 939-943. Praveen S, Mishra AK & Dasgupta A,2005. Antisense suppression of replicase gene expression recovers tomato plants from leaf curl infection. Plant Sci.168:1011-1014. Powell-Abel P, Nelson RS, Hoffman N De B, Rogers SG, Fralley RT & Beachy RN, 1986. Delay of disease development in transgenic plants that express the tobacco mosaic coat protein gene, Science. 232. 138-143. Rajasekharan K, Grula JW, Hudspeth RL, Pofelis S & Anderson DM (1996) Herbicide-resistant Acala and Coker cottons transformed with a native gene encoding mutant forms of acetohydroxyacid syntase. Mol. Breed. 2: 307319.

Narayanaswamy K & Savithri HS, 2003. Genetially engineered resistance to plant virus. In: Singh RP and Jaiswal PK (eds) Plant Genetic Engineering: Applications and Limitations. Vol. 1. Plant Genetic Engineering; vol. 1. Applications and Limitations (pp. 61-85). Scitech Pub. LLC, USA.

Rishi N & Chauhan MS, 1994. Appearance of leaf curl disease of cotton in North India. J. Cotton Res. Dev. 8 .179-180.

Nateshan HM, Muniyappa V,Swanson MM & Harrison BD, 1996. Host range, vector relations and serological relationships of cotton leaf curl virus in South India, Ann. Appl. Biol. 126 233-244.

Sanford JC & Johnston SA, 1985. The concept of parasite derived resistance deriving resistance genes from the parasites own genome, J. Theor. Biol. 113. 395-405.

Noris E, Accotto G, Tavazza R, Brunetti A,Crespi S & Tavazza M,1996. Resistance to tomato yellow leaf curl geminivirus in Nicotiana benthamiana plants transformed with a truncated viral C1 gene.Virology.224:132-138.

Sambrook, Fritsch EF & Maniatis T, 1989. Molecular Cloning- A Laboratory Manual, Cold Spring Harbour Laboratory, New York, USA.

Sanjaya, Satyavathi VV, Prasad V, Kirthi N, Maiya SP, Savithri HS & Sita Lakshmi G, 2005. Development of cotton transgenics with antisense AV2 gene for resistance against cotton leaf curl virus (CLCuD) via Agrobacterium tumefaciens. Plant Cell Tiss Organ cult. 81:55-63.

365

Electronic Journal of Plant Breeding, 1(4): 360-369 (July 2010) Varma Satyavathi VV, Prasad V, Gita Lakshmi & Sita Lakshmi,2002.High efficiency transformation protocol for three Indian cotton varieties via Agrobacterium tumefaciens, Plant Sci. 62. 215223. Smith HA, Swaney SL, Parks TD, Wernsman EA & Dougherty WG,1994. Transgenic plant virus resistance mediated by untranslatable sense RNA: expression, regulation, and fate of nonessential RNAs, Plant Cell. 6.1441- 1453. Stark DM & Beachy RN,1989. Protection against potyvirus in transgenic plants; Evidence for broad-spectrum resistance, Bio/Technology. 7. 1257-1262. Sunilkumar G & Rathore KS, 2001. Transgenic cotton; factors influencing Agrobacteriummediated transformation and regeneration, Mol. Breed. 8 . 37-52. Susi P, Hohcuri M, Wahlroos T & Kilby NJ, 2004. Characteristics of RNA silencing in plants: similarities and differences across kingdoms. Plant Mol. Boil.54:157-174. Technical Information Section.1999.Cotton Leaf curl Disease: Losses and remedies, THE ICAC RECORDER, International Cotton Advisory Committee,Volume XVII, No.4, Dec. Umbeck P, Johnson G, Barton K & Swain W, 1987. Genetically transformed cotton (Gossypium hirsutum L.) plants, Bio/Technology. 5 . 263265.

A & Malathi VG,2003. Emerging geminiviruses problems: a serious threat to crop production, Ann. Appl. Biol. 142. 145164.

Varma A, Jain RK & Bhat A I,2002. Virus resistant transgenic plants for environmentally safe management of viral disease, Indian J. Biotechnol. 1.73-86. Waterhouse M & Graham MW, 1995. Virus resistance and gene silencing in plants can be induced by simultaneous expression of sense and antisence RNA. Proc. Natl. Acad. Sci. USA. : 1395913964. Wassengger M (2002) silencing.Int.Rev.Cytol.219:61-113.

Gene

Yang Y, Sherwood TA, Patte CP , Hiebert E & Polston JE, 2004. Use of tomato yellow leaf curl virus (TYLCV).Rep gene sequence to engineer TYLCV resistance in tomato. Phytopathology.94:490-496. Zapata Z, Park SH, EL-Zikand KM & Smith RH, 1999.Transformation of a Texas cotton cultivars by using Agrobacterium and the shoot apex, Theor. Appl. Genet. 98. 252-256. Zhou X,Liu Y,Robinson JD & Harrison BD,1998. Four DNA-A variants among Pakistan isolates of cotton leaf curl virus and their affinities to DNA-A and Gemini virus isolates from Okra.J.Gen.Virol.79:915-923.

366

Electronic Journal of Plant Breeding, 1(4): 360-369 (July 2010)

RB

Nos promoter

ECoRI Bam HI

Npt II

pAnos

CaMV 35S

ECoRI Bam HI LB

Rep gene pANos pAocs

Fig 1: Map of binary pBin AR carrying Antisense Rep gene

Fig 2a: Transformed shoots in the selection medium,2b: shoot induction,2c: rooting of the shoots,2d:hardening of the rooted plants,2e:Transgenic plants in the green house 2a 2b

2c

2d

367

Electronic Journal of Plant Breeding, 1(4): 360-369 (July 2010)

Fig 3: Electrophoresis analysis of PCR products of transgenic cotton plants showing the presence of expected 700bp fragment of npt II gene. 1

2

3

4

5

6

M

700bp

Lane 1: Positive control, 2 to 6 : Transformed plant DNA, M: 100 bp marker Fig 4: Electrophoretic analysis of PCR products of transgenic cotton plants showing the presence of expected 540 bp fragment of rep gene. 1

2

3

4

M

540bp

Lane 1-3 : Transformed plant DNA, 4: Lamda marker (Eco RI + Hind III digest) M: 100 bp marker,

368

Electronic Journal of Plant Breeding, 1(4): 360-369 (July 2010)

Fig 5: Southern blot analysis of To transgenic plants. Genomic DNA (10µg) was digested with Eco RI and Hind III hybridized with rep gene probe labeled with non-radioactive dig-labelling method. 1

2

3

4

5

6

kb 1.0 0.6 0.1

Lane 1&2: 100 bp ladder, Lane 3&4: individual transgenic plant genomic DNA, Lane 5: +ve Control , Lane 6: -ve Control

369