A Study of Human Mitochondrial Genome in Sulaimani Province
A THESIS SUBMITTED TO THE COUNCIL OF COLLEGE OF SCIENCE, UNIVERSITY OF SULAIMANI IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE IN GENERAL GENETICS
By Dlshad Abdullah Rashid B. Sc. In Biology - 2008 University of Sulaimani
Supervised By Dr. Farhad M. Barzinji Asst. Professor
April 2014
Gulan 2714
Supervisor’s certification
I certify that this thesis was prepared under my supervision at the university of Sulaimani, college of science and do hereby recommend it to be accepted as a partial fulfillment of the requirements for the degree of Master of Science in General Genetics.
Signature: Supervisor: Farhad M. Barzinji Scientific grade: Asst. Professor Date:
/
/ 2014
In view of the available recommendations, I forward the thesis for debate by the examining committee.
Signature: Name: Huner Hiwa Arif Chairman of Biology Department. Date:
/
/ 2014
Examining Committee Certification We certify that we have read this thesis entitled “A Study of Human Mitochondrial Genome in Sulaimani Province ”accomplished by (Dlshad Abdullah Rashid), and as Examining Committee, examined the student in its content and in connected with it, and in our opinion it meets the basic requirements toward the degree of Master of Science in General Genetics.
Signature:
Signature:
Name: Dr. Khidir M. Hawrami
Name: Dr. Gaza F. Salih
Scientific grade: Professor
Scientific grade: Asst. Professor
Date:
Date:
/
/ 2014
(Chairman)
/
/ 2014
(Member)
Signature:
Signature:
Name: Dr. Dlnya Asad Mohamad
Name: Dr. Farhad M. Barzinji
Scientific grade: Asst. Professor
Scientific grade: Asst. Professor
Date:
Date:
/
/ 2014
(Member)
/
/ 2014
(Supervisor-Member)
Approved by the Dean of the Faculty of Science. Signature: Name: Dr. Bakhtiar Q. Aziz Scientific grade: Professor Date:
/
/ 2014
(The Dean)
Linguistic Evaluation Certification
I hereby certify that this thesis has been read and checked and after indicating all the grammatical and spelling mistakes; the thesis was given again to the candidate to make the adequate correction. After the second reading, I found that the candidate corrected the indicated mistakes. Therefore, I certify that this thesis is free from mistakes.
Name: Ari Mohammed Abdulrahman Signature: Date:
/
/ 2014
English Department / College of Languages / Sulaimani University.
Dedication
This thesis is dedicated to all those who helped me to reach this stage
Acknowledgements “All praises to Allah the almighty, the most merciful, and the most gracious” I wish to express my sincere appreciation to my supervisor, Dr. Farhad M. Barzinji, for his guidance and support during the course of this research work. His assistance and suggestions were crucial in the realization of this work. I would like to especially thank Dr. Pola Xaneqa, Dr. Zhala Karim in Kurdistan Institution for Strategic Studies and Scientific Research in Sulaimani for giving me the opportunity to use their microbiology laboratory. I would like also to thank all staff members especially Dr. Noefl for their assistance and patience during the work. Thanks to Dr. Farhad M. Barzinji, manager of Microgene Diagnostic laboratory at Harem Private Hospital in Sulaimani, for allowing me to do part of my work in his laboratory and thanks are due to all staff members in the Laboratory. I would like to extend my thanks to the Deanery of College of Science and Biology Department for giving me admission into higher education and giving me an opportunity to study. I would like to acknowledge individuals who have helped me make my thesis undertaking much easier and successfully completed, I owe thanks to Mrs. Nyan, Mr. Blend and Mrs. Selar.
DLSHAD
ؤظ ووزةي وة ددةي وةىَ مَ ري وم م
م رواو َ اوة وةك مَ ي زام زامَ َ ري زام ي مَ دة طوةزام زام
ن را دد 2008 - دا سر مَ-مَ يزام رر رز ا وف در.د ةدةرر ريؤ
نم
ن
2014
2714
Acknowledgements “All praises to Allah the almighty, the most merciful, and the most gracious” I wish to express my sincere appreciation to my supervisor, Dr. Farhad M. Barzinji, for his guidance and support during the course of this research work. His assistance and suggestions were crucial in the realization of this work. I would like to especially thank Dr. Pola Xaneqa, Dr. Zhala Karim in Kurdistan Institution for Strategic Studies and Scientific Research in Sulaimani for giving me the opportunity to use their microbiology laboratory. I would like also to thank all staff members especially Dr. Noefl for their assistance and patience during the work. Thanks to Dr. Farhad M. Barzinji, manager of Microgene Diagnostic laboratory at Harem Private Hospital in Sulaimani, for allowing me to do part of my work in his laboratory and thanks are due to all staff members in the Laboratory. I would like to extend my thanks to the Deanery of College of Science and Biology Department for giving me admission into higher education and giving me an opportunity to study. I would like to acknowledge individuals who have helped me make my thesis undertaking much easier and successfully completed, I owe thanks to Mrs. Nyan, Mr. Blend and Mrs. Selar.
DLSHAD
Appendices
Appendix 1: Sub-fragments of fragments A, B and C of samples 2, 3, 4 and 5. Sub-fragments of fragment A of sample 2
Sub-fragments of fragment A of sample 3
Sub-fragments of fragment A of sample 4
Sub-fragments of fragment A of sample 5
Sub-fragments of fragment B of sample 2
Sub-fragments of fragment B of sample 3
Sub-fragments of fragment B of sample 4
Sub-fragments of fragment B of sample 5
-i-
Appendices
Sub-fragments of fragment C of sample 2
Sub-fragments of fragment C of sample 3
Sub-fragments of fragment C of sample 4
Sub-fragments of fragment C of sample 5
Lanes M: 1Kb DNA marker. Sub-fragments of fragment A of samples 2, 3, 4 and 5: Lane 1: PCR products of fragment A with size 6115 bp and Lanes 2-9: sub-fragments of fragment A with sizes 5329, 4609, 3878, 3082, 2383, 1796, 1195 and 667 bp respectively. Sub-fragments of fragment B of all samples 2, 3, 4 and 5: Lane 1: PCR products of fragment B with size 6125 bp and Lanes 2-8: sub-fragments of fragment B with sizes 5404, 4608, 3676, 2895, 2129, 1303 and 589 bp respectively. Sub-fragments of fragment C of all samples 2, 3, 4 and 5: Lane 1: PCR products of fragment C with size 5515 bp and Lanes 2-8: sub-fragments of fragment C with sizes 4733, 4063, 3405, 2684, 2040, 1332 and 658 bp respectively.
-ii-
Appendices
Appendix 2: Electropherograms and sequences alignments of A263G single nucleotide polymorphisms in different samples mat be related to Kurdish population lineage. Sample No.1
Sample No.2
Query 254 TGCACAGCCGCTTTCCAC 271 ||||||||| |||||||| Sbjct 254 TGCACAGCCACTTTCCAC 271
Query 252 TCTGCACAGCCGCTTTCC 269 ||||||||||| |||||| Sbjct 252 TCTGCACAGCCACTTTCC 269
Sample No.3
Sample No.4
Query 256 CACAGCCGCTTTCCAC 271 ||||||| |||||||| Sbjct 256 CACAGCCACTTTCCAC 271
Query 252 TCTGCACAGCCGCTTTCCAC 271 ||||||||||| |||||||| Sbjct 252 TCTGCACAGCCACTTTCCAC 271
Sample No.5
Sample No.6
Query 256 CACAGCCGCTTTCCACA 272 ||||||| ||||||||| Sbjct 256 CACAGCCACTTTCCACA 272
Query 254 TGCACAGCCGCTTTCC 269 ||||||||| |||||| Sbjct 254 TGCACAGCCACTTTCC 269
-iii-
Appendices
Sample No.7
Sample No.8
Query 253 CTGCACAGCCGCTTTCCACAC 273 |||||||||| |||||||||| Sbjct 253 CTGCACAGCCACTTTCCACAC 273
Query 254 TGCACAGCCGCTTTCCACACA 274 ||||||||| ||||||||||| Sbjct 254 TGCACAGCCACTTTCCACACA 274
Appendix 3: Electropherograms and sequences alignments of 309 +C and 315 +C single nucleotide polymorphisms in different samples may be related to Kurdish population lineage. Sample No.1
Sample No.2
Query 301 ACCCCCCCCTCCCCCCGCT 319 |||||||| ||||| |||| Sbjct 301 ACCCCCCC-TCCCC-CGCT 317
Query 301 ACCCCCCCCTCCCCCCGCT 319 |||||||| ||||| |||| Sbjct 301 ACCCCCCC-TCCCC-CGCT 317
Sample No.3
Sample No.4
Query 301 ACCCCCCCCTCCCCCCGCT 319 |||||||| ||||| |||| Sbjct 301 ACCCCCCC-TCCCC-CGCT 317
Query 301 ACCCCCCCCTCCCCCCGCT 319 |||||||| ||||| |||| Sbjct 301 ACCCCCCC-TCCCC-CGCT 317
-iv-
Appendices
Sample No.5
Sample No.6
Query 301 ACCCCCCCCTCCCCCCGCT 319 |||||||| ||||| |||| Sbjct 301 ACCCCCCC-TCCCC-CGCT 317
Query 301 ACCCCCCCCTCCCCCCGCT 319 |||||||| ||||| |||| Sbjct 301 ACCCCCCC-TCCCC-CGCT 317
Sample No.7
Sample No.8
Query 301 ACCCCCCCCTCCCCCCGCT 319 |||||||| ||||| |||| Sbjct 301 ACCCCCCC-TCCCC-CGCT 317
Query 301 ACCCCCCCCTCCCCCCGC 318 |||||||| ||||| ||| Sbjct 301 ACCCCCCC-TCCCC-CGC 316
Appendix 4: Electropherograms and sequences alignments of T16519C single nucleotide polymorphisms in different samples may be related to Kurdish population lineage. Sample No.1
Sample No.2
Query 16508 CTACTTCAGGGCCATAAAG 16526 ||||||||||| ||||||| Sbjct 16508 CTACTTCAGGGTCATAAAG 16526
Query 16501 CTACTTCAGGGCCATAAAG 16526 ||||||||||| ||||||| Sbjct 16501 CTACTTCAGGGTCATAAAG 16526
-v-
Appendices
Sample No.3
Sample No.4
Query 16508 CTACTTCAGGGCCATAAAG 16526 ||||||||||| ||||||| Sbjct 16508 CTACTTCAGGGTCATAAAG 16526
Query 16501 CTACTTCAGGGCCATAAAG 16526 ||||||||||| ||||||| Sbjct 16501 CTACTTCAGGGTCATAAAG 16526
Sample No.5
Sample No.6
Query 16508 CTACTTCAGGGCCATAAAG 16526 ||||||||||| ||||||| Sbjct 16508 CTACTTCAGGGTCATAAAG 16526
Query 16501 CTACTTCAGGGCCATAAAG 16526 ||||||||||| ||||||| Sbjct 16501 CTACTTCAGGGTCATAAAG 16526
Sample No.7
Sample No.8
Query 16508 CTACTTCAGGGCCATAAAG 16526 ||||||||||| ||||||| Sbjct 16508 CTACTTCAGGGTCATAAAG 16526
Query 16501 CTACTTCAGGGCCATAAAG 16526 ||||||||||| ||||||| Sbjct 16501 CTACTTCAGGGTCATAAAG 16526
-vi-
Appendices
Appendix 5: Electropherograms and sequences alignments of A750G single nucleotide polymorphisms in different samples may be related to Kurdish population lineage. Sample No.1
Sample No.2
Query 738 ACGATCAAAAGGGACAAGCAT 758 |||||||||||| |||||||| Sbjct 738 ACGATCAAAAGGAACAAGCAT 758
Query 738 ACGATCAAAAGGGACAAGCAT 758 |||||||||||| |||||||| Sbjct 738 ACGATCAAAAGGAACAAGCAT 758
Sample No.3
Sample No.4
Query 738 ACGATCAAAAGGGACAAGCAT 758 |||||||||||| |||||||| Sbjct 738 ACGATCAAAAGGAACAAGCAT 758
Query 738 ACGATCAAAAGGGACAAGCAT 758 |||||||||||| |||||||| Sbjct 738 ACGATCAAAAGGAACAAGCAT 758
Sample No.5
Sample No.6
Query 738 ACGATCAAAAGGGACAAGCAT 758 |||||||||||| |||||||| Sbjct 738 ACGATCAAAAGGAACAAGCAT 758
Query 738 ACGATCAAAAGGGACAAGCAT 758 |||||||||||| |||||||| Sbjct 738 ACGATCAAAAGGAACAAGCAT 758
-vii-
Appendices
Sample No.7
Sample No.8
Query 738 ACGATCAAAAGGGACAAGCAT 758 |||||||||||| |||||||| Sbjct 738 ACGATCAAAAGGAACAAGCAT 758
Query 738 ACGATCAAAAGGGACAAGCAT 758 |||||||||||| |||||||| Sbjct 738 ACGATCAAAAGGAACAAGCAT 758
Appendix 6: Electropherograms and sequences alignments of A73G single nucleotide polymorphisms in different samples may be related to Kurdish population lineage. Sample No. 1
Sample No.2
Query 64 CTGGGGGGTGTGCACGCGATA 84 ||||||||| ||||||||||| Sbjct 64 CTGGGGGGTATGCACGCGATA 84
Query 61 CTGGGGGGTGTGCACGCGATA 84 ||||||||| ||||||||||| Sbjct 61 CTGGGGGGTATGCACGCGATA 84
Sample No.3
Sample No. 4
Query 64 CTGGGGGGTGTGCACGCGATA 84 ||||||||| ||||||||||| Sbjct 64 CTGGGGGGTATGCACGCGATA 84
Query 61 CTGGGGGGTGTGCACGCGATA 84 ||||||||| ||||||||||| Sbjct 61 CTGGGGGGTATGCACGCGATA 84
-viii-
Appendices
Sample No.5
Sample No.6
Query 64 CTGGGGGGTGTGCACGCGATA 84 ||||||||| ||||||||||| Sbjct 64 CTGGGGGGTATGCACGCGATA 84
Query 61 CTGGGGGGTGTGCACGCGATA 84 ||||||||| ||||||||||| Sbjct 61 CTGGGGGGTATGCACGCGATA 84
Sample No.7
Query 64 CTGGGGGGTGTGCACGCGATA 84 ||||||||| ||||||||||| Sbjct 64 CTGGGGGGTATGCACGCGATA 84
Appendix 7: Electropherograms and sequences alignments of A1438G single nucleotide polymorphisms in different samples may be related to Kurdish population lineage. Sample No.1
Query Sbjct
Sample No.2
1429 CAGTAAACTGAGAGTAGAG 1447 ||||||||| ||||||||| 1429 CAGTAAACTAAGAGTAGAG 1447
Query Sbjct
-ix-
1429 CAGTAAACTGAGAGTAGAG 1447 ||||||||| ||||||||| 1429 CAGTAAACTAAGAGTAGAG 1447
Appendices
Sample No.3
Query Sbjct
Sample No.4
1429 CAGTAAACTGAGAGTAGAG 1447 ||||||||| ||||||||| 1429 CAGTAAACTAAGAGTAGAG 1447
Query Sbjct
1429 CAGTAAACTGAGAGTAGAG 1447 ||||||||| ||||||||| 1429 CAGTAAACTAAGAGTAGAG 1447
Sample No.5
Query Sbjct
1429 CAGTAAACTGAGAGTAGAG 1447 ||||||||| ||||||||| 1429 CAGTAAACTAAGAGTAGAG 1447
Appendix 8: Electropherograms and sequences alignments of A4769G single nucleotide polymorphisms in different samples may be related to Kurdish population lineage. Sample No.1
Sample No.2
N QUERY 4761 ATCATAATGGCTATAGCA 4778 |||||||| ||||||||| SBJCT 4761 ATCATAATAGCTATAGCA 4778
QUERY 4761 ATCATAATGGCTATAGCA 4778 |||||||| ||||||||| SBJCT 4761 ATCATAATAGCTATAGCA 4778
-x-
Appendices
Sample No.4
Sample No.3
QUERY 4761 ATCATAATGGCTATAGCA 4778 |||||||| ||||||||| SBJCT 4761 ATCATAATAGCTATAGCA 4778
QUERY 4761 ATCATAATGGCTATAGCA 4778 |||||||| ||||||||| SBJCT 4761 ATCATAATAGCTATAGCA 4778
Sample No.5
QUERY 4761 ATCATAATGGCTATAGCA 4778 |||||||| ||||||||| SBJCT 4761 ATCATAATAGCTATAGCA 4778
Appendix 9: Electropherograms and sequences alignments of T204C single nucleotide polymorphisms in different samples may be related to Kurdish population lineage. Sample No. 2
Sample No.3
Query 198 CTAAAGCGTGTTAATTAA 215 |||||| ||||||||||| Sbjct 198 CTAAAGTGTGTTAATTAA 215
Query 198 CTAAAGCGTGTTAATTAA 215 |||||| ||||||||||| Sbjct 198 CTAAAGTGTGTTAATTAA 215
-xi-
Appendices
Sample No.4
Query 198 CTAAAGCGTGTTAATTAA 215 |||||| ||||||||||| Sbjct 198 CTAAAGTGTGTTAATTAA 215
Appendix 10: Representative electropherograms and sequences alignments of A2706G single nucleotide polymorphisms in different samples may be related with Kurdish population lineage. Sample No. 1
Sample No. 5
Query 2695 GAGGCGGGCATGACACAGCAAG 2716 ||||||||||| |||||||||| Sbjct 2695 GAGGCGGGCATAACACAGCAAG 2716
Query 2695 GAGGCGGGCATGACACAGCAAG 2716 ||||||||||| |||||||||| Sbjct 2695 GAGGCGGGCATAACACAGCAAG 2716
Appendix 11: Electropherogram and sequences alignments of C7028T single nucleotide polymorphisms in sample no. 1 may be related to Kurdish population lineage. Sample No. 1
Query 7017 TACGTTGTAGCTCACTTCCACTATGTCCTATCAATA 7052 ||||||||||| |||||||||||||||||||||||| Sbjct 7017 TACGTTGTAGCCCACTTCCACTATGTCCTATCAATA 7052
-xii-
Appendices
Appendix 12: Electropherograms and sequences alignments of A8860G single nucleotide polymorphisms in different samples may be related to Kurdish population lineage. Sample No.2
Sample No.3
Query 8851 TGAGCGGGCGCAGTGATT 8868 ||||||||| |||||||| Sbjct 8851 TGAGCGGGCACAGTGATT 8868
Query 8851 TGAGCGGGCGCAGTGATT 8868 ||||||||| |||||||| Sbjct 8851 TGAGCGGGCACAGTGATT 8868
Sample No.4
Sample No.5
Query 8851 TGAGCGGGCGCAGTGATT 8868 ||||||||| |||||||| Sbjct 8851 TGAGCGGGCACAGTGATT 8868
Query 8851 TGAGCGGGCGCAGTGATT 8868 ||||||||| |||||||| Sbjct 8851 TGAGCGGGCACAGTGATT 8868
Appendix 13: Electropherogram and sequences alignments of C12705T single nucleotide polymorphisms in sample no.1 may be related to Kurdish population lineage. Sample No.1
Query 12690 CAAATATCTACTCATTTTCCTAATTACC 12717 ||||||||||||||| |||||||||||| Sbjct 12690 CAAATATCTACTCATCTTCCTAATTACC 12717
-xiii-
Appendices
Appendix 14: Electropherograms and sequences alignments of C14766T single nucleotide polymorphisms in different samples may be related to Kurdish population lineage. Sample No.1
Query 14763 AAATTAACCCCCTAATAAAATTA 14785 ||| ||||||||||||||||||| Sbjct 14763 AAACTAACCCCCTAATAAAATTA 14785
Sample No.5
Query 14763 AAATTAACCCCCTAATAAAATTA 14785 ||| ||||||||||||||||||| Sbjct 14763 AAACTAACCCCCTAATAAAATTA 14785
Appendix 15: Electropherograms and sequences alignments of A15326G single nucleotide polymorphisms in different samples may be related to Kurdish population lineage. Sample No.1
Query 15318 CCCTAGCAGCACTCCACCTCCTA 15340 |||||||| |||||||||||||| Sbjct 15318 CCCTAGCAACACTCCACCTCCTA 15340
Sample No.2
Query 15318 CCCTAGCAGCACTCCACCTCCTA 15340 |||||||| |||||||||||||| Sbjct 15318 CCCTAGCAACACTCCACCTCCTA 15340
Sample No.3
Query 15318 CCCTAGCAGCACTCCACCTCCTA 15340 |||||||| |||||||||||||| Sbjct 15318 CCCTAGCAACACTCCACCTCCTA 15340
Sample No.4
Query 15318 CCCTAGCAGCACTCCACCTCCTA 15340 |||||||| |||||||||||||| Sbjct 15318 CCCTAGCAACACTCCACCTCCTA 15340
-xiv-
Appendices
Appendix 16: Electropherograms and sequences alignments of T16189C single nucleotide polymorphisms in different samples may be related to Kurdish population lineage. Sample No.1
Sample No.2
Query 16174 ACATCAAAACCCCCCCCCCATGCT 16198 |||||||||||||| ||||||||| Sbjct 16174 ACATCAAAACCCCCTCCCCATGCT 16198
Query 16174 ACATCAAAACCCCCCCCCCATGCT 16198 |||||||||||||| ||||||||| Sbjct 16174 ACATCAAAACCCCCTCCCCATGCT 16198
Sample No.3
Sample No. 4
Query 16174 ACATCAAAACCCCCCCCCCATGCT 16198 |||||||||||||| ||||||||| Sbjct 16174 ACATCAAAACCCCCTCCCCATGCT 16198
Query 16174 ACATCAAAACCCCCCCCCCATGCT 16198 |||||||||||||| ||||||||| Sbjct 16174 ACATCAAAACCCCCTCCCCATGCT 16198
Sample No.7
Query 16174 ACATCAAAACCCCCCCCCCATGCT 16198 |||||||||||||| ||||||||| Sbjct 16174 ACATCAAAACCCCCTCCCCATGCT 16198
-xv-
Appendices
Appendix 17: Electropherograms and sequences alignments of C16223T and C16278T single nucleotide polymorphisms in sample no. 1 may be related to Kurdish population lineage. Sample No.1
Sample No.1
Query 16200 CAGCAATCAACCCTCAACTATCAC 16259 Query 16265 ACCCACTAGGATATCAACAAACCTA 16289 |||||||||||| ||||||||||| ||||||||||||| ||||||||||| Sbjct 16197 CAGCAATCAACCCTCAACTATCAC 16256 Sbjct 16265 ACCCACTAGGATACCAACAAACCTA 16289
Appendix 18: Electropherograms and sequences alignments for A12172G single nucleotide
polymorphisms in different samples.
Query 12164 GATTGTGAGTCTGACAACA 12182 |||||||| |||||||||| Sbjct 12164 GATTGTGAATCTGACAACA 12182
Query 12164 GATTGTGAGTCTGACAACA 12182 |||||||| |||||||||| Sbjct 12164 GATTGTGAATCTGACAACA 12182
Query 12164 GATTGTGAGTCTGACAACA 12182 |||||||| |||||||||| Sbjct 12164 GATTGTGAATCTGACAACA 12182
-xvi-
Appendices
Appendix 19: Electropherograms and sequences alignments for T152C, T195C, A200G, C295T,
C462T, T489C, G930A, G1719A, G2528A, G5147A, T6221C, A6284T, C6371T, A6791G, G8155A, G8697A, G10646A, A10748T, G13368A, G14905A, A15607G, G15928A, T16126C, C16179T, A16182C, A16183C, C16193T, C16218T, A16247T, C16294T, C16296T, T16304C, C16328A and T16356C single nucleotides polymorphisms different samples.
Query 142 TGCCTCATCCCATTATTTATC 162 |||||||||| |||||||||| Sbjct 142 TGCCTCATCCTATTATTTATC 162
Query 181 CGAACATACTTACTGAAGTGTGT 240 |||||||||||||| |||||||| Sbjct 181 CGAACATACTTACTAAAGTGTGT 240
Query 454 TTCCCCTCTCACTCCCATAC 473 |||||||| ||||||||||| Sbjct 454 TTCCCCTCCCACTCCCATAC 473
Query 184 GGCGAACATACCTACTAAAGTGTG 207 ||||||||||| |||||||||||| Sbjct 184 GGCGAACATACTTACTAAAGTGTG 207
Query 286 AAAAAATTTTCACCAAA 302 ||||||||| ||||||| Sbjct 286 AAAAAATTTCCACCAAA 302
Query 481 CTCATCAACACAACCCC 497 |||||||| |||||||| Sbjct 481 CTCATCAATACAACCCC 497
-xvii-
Appendices
Query 920 GTCAATAGAAACCGGCGTAAA 940 |||||||||| |||||||||| Sbjct 920 GTCAATAGAAGCCGGCGTAAA 940
Query 2518 AGCATCACCAATATTAGAGG 2537 |||||||||| ||||||||| Sbjct 2518 AGCATCACCAGTATTAGAGG 2537
Query 1706 CCAGACAACCTTAACCAAACCA 1727 ||||||||||||| |||||||| Sbjct 1706 CCAGACAACCTTAGCCAAACCA 1727
Query 5137 CCAGCACCACAACCCTACTA 5156 |||||||||| ||||||||| Sbjct 5037 CCAGCACCACGACCCTACTA 515
Query 6208 TCTGACTCTTACCCCCCTCTCTCCT 6232 ||||||||||||| ||||||||||| Sbjct 6208 TCTGACTCTTACCTCCCTCTCTCCT 6232
Query 6273 ACAGGTTGAACTGTCTACCCTCCC 6296 ||||||||||| |||||||||||| Sbjct 6273 ACAGGTTGAACAGTCTACCCTCCC 6296
Query 6360 GCAGGTGTCTCTTCTATCTTAG 6381 ||||||||||| |||||||||| Sbjct 6360 GCAGGTGTCTCCTCTATCTTAG 6381
Query 6780 TTTACAGTAGGGATAGACGTA 6900 ||||||||||| ||||||||| Sbjct 6780 TTTACAGTAGGAATAGACGTA 6900
-xviii-
Appendices
Query 8147 CGACCGGGAGAGTATACTAC 8166 |||||||| ||||||||||| Sbjct 8147 CGACCGGGGGAGTATACTAC 8166
Query 8689 AAACAAATAATAACCAT 8705 |||||||| |||||||| Sbjct 8689 AAACAAATGATAACCAT 8705
Query 10638 AATATTGTACCTA 10650 |||||||| |||| Sbjct 10638 AATATTGTGCCTA 10650
Query 13359 GTGCTCCGGATCCATCAT 13376 ||||||||| |||||||| Sbjct 13359 GTGCTCCGGGTCCATCAT 13376
Query 15600 CTAACAAGCTAGGAGG 15615 ||||||| |||||||| Sbjct 15600 CTAACAAACTAGGAGG 15615
Query 10741 ATAACCTTAGCCT 10753 ||||||| ||||| Sbjct 10741 ATAACCTAAGCCT 10753
Query 14896 CCTAGCCATACACTACTC 14913 ||||||||| |||||||| Sbjct 14896 CCTAGCCATGCACTACTC 14913
Query 15921 AAACCGAAGATGAAAA 15937 |||||| ||||||||| Sbjct 15821 AAACCGGAGATGAAAA 15937
-xix-
Appendices
Query 16119 AATATTGCACGGTACCAT 16136 ||||||| |||||||||| Sbjct 16119 AATATTGTACGGTACCAT 16136
Query 16169 CAATCCACATTAACCCCCCC 16188 |||||||||| || ||||| Sbjct 16169 CAATCCACATCAAAACCCCC 16188
Query 16184 CCCCCTCCCTATGCTT 16199 ||||||||| |||||| Sbjct 16184 CCCCCTCCCCATGCTT 16199
Query 16211 CAGCAATTAACCCTCAA 16227 ||||||| ||||||||| Sbjct 16211 CAGCAATCAACCCTCAA 16227
Query 16242 CTGCATCTCCAAAGCC 16257 ||||| |||||||||| Sbjct 16142 CTGCAACTCCAAAGCC 16257
Query 16319 GCCATTTACAGTACATAG 16336 ||||||||| |||||||| Sbjct 16319 GCCATTTACCGTACATAG 16336
Query 16288 TACCCATCTTTAACAGCACATAGT 16311 |||||| | ||||||| ||||||| Sbjct 16288 TACCCACCCTTAACAGTACATAGT 16311
Query 16345 CAGTCAAATCCCCTCTCGT 16363 ||||||||||| ||||||| Sbjct 16345 CAGTCAAATCCTCTCTCGT 16363
-xx-
Chapter one Introduction
Chapter two literature review
Chapter three materials AND methods
Chapter four Results AND discussions
Conclusions AND recommendations
References
Appendices
الخالصة
Dedication
This thesis is dedicated to all those who helped me to reach this stage
Examining Committee Certification We certify that we have read this thesis entitled “A Study of Human Mitochondrial Genome in Sulaimani Province ”accomplished by (Dlshad Abdullah Rashid), and as Examining Committee, examined the student in its content and in connected with it, and in our opinion it meets the basic requirements toward the degree of Master of Science in General Genetics.
Signature:
Signature:
Name: Dr. Khidir M. Hawrami
Name: Dr. Gaza F. Salih
Scientific grade: Professor
Scientific grade: Asst. Professor
Date:
Date:
/
/ 2014
(Chairman)
/
/ 2014
(Member)
Signature:
Signature:
Name: Dr. Dlnya Asad Mohamad
Name: Dr. Farhad M. Barzinji
Scientific grade: Asst. Professor
Scientific grade: Asst. Professor
Date:
Date:
/
/ 2014
(Member)
/
/ 2014
(Supervisor-Member)
Approved by the Dean of the Faculty of Science. Signature: Name: Dr. Bakhtiar Q. Aziz Scientific grade: Professor Date:
/
/ 2014
(The Dean)
Chapter One
Introduction
1. INTRODUCTION All living organisms depend on efficient energy generating processes at the cellular level, and the cellular vitality state is when the cell efficiently generating energy. Therefore, a healthy organism needs cellular vitality that protects it against infections. In humans and other eukaryotic organisms this vital energy is produced in the mitochondria. Mitochondrion is thread-like or bean-shaped organelle with a diameter between 0.5 to 1µm. It was first described by the German cytologist Altman in 1890 (kutschera and niklas, 2005). The mitochondria are present in almost all eukaryotic cells and evolved by “Serial endosymbiosis processes” (Gray et al., 1999). Most human cells contain between a few hundred and to a few thousand copies. The organelle is surrounded by two distinct membrane systems; the outer membrane (OMM) encloses the organelle, and the inner membrane (IMM) that is tube-like invaginations protruding into the interior of the organelle (cristae membrane). Cristae membrane greatly increases the surface area of IMM and contains essential enzymes for metabolic functions such as mitochondrial respiratory chain MRC. The 2 membranes (OMM and IMM) are generating 2 internal aqueous compartments: inter membrane space (IMS) that contains only a few proteins, in which some are involved in the proteins transport into mitochondria (De Grey, 1999). The second is matrix which contains a mixture of hundreds of enzymes and other proteins, many of which play a crucial role in the energy production, as well as it contains several identical copies of the mitochondrial genome (mtDNA). The mitochondrial genome is a small circular molecule like most other prokaryotic genomes, and it consists of 16,569 bp. The two strands of mtDNA are different in their base composition: a guanine (G) rich heavy strand (H) and the second is cytosine (C) rich light strand (L). Furthermore, the genome is divided into 2 regions: First, the coding region that consists of 15448 bp (position 576-16024), which contains only 37 genes (13 genes coding proteins (polypeptides) essential for proton-electron transport chain, and 22 tRNAs, 2 rRNAs (12S and 16S) that are essential for protein biosynthesis in the mitochondria, while the majority of mitochondrial genes are encoded by nuclear DNA (nDNA) such as replication, transcription and some other proteins (Wiederkehr et al., 2009, Urata et al., 2004 and Jansen, 2000). Second, the non-coding region (D-loop) has regulatory functions and it consists of 1121 bp that starts from positions 1-576 and 16024-16569. Moreover, the D-loop is more prone (a hot spot) for mutation -1-
Chapter One
Introduction
and therefore it contains two hypervariable regions: HV1 that starts from nucleotide (nt) 16024– 16383 and the second is HV2 starting from nt 57–372 (Sharma et al., 2005). There are 2 phenomenons concerning the mitochondrial population: a homoplasmia that is all the mitochondrial genomes are either homogeneous for wild type or mutant variant, while heteroplasmia is where the population in a single cell contains both of wild type and mutant genome variants. Therefore, during the cell division of heteroplasmia cells three different genotypes can originate: homoplasmic wild type mitochondria, homoplasmic mutant mitochondria, and heteroplasmic mitochondria. Both homoplasmic mutant and heteroplasmic are related to the mitochondrial disease. Therefore, most of the sudden death cases suffer from mitochondrial related disease and the genome is homoplasmic mutant, while in the mild diseases and maternal carrier cases the genome is in heteroplasmic form. The severity levels of the diseases in heterosome are related to the ratio between the mutant and the wild type of mitochondrial genome in the cells. When the ratio is 1/1 and below the cell is in carrier state, but if the ratio is 2/1 or more the cell is in disease form. The phenomenon of the ratio levels is known as threshold effect (Rossignol et al., 2003). The functions of mitochondria are: generating energy, apoptosis (programmed cells death), storage of calcium (Ca++) and heat production. The production of energy occurs in the electron transport chain (ETC) system and oxidative phosphorylation (OXPHOS) process. This system is composed of five multimeric protein complexes (I-V), in which the proteins are encoded by both mtDNA and nuclear DNA (nDNA) except for the proteins of complex (II) that is totally encoded by nDNA. This system also generates deleterious reactive oxygen species (ROS) in the form of OH•, O2•- and H2O2 as a by-products of normal oxidative metabolism. Moreover, overproduction of ROS under various cellular stresses results in damages in the cellular macromolecules such as nDNA, mtDNA, proteins and enzymes, which can cause organ injury and contributes to a broad spectrum of diseases and pathological conditions (Cummins, 2001 and Kuznetsov et al., 2011). Disease-associated point mutations in “mtDNA” have been reported in all structural genes except mitochondrial ATPase8 (MTATP8). The most common point mutations are in the tRNA genes that pathogene mutations in all 22 tRNAs have been identified. Primarily mutations in tRNA genes, rRNA genes, or large-scale deletions affect the overall mitochondrial protein synthesis, while mutations in specific protein-coding genes generally affect the particular complex where the protein is located. -2-
Chapter One
Introduction
The diseases that are related to tRNA genes are Mitochondrial Encephalomyopathy, Lactic Acidosis and Stroke-like episodes (MELAS) and Myoclonic Epilepsy and Ragged Red Muscle Fibers (MERRF) while the disease that is related to 12SrRNA is Non-Syndromic Inherited Hearing Loss (prezant et al., 1993 and Solano A et al., 2001). Furthermere, the diseases related to single large-scale deletions are Pearson syndrome (PS) Kearns–Sayre’s syndrome (KSS) and Chronic progressive external ophthalmoplegia (CPEO or PEO) (van de Corput et al., 1997 and DiMauro, 2004), while the diseases that are related protein coding genes are Maternally inherited Leigh syndrome (MILS) and Leber’s Hereditary Optic Neuropathy (LHON). The two properties of the mtDNA are: it is maternal inheritance, and has a high mutational rate, therefore, these two properties make mtDNA a useful tool for human maternally evolutionary studies (Torroni et al. 1996 and Annunen-Rasila, 2007). The mutation rate of mtDNA is much higher than that of the nuclear DNA, but most mtDNA mutations are neutral polymorphisms, which have accumulated sequentially in maternal lineages, which were used for the detection of human maternal ancestor and human migration line throughout the world (Wallace et al., 1999 and Brown et al., 1979). It is generally accepted that the Homo sapiens sapiens originated in Africa, and the original African population is the ancestor of all present human populations (Cann et al., 1987; Stringer and Andrews, 1988; Jorde et al., 1998). Furthermore, since all mtDNAs in Homo sapiens are descended from our most recent common female ancestor (MRCA) (mitochondrial Eve) and she had lived in Africa in about 100,000-200,000 years ago, and then migrated out of Africa. According to the Out-of-Africa hypothesis, as the population evolved, it spread along the coastal zones of Africa into Asia and Europe. This population spread further to other regions (Cann et al., 1987; Aiello, 1993; Templeton, 1993; Nei, 1995; Jorde et al., 1998; Walsh., 2001; Harpending and Rogers, 2000). The aims of this study are:
To identify the genetic cause of mitochondrial myopathy.
To evaluate the pathogenicity of identified mtDNA mutations.
To identify common homoplasmic mutations that might be related to the Kurdish population and haplogroup.
-3-
Chapter Two
Literature Review
2. LETERATURE REVIEW 2.1. Introduction Mitochondrion is the power house of the cell and was first described by the German cytologist Altman in 1890 (Kutschera and Niklas, 2005). This thread-like or bean-shaped organelle is small with a diameter between 0.5 and 1µm (Figure 2.1), it is extremely mobile and constantly changes its shape. It is more accurate to think of mitochondrion as a budding fusing network similar to the endoplasmic reticulum (Iborra et al., 2004) The mitochondrion is present in almost all eukaryotic cells. The eukaryotes lacking mitochondrion such as Entamoeba histolytica and red blood cells may have lost this organelle in the course of their evolutionary deviation from the main eukaryotic lineage (Saelens et al., 2004). Most human cells contain between a few hundred to a few thousand copies per cell and it is most abundant in high energy-demand tissues such as nerves and muscles. Moreover, the mitochondria occupy a substantial fraction of the liver cell volume being about 1/5 in liver cells (de Grey, 1999).
2.2. The structure of mitochondrion The mitochondrion is surrounded by two distinct membrane systems, the outer membrane (OMM) and the inner membrane (IMM). These generate 2 internal aqueous compartments, inter membrane space (IMS) and matrix (Figure 2.1).
Figure 2.1: Left electron microscope figure of mitochondrion and right schematic diagram of a surface cut mitochondrion with its internal structure (Snustad and Simmons, 2000). -4-
Chapter Two
Literature Review
The membranes OMM and IMM are composed of phospholipid bilayers, proteins, and cholesterol (Becker et al., 2009). There are some peculiarities regarding which phospholipids are present: for example, a diphospholipid called cardiolipin or diphosphatidylglycerol (Figure 2.2) is present in large amounts in the IMM, whereas it is almost absent in the other parts of the cell. Conversely, cholesterol is almost not present in IMM, except in the adrenal cortex, where it is metabolized to Pregnenolone (Byrd et al., 1983).
Figure 2.2: Chemical structure of diphospholipid (Kiebish et al., 2008). The 2 membranes (IMM and OMM) are not completely separated; they come together in a few places called contact sites (de Grey, 1999) (Figure 2.1). 2.2.1. The outer membrane (OMM) The outer membrane (OMM) encloses the entire organelle (mitochondria). It is not folded and has numerous channel called porins (transport proteins), which are permeable for protons and proteins from 10 kD and less in sizes. Since OMM contains the original host membrane, therefore it is a barrior to cations (Chicco and Sparagna, 2007). Furthermore, there are other proteins embedded in this membrane (OMM), including enzymes such as: -5-
Chapter Two
Literature Review
a) Enzymes catalyzing mitochondrial lipid synthesis. b) Enzymes converting lipid substrates to the molecules subsequently metabolized in the matrix. 2.2.2. The intermembrane space (IMS) The space between the inner and outer mitochondrial membranes (IMM and OMM) is called the Mitochondrial Intermembrane Space (IMS). It contains a few proteins, in which some of the proteins are involved in the protein transport into mitochondria (de Grey, 1999), and generally the IMS proteins are classified into three types: 1st: Bipartite proteins that have an N-terminal MTS (Matrix Targeting Sequences). 2nd: Hydrophobic sorting sequence proteins that utilize a cofactor to fold correctly proteins and thereby avoid escape from the IMS. 3rd: Proteins that are permanently associated with factors in the IMS (Neupert and Herrmann, 2007)
2.2.3. The inner mitochondrial membrane (IMM) This membrane is divided into: 1) Peripheral regions adjacent to the outer membrane (inner boundary membrane). 2) Tube-like invaginations protruding into the interior of the organelle cristae membrane (Figure 2.1). The cristae membrane increases greatly the surface area of IMM and contains essential enzymes for metabolic reactions. Moreover, the IMM is impermeable for most charged molecules and the molecules that pass through are controlled by protein embedded in the membrane (de Grey, 1999). These proteins are very specific, in which each one transfers only a particular molecule at a time. This rigid control exists because it is vital for the mitochondrial function and the molecules that are transported in this way must be transferred when they are needed, but only in the right quantity. In addition to the carrier proteins, there are several other enzymes embedded in the IMM and their roles are central in mitochondrial function. These enzymes are clients to the carrier proteins (Ohnishi, 1993). Furthermore, about 20% of the lipid content of IMM composed of the double layers of cardiolipin whose chemical nature is thought to make the membrane impermeable to ions (Chicco and Sparagna, 2007). This impermeability is important to maintain -6-
Chapter Two
Literature Review
the electrochemical gradient that drives ATP synthesis in the mitochondrion. Therefore, the inner membrane is the site of the ETC and contains proteins with three types of functions: (i) Respiratory chain oxidative reactions. (ii) ATP synthesis. (iii) Metabolite transport into and out of the matrix. 2.2.4. The matrix (space within the inner membrane). The space enclosed by the IMM is called the mitochondrial matrix. It has been estimated that half the mass of the matrix is proteins. It contains a mixture of hundreds of enzymes, many of which play a crucial role in the oxidation of pyruvate and fatty acids in the citric acid cycle or Krebs cycle (The initial steps in the production of ATP through aerobic respiration). Moreover, it also contains several identical copies of the mtDNA (mt genome) as well as mtDNA and nDNA encoded proteins and components that are required for replication and gene expression (Wiederkehr et al., 2009). The matrix is one of the most alkaline environments in the cell and it has a pH of between 8 and 8.5 roughly half a unit higher than the cytosol (de Grey, 1999).
2.3. The function of mitochondria The mitochondrion is intimately involved in cellular homeostasis, plays a part in some cellular metabolism and functions as: 2.3.1. Energy production Cellular respiration is the set of metabolic reactions and processes that convert biochemical energy from nutrients (carbohydrates, fat and oils and amino acids) into ATP, and then release waste products (CO2, H2O and heat). The cellular respiration occurs in three metabolic stages (Figure 2.3): 1. Glycolysis (occurring in cytoplasm) 2. Citric acid cycle (occurring in mitochondria) 3. Electron transport chain (occurring in mitochondria)
-7-
Chapter Two
Literature Review
Glycolysis
Kreb cycle
Electron transport chain
Figure 2.3: Stages of cellular respiration
1. Glycolysis This reaction occurs in the cytoplasm and a small fraction (2 molecules) of ATP of the total free energy is released. The steps of glycolysis are illustrated in Figure 2.4 and each of the steps are described briefly below: Step 1: In a series of 3 reactions, a molecule of glucose converted to fructose 1, 6-bisphosphate, in these reactions two ATP molecules are consumed. Step 2: In 2 reactions, the resulting six-carbon compound is broken down to 2 three-carbon compounds, each with a phosphate group. Step 3: Two Nicotinamide adenine dinucleotide (NADH) molecules are produced, and one more inorganic phosphate group (Pi) is transferred to each three-carbon compound. Step 4: In a series of 4 reactions, each three-carbon compound is converted to pyruvate (threecarbon molecule) in this process producing 4 ATP molecules (DiMauro and Schon., 2003).
-8-
Chapter Two
Literature Review
Figure 2.4: Steps of glycolysis (DiMauro and Schon, 2003).
2. Citric acid cycle (Krebs cycle) The cellular metabolism is completed in the mitochondrion, when pyruvate from glycolysis, fatty acids from fat and oil and some amino acids from proteins are imported in to the mitochondria (Pieczenik and Neustadt, 2007). The steps of citric acid cycle are briefly outlined below and illustrated in Figure 2.5: Step1: Pyruvate or fatty acids is converted to 2 molecules of acetyl coenzyme A (acetyl-CoA) by the pyruvate dehydrogenase complex and β-oxidase pathway respectively, CO2 and NADH are produced. The acetyl-CoA selectively transported from the cytosol to the mitochondrial matrix. Step2: Acetyl-CoA combines with oxaloacetate to form citrate. This reaction is catalyzed by citrate synthase. Step3: Citrate is converted to isocitrate by the enzyme aconitase. Step4: Iisocitrate dehydrogenase converts isocitrate to α-ketoglutarate and 1 molecule of NADH is produced. Step5: α-ketoglutarate is converted to succinyl-CoA by the enzyme α-ketoglutarate dehydrogenase and 1 molecule of NADH is produced.
-9-
Chapter Two
Step6:
Literature Review
Succinate thiokinase catalyze the conversion of succinyl-CoA to succinate and 1
molecule of guanine triphosphate (GTP) is formed from guanine diphosphate (GDP). Step7: Succinate dehydrogenase converts succinate to fumarate and 1 molecule of flavin adenine dinucleotide (FADH2) is formed. Step8: The enzyme fumarase converts fumarate to malate. Step9: Malate converts to oxaloacitate by the enzyme malate dehydrogenase and 1 molecule NADH is formed. The last oxaloacitate enters to citric acid cycle and the cycle continued.
Figure 2.5: Steps of Krebs (citric acid) cycle (DiMauro and Schon., 2003).
3. Electron transport chain (ETC) The NADH and FADH2 are produced in both glycolysis and Krebs cycle. Both molecules are converted to ATP in the oxidative phosphorylation (OXPHOS) process in electron transport chain system on IMM (Pieczenik and Neustadt., 2007). The OXPHOS system is composed of five protein complexes: Complex I:
Nicotinamide Adenine Dinucleotide Coenzyme Q reductase (NADH-CoQ
reductase) that is composed of approximately 46 subunits, 7 of the subunits are encoded by -10-
of
Chapter Two
Literature Review
mtDNA (ND1–ND4, ND4L, ND5, and ND6), while the remainder 39 subunits are encoded by nDNA. Complex II: Succinate CoQ reductase (FADH2-CoQ) is composed of 4 subunits, in which all are encoded by nDNA. Complex III: Ubiquinol cytochrome-b reductase is composed of 11 subunits: 1 of the subunit is encoded by mtDNA and the 10 reminder subunits are encoded by nDNA. Complex IV: Cytochrome-c oxidase contains 13 subunits, of which three subunits are mtDNAencoded while 10 subunits are nDNA encoded. Complex V: ATP synthase is composed of 16 subunits, in which the 2 subunits Adenosine Triphosphtase6 and 8 (ATPase6 and ATPase8) are mtDNA-encoded and 14 subunits are nDNA encoded (DiMauro, 2004 and Annunen-Rasila, 2007 and Carroll et al., 2006).
The ETC and OXOPHOS pathway: The ETC and OXOPHOS pathway stages are illustrated in Figure 2.6 and outlined briefly below: Stage1: Complex I and Complex II use the energy from NADH and FADH2 respectively to pump protons into the IMS of the mitochondrion. Stage2: Electrons from Complexes I and II are delivered to complex III through coenzyme Q (cytochrom-b). Stage3: Complex III delivers electrons to complex IV and reduces oxygen atoms inside the matrix to H2O. Stage4: A proton motive force generates in the IMS (high proton concentration) by coupling electron transport to protein translocation at complexs I, II, and IV The enzyme ATP synthase generates ATP when protons are transported down from IMS (high proton concentration) into the matrix (low proton concentration) due to the pH difference between the mitochondrial matrix and the IMS (Moore et al., 2000 and Schắfer et al., 2006 and DiMauro and Schon, 2003).
-11-
Chapter Two
Literature Review
Figure 2.6: Schematic representation of oxidative phosphorylation (Saraste, 1999).
OXOPHOS generates Reactive Oxygen Species (ROS) as a by-product, which is an endogenous toxin. Furthermore, ROS are generated in forms of OH•, O2•- and H2O2 by reduction of O2 (oxygen) these molecules (ROS) are highly mutagenic and carcinogenic (Figure 2.7). In the human body, each mitochondrion produces 1 × 107 ROS molecules per day, since mitochondria occupy up to 25% of the total cytosol, the cell is very susceptible to oxidative damage (Cummins, 2001). Moreover, ROS can damage the mitochondria, cellular proteins, lipids, as well as nucleic acids (DNA and RNA), and interrupt the energy production. Excessive production of ROS may cause programmed cell death (apoptosis), which is another function of mitochondria. (Wallace et al., 1999 and Balaban et al., 2005).
-12-
Chapter Two
Literature Review
Figure 2.7: The generation of reactive oxygen species (ROS) (Murphy, 2009). Net energy formation by cellular respiration: The energy released by cellular respiration from one molecule of glucose is about 38 ATP molecules as following: 1) Two molecules of ATP produced in glycolysis by substrate level phosphorylation. 2) Two molecules of ATP produced in citric acid cycle by substrate level phosphorylation: 2GDP + 2Pi
2CoA-SH + 2GTP
In ETC 34 ATP molecules are produced by oxidative phosphorylation (30 molecules of ATP from 10 NADH 3 ATP molecules per NADH and 4 molecules of ATP from 2 FADH2 (2 ATP molecules per FADH2) (Garrett and Grisham, 1999). C6H12O6 + 6O2
6CO2 + 6H2O + 38ATP (Figure 2.8)
38 ATP
Figure 2.8: A diagram of cellular respiration and energy production calculation. -13-
Chapter Two
Literature Review
2.3.2. Apoptosis (programmed cell death) Excessive production of ROS from OXOPHOS may cause apoptosis. It is a process of programmed cell death (PCD) that may occur in multicellular organisms. Biochemical events lead to characteristic cell changes (morphology) and death. These changes include blebbing (the actin-myosin system has been proposed to be the source of contractile force that drives bleb formation),
cell
shrinkage, nuclear fragmentation, chromatin
condensation,
as
well
as
chromosomal and mtDNA fragmentation. Apoptotic cascade is generated by the activation of mitochondrial permeability transition pore (mtPTP) in the IMM. Activated mtPTP lead to release of cytochrome-c and the latent form of specialized proteases, some pro-caspases, adenylate kinase-2 and apoptosis-inducing factor (Kroemer, 2003). The PCD is promoted by activating the cytosolic protein degradation pathway and destroying the cytoplasm (Wallace et al., 1999). This interrelated system involved in apoptosis is assembled from roughly 1500 genes distributed in the nuclear and mitochondrial genomes (Sequeira et al., 2012). Furthermore, Ca2+ induces mtPTP and apoptosis (Annunen-Rasila, 2007). The transport of calcium into and out of the mitochondrion is affected by specific proteins and the increased level of Ca2+ in mitochondria causes the formation of mtPTP in the inner membrane .This pore allows large solutes to enter the mitochondrial matrix, causing osmotic swelling of the mitochondrion which dissipates the proton gradient, and stops ATP synthesis then initiates the release of apoptogenic factors (Nicholls and Budd, 2000).
2.3.3. Storage of calcium ions Mitochondrion constitutes a spatiotemporal buffering system for modulating cytosolic calcium (Ca2+) concentration. A low-affinity and high-capacity Ca2+ pump in the IMM have an important role in returning the Ca2+ concentration to normal after a Ca2+ signal. This mitochondrial Ca2+ pump uses the electrochemical gradient across the IMM during the electron transfer steps of OXPHOS to take up Ca2+ from the cytosol, where upon this Ca2+ stimulates and controls the rate of OXPHOS at many levels. Free Ca2+ ions in mitochondrion are important regulators of various metabolic enzymes, such as the dehydrogenases of the TCA cycle (Annunen-Rasila, 2007).
-14-
Chapter Two
Literature Review
2.3.4. Heat production Under certain conditions, the protons pumped out to the IMM by complexes I, III, and IV in ETC system, can re-enter to the mitochondrial matrix without contributing to ATP synthesis. This process is known as proton leak or mitochondrial uncoupling (Jastroch et al., 2010). It is due to the facilitated diffusion of protons from IMS into the matrix (Figure 2.9). The process results in the unharnessed potential energy of the proton electrochemical gradient that is released as heat. The process is mediated by a proton channel called thermogenin or uncoupling protein1 UCP1 (Patil et al., 2008).
Figure 2.9: A diagram of heat production in mitochondria (Berg F et al., 2006).
2.4. The origin of mitochondrion The emergence of the mitochondrion is considered a defining event in the evolution of eukaryotic cells. The most favored model for explaining this event is the serial endosymbiosis theory (Gray et al., 1999). It is generally believed that the energy-converting organelles mitochondria of eukaryotes evolved from prokaryotes which were engulfed by primitive eukaryotic cells and developed a symbiotic relationship with primitive eukaryotic cells about 1.5 billion years ago (Figure 2.10). This would explain why mitochondria have their own DNA (mtDNA) that codes for some of their proteins. Ever since their initial uptake by the host cells, these organelles have lost much of their own genome by either that part of the genome was -15-
Chapter Two
Literature Review
transferred to the nucleas or lost (deleted) completely from the genome due to the existence of the same genese on the host genome (Lang et al., 1999). Therefore, the organels have become heavily dependent on those genes in the nucleus (Finnilä, 2000), mitochondrial DNA polymerase forenstances is nDNA encoded enzyme. The genes did not evolve there but they moved. The main question in this aspectations is: why not all mitochondrial genes have been transferred to the nucleus? One possible answer could be that some mtDNA encoded proteins cannot be imported through the mitochondrial membranes because of their highly hydrophobic nature (de Grey, 1999).
Figure 2.10: Serial endosymbiosis theory (http://mrkingbiochemistry.wordpress.com/page/3/)
2.5. Human mitochondrial genome Human cell contains both nDNA and mtDNA. The cell typically contains 103–104 copies of mtDNA, the number varies widely with the cell type. MtDNA is circular covalently closed double-stranded DNA (Figure 2.11). The size of the genome is about 16569 bp (16.5 kb) and it replicates independently of nDNA. Furthermore, the genome of mitochondria is capable of transcription, translation and protein assembly (Chatterjee et al., 2006). It contains 37 genes, which includes 13 proteins (polypeptides) encoded genes that are involved in respiration and OXPHOS processes, as well as 22 tRNAs (transfe RNA) and 2 rRNA (ribosomal RNA) (12S and 16S) that all are essential components for protein synthesis in mitochondria (Urata et al., 2004). Whereby, the mtDNA polymerases, mtRNA polymerases, the ribosomal proteins and the mtDNA regulatory factors all are encoded by nDNA and imported to the mitochondria (Finnilä, 2000). -16-
Chapter Two
Literature Review
The two strands of mtDNA are different in their base composition: A guanine (G) rich heavy strand (H), and a cytosine (C) rich light strand (L). The heavy strand (H) contains 12 out of the 13 polypeptide-encoding genes, while the 13th is encoded by light (L) strand. Moreover, 14 out of the 22 tRNA genes are encoded by heavy strand (H) and the remainder 8 as well as both rRNA genes are encoded by light (L) strand (Table 2.1) (Finnilä, 2000).
Table 2.1: The coding genes on heavy- and light- strand of mitochondrial genome.
MtDNA strands
tRNA genes
rRNA genes
OXOPHOS protein genes
Arginine (R), Glycine (G), Lysine (K), Aspartic acid (D), Genes on the heavy strand (H)
Tryptophan (W), Methionine (M),
ND1, ND2, ND3, 12S rRNA
isoleucine (I), Leucine1 (L1),
and
Serine2 (S2), Histidine (H),
16S rRNA
Threonine (T), Leucine2 (L2),
ND4, ND4L, ND5, Cyt-b, three subunits of complex VI, ATPase 6 and ATPase 8
Valine (V), and phenylalanine (F) Cysteine (C), Genes on the light strand (L)
Asparagine (N),
Alanine (A), Glutamine (Q), Proline (P), Glutamic acid (E),
ND6
Serine1 (S1) and Tyrosine (Y)
The genome contains only 2 non-coding regions, which have a regulatory function. The largest region is the control region (D-loop), which consists of 1121 base pairs and it starts from positions 1-576 and 16024-16569 (Figure 2.11). As well as it is a hot spot for mutation and contains two hypervariable regions; HV1 that starts from nucleotide (nt) 16024–16383, and the second is HV2 starting from nt 57–372 (Sharma et al., 2005). The non-coding region contains first, the promoters for transcription of genes on both Hand L-strand promoters (HSP (HSP1 and HSP2) and LSP respectively). Second, it contains the H-strand origin of replication OriH (Wallace, 1999). This region is characterized by a triplestranded structure that is formed by the nascent H-strand which terminates prematurely and -17-
Chapter Two
Literature Review
remains annealed to the parental L-strand. This nascent strand, known as 7S DNA is about 700 nucleotides long and displaces the parental H-strand as a loop (Figure 2.11) (Fernández-Silva et al,. 2003). Although the D-loop region is highly variable between species, some conserved sequences are found and believed to be involved in replication (Tapper and Clayton, 1981). However, the exact function of these sequences is only partially understood. The second non-coding region is the light-strand origin of mtDNA replication (OriL), which is located within a tRNA cluster (Figure 2.11). It is 30 bp long and adopts a secondary stem-loop structure in its single stranded conformation (Tapper and Clayton, 1981).
Figure 2.11: The coding and noncoding regions of the human mitochondrial genome (Wanrooij and Falkenberg, 2010).
-18-
Chapter Two
Literature Review
2.5.1. DNA replication in mitochondria Mitochondrial DNA replication takes place throughout the cell cycle, independent of the nDNA. The regulation of mtDNA copy number per cell is thought to depend on the energy requirements of the cells, which vary between cell types and different physiological conditions. However, the molecular mechanism behind this essential regulation is not known. All factors required for mtDNA replication are nucleus-encoded and therefore, signaling pathways between mitochondria and the nucleus are required to synchronize mitochondrial biogenesis (Garesse and Vallejo, 2001). There are three models of mtDNA replication. All models are illustrated in Figure 2.12 and outlined here below:
2.5.1.1. Strand-displacement mode According to this model, DNA synthesis takes place unidirectional on both strands, the replication is asymmetric and initiates from two origins of replication (OriH and OriL). Furthermore, the replication is initiated by DNA polymerase Gamma (Ɣ) at OriH using an RNA primer transcript from the L-strand (Lee DY and Clayton, 1996). The H-strand synthesis proceeds two-thirds (2/3) of the mt genome, displacing the parental and the synthesis contenous until it reaches the OriL. OriL region folds to make a stem-loop structure, and L-strand synthesis is then initiated and proceeds back along the H-strand template. Consequently, mtDNA replication is bidirectional (Figure 2.12). In 2000, this model was questioned and it was suggested that mtDNA replication occurred in a conventional strand-coupled model. Moreover, a few years later, a third model for mtDNA replication was reported, which included ribonucleotide incorporation throughout the lagging strand “RITOLS” (Yasukawa et al., 2006). Currently, there is no consensus about the exact mechanism of mtDNA replication in mammals.
2.5.1.2. Strand-coupled model The strand-displacement model of mtDNA replication has been questioned by results obtained from two-dimensional agarose gel electrophoresis (2DAGE). This method separates DNA molecules by size and shape, and replication intermediates can be recognized according to running condition (Brewer and Fangman, 1987). Briefly, restriction fragments containing -19-
Chapter Two
Literature Review
conventional replication forks, that are essentially duplex DNA, produce a characteristic Y-arc on 2DAGE. In addition, information about origins of replication and replication pause sites can be obtained with 2DAGE. Analysis of mtDNA purified from human placenta has suggested the existence of fully double stranded replication intermediates, which is consistent with conventional coupled leading and lagging-strand DNA synthesis (Holt et al., 2000). Furthermore, 2DAGE analysis of replication intermediates from mammals indicated that strandcoupled mtDNA replication occurred in a bidirectional manner, initiating from a broad initiation zone near OriH. The OriH was suggested to be a fork arrest point (Bowmaker et al., 2003). However, these intermediates were later shown to be products of partial degradation of RNA/DNA hybrids, in which extensive RNA tracts were found covering the entire laggingstrand (Figure 2.12).
2.5.1.3. Ribonucleotide Incorporation Throughout the Lagging-strand (RITOL) model: A novel mtDNA replication model, entailing ribonucleotide incorporation throughout the lagging-strand, was then suggested called RITOLS model (Yasukawa et al., 2006). Like the strand displacement model, RITOLS DNA replication is unidirectional with H- and L-strands initiating in the control region and at OriL respectively with a significant delay between leadingand lagging-strand DNA syntheses. However, RNA would be first laid down in the laggingstrand and subsequently replaced by DNA in maturation steps. The function of RITOLS was explained as a mechanism to regulate transcription and replication. RNA tracts would represent a roadblock to transcription events while replication is taking place. The precise mechanism by which the provisional lagging strand RNA is synthesized and how it is replaced by DNA has not been addressed yet (Figure 2.12) (McKinney and Oliveira, 2013).
-20-
Chapter Two
Literature Review
Figure 2.12: Models of mtDNA replication (McKinney and Oliveira, 2013).
2.5.2. The structure of mitochondrial genes The mitochondrial genes are intron-less like other prokaryotic (bacterial) genes. On the other hand, the transcribed genes are tailed with a stretch of poly A like nDNA transcribed genes, and the stop codons (UAA, UAG, AGA, and AGG) in most of the genes are created by the polyadenylation. Some of the genes are overlapped (Gissi and Pesole, 2003).
2.5.3. RNA transcription in mitochondrial DNA The basal machinery needed for transcription initiation of mtDNA has been fully reconstituted in vitro and consists of a set of three proteins: mitochondrial RNA polymerase (POLRMT), which was first described in yeast (Greenleaf et al., 1986), mitochondrial transcription factor B2 (TFB2M), and mitochondrial transcription factor A (TFAM) (McCulloch et al. 2002). Interestingly, POLRMT is most closely related to bacteriophage RNA polymerases (Tiranti et al., 1997). Transcription is initiated from two specific sites within the control region (Figure 2.13), the HSP1 and HSP2 and LSP (Montoya et al., 1982). The HSP1, which lies fully within the D-loop, is responsible for the transcription of 12S and 16S rRNAs and intervening tRNAs. -21-
Chapter Two
Literature Review
Whereas, the minor or distal heavy-strand promoter HSP2 initiates the transcription within the sequence of the mitochondrial tRNAphe (phenylalanine tRNA). HSP2 transcribe the remainder mitochondrial mRNAs nearly the full length of the mtDNA. It has been postulated that HSP2 is regulated in an antagonistic manner compared to LSP and HSP1. Furthermore, the LSP transcrib 8 tRNAs and ND6 mRNA (Zollo et al., 2012). POLRMT can specifically recognize mitochondrial promoters. The first in vivo evidence that TFB2M is essential for mtDNA transcription was provided by studies in Drosophila melanogaster, where TFB2M gene silencing resulted in the abolishment of mitochondrial transcripts (Minczuk et al., 2011). The third transcription factor (TFAM) binds specifically to a region upstream of the HSP and LSP transcription initiation sites (Fisher and Clayton, 1985). TFAM causes a dramatic bending of the mtDNA at the promoter region resulting in DNA melting and allowing the recruitment of POLRMT and TFB2M to form the initiation complex (Shi Y et al., 2012).
Figure 2.13: A model of the transcription initiation machinery and promoters in mitochondria (Peralta et al., 2012).
2.5.4. Protein biosynthesis in mitochondrial The translational process in mitochondria is still not very well understood. In vitro translations have still not been successful, probably due to the difficulty of isolating sufficient mt-mRNA, and possibly because of the complicated modifications that the mRNA undergoes prior to be translated. Mitochondria contain their own machinery, for mRNA translation. The RNA components of this machinery (rRNAs and tRNAs) are mtDNA-encoded, while all other protein components -22-
Chapter Two
Literature Review
required for mitochondria translational machinery including ribosomal proteins, translational factors and aminoacyl-tRNA synthetases are encoded by nDNA and imported from the cytosol (Jacobs and Turnbull, 2005). The ribosomes (mitoribosomes) are exhibiting a sedimentation coefficient of 55S, which is composed of two subunits, a 28S small subunit (SSU) and 39S large subunit (LSU). SSU is composed of 12S rRNA and 29 proteins, while LSU is composed of 16S rRNA and about 50 proteins (Koc et al., 2001) The genetic code in mitochondria differs slightly from the universal genetic code that is used by both prokaryotes and the eukaryotic cells (Figure 2.14). For example, human mitochondria (Hmt) use the universal arginine codons AGG and AGA in addition to UAA and UAG as translational termination codons (stop cocdon). While, UGA which is a stop codon in universal genetic code, serves as a codon for Tryptophan in mitochondria. Furthermore, AUA has been reassigned to Methionine rather than serving as an Isoleucine codon.
Figure 2.14: The human genetic codes of human mitochondrial genome (http://www.mitomap.org/MITOMAP/HumanMitoCode).
-23-
Chapter Two
Literature Review
Moreover, the numbers of tRNA in mitochondria are restricted far below the minimum number necessary to translate all the codons of the genetic code according to the wobble hypothesis (Pel and Grivell, 1994). Additionaly, mitochondrial mRNA have a number of unusual characteristics such as: they are not 5’ caped (7-methylguanlyate cap structure) that can facilitate ribosome binding and direct it to the start codon. It contains a poly A sequence and forms a part of the stop codons, and contains no or very few 5’-untranslated region. The small subunit of animal mitoribosomes has the ability to bind these mRNA tightly in a sequence-independent manner and in the absence of initiation factors or initiation tRNA, unlike the prokaryotic and eukaryotic cytoplasmic systems.
Phases of mitochondrial translation Translation process in human mitochondrion is divided into three phases as illustrated in Figure 2.15 and outlined briefly here below:
1. Initiation phase It has been postulated that the first step in initiation complex formation is sequenceindependent binding of mRNA to the SSU (Bhargava and Spremulli, 2005). Mitochondrial translational initiation factor 3 (mtIF3) is thought to assist the mRNA to bind to the SSU so that the start codon AUG is correctly positioned at the peptidyl (P site) of the mitoribosome. Both Nformylmethionine–tRNA (fMet-tRNA) and mtIF2 can bind weakly to the SSU in the absence of mRNA and mtIF3 (Christian and Spremulli, 2009). The binding of fMet-tRNA to the SSU requires mtIF2, which is markedly enhanced by GTP (Ma and Spremulli, 1996). Recombining of the LSU with the SSU stimulates the dissociation of mtIF3 additionally; GTP hydrolysis on mtIF2 is triggered by the LSU, leading to its mtIF2-GDP release from the complex (Haque et al., 2008).
2.Elongation phase The basic steps in the elongation phase in mitochondria are the same as in bacteria. In this step, mitochondrial elongation factor (mtEFTu) forms a ternary complex with GTP and an aminoacylated tRNA (Pel and Grivel, 1994). It is proposed to be critical for translational
-24-
Chapter Two
Literature Review
accuracy through surveillance of aminoacyl-tRNAs for misacylation (Smit et al., 2010). mtEFTu protects the aminoacylated tRNA from hydrolysis. After a proofreading step, the mtEFTu carries the aminoacylated tRNA to the mitoribosomal aminoacyl or acceptor site (A-site) for the decoding of mRNA by codon-anticodon interactions on the SSU (Pel and Grivel, 1994). When the codon-anticodon hybridization occurs, GTP hydrolysis on mtEF-Tu is stimulated by the mitoribosome, resulting in the release of inactive mtEFTu-GDP form. The nucleotide exchange protein mtEFTs converts inactive mtEFTu-GDP to the active form mtEFTu·GTP. Upon the release of mtEFTu, the 3- end of the aminoacyl-tRNA moves into the peptidyl transferase center of the LSU where peptide bond formation is catalyzed, adding the new amino acid to the growing peptides (nascent peptids). The mitochondrial elongation factor G1 (mtEFG1) with bound GTP catalyzes the translocation step by conformational changes in both “mtEFG1” and the mitoribosome, during which the A-site and P-site tRNAs move to the P-site and exit E-sites of the mitoribosome and mRNA is advanced by one codon. Subsequently, the tRNA leaves the mitoribosome via the E-site and a new elongation cycle can start (Smits et al., 2010).
3. Termination phase This step begins when a stop codon (UAA, UAG, AGA or AGG) is encountered in the Asite. A mitochondrial release factor (mtRF1) recognizes the stop codon (Korostelev et a.l, 2008) and causes the protein that is attached to the last tRNA molecule in the P-site to be released. The ester bond between the tRNA and the nascent polypeptide is hydrolyzed, presumably by the peptidyl transferase center on the LSU triggered by the release factor, and this process is catalyzed by GTP. After the release of the newly synthesized protein, mitochondrial ribosome recycling factor (mtRRF) and mitochondrial elongation factor G2 (mtEFG2-GTP) together enable the mitoribosomal subunits tRNA and mRNA to dissociate from each other (Chrzanowska-Lightowlers et al.,2011), making the components available for a new round of protein synthesis. GTP hydrolysis are required for the release of mtRRF and mtEFG2-GDP from the LSU (Bhargava et al., 2004).
-25-
Chapter Two
Literature Review
Figure 2.15: Human mitochondrial protein translation phases (Smits et al, 2010).
2.5.5. Maternal inheritance The mtDNA is inherited maternally with a vertical non-Mendelian pattern. The mother transmits her mitochondrial genome to all her children. Therefore, only the female daughters will pass it to all the members in the next generation (Figure 2.16). This is due to the existence of high number of mitochondrion in the ovum, which is between 100 000 and 200 000 copies, compared to a few hundred copies in spermatozoids that are located in the tail ( de Grey, 1999). Additionaly, the spermatozoids mitochondria that can enter the fertilized ovum are eliminated through an active process (Levine and Elazar, 2011).
Figure 2.16: Maternal inheritance of mitochondrial DNA. -26-
Chapter Two
Literature Review
2.5.6. Mitotic segregation The phenotype of a cellular line can vary during cellular division since mitochondria are distributed at random between the daughter cells (Dowton and Slaugh, 1995). Therefore, if in one cell two different mtDNA populations exist (one normal and the other mutant heteroplasmia) during the cell divisions, three different genotypes can originate: homoplasmic for the normal mtDNA, homoplasmic for the mutant mitochondria and heteroplasmic for normal and mutant DNA (Figure 2.17). Therefore, the phenotype of a cell with heteroplasmia will depend on the percentage of mutant mitochondria it contains. If the number of damaged DNA molecules is relatively low, complementation with the normal DNA molecules will be produced and the genetic defect will not manifest itself. While the mutant mitochondria surpass a certain threshold manifested in a pathogenic phenotype (threshold effect) (Rossignol et al., 2003). That is, if ATP production is below the minimum needed for tissue function due to defective production of proteins in the mtDNA, the disease appears. The number of mitochondria is different in each organ and tissue depending on the amount of energy required for its function. Therefore, the tissues that are affected preferentially are vision, the central nervous system, skeletal muscles, heart, pancreas, kidney and liver (Solano A et al., 2001).
Figure 2.17: The segregation of mitochondrial DNA mutation during the cell division.
-27-
Chapter Two
Literature Review
2.6. Mutations in mitochondrial DNA 2.6.1. Mutation rates The rate of mutations in mitochondria is estimated to be 10 times higher than that in the nuclear DNA (Cummins, 2001). This higher mutation rate is due to lack of efficient DNA repair mechanisms such as nucleotide-excision repair (NER) and mismatch repair (MMR) systems. Morever, mtDNA is not bound to the histone-proteins that can protect it from oxidative damage due to the highly toxic ROS that are produced as by-products of OXPHOS, which damage the DNA (Bogenhagen, 1999; Fontenay, 2006 and Cummins, 2001).
2.6.2. Mutations related to human diseases Mitochondrial diseases are heterogeneous and multifaceted, and can present at any age. Clinical features may range from an acute to chronic (Mattman et al., 2011). The disease related to mitochondria was first described in the early 1960s, when systematic ultrastructural and histochemical studies revealed excessive proliferation of normal- or abnormal-looking mitochondria in the muscles of patients with weakness or exercise intolerance. The modified Gomori trichrome stain areas of mitochondrial accumulation looked purple, while the abnormal fibers were ragged-red fibers (RRF) and came to be considered the pathological hallmark of mitochondrial diseas (Figure 2.18)
Figure 2.18: Ragged-red fibers (RRF) (DiMauro, 2004).
-28-
Chapter Two
Literature Review
Furthermore, the first biochemical evidence of a mitochondrial dysfunction-loose coupling of oxidation and phosphorylation was reported in 1962 by Luft, a young woman with nonthyroidal hypermetabolism Luft syndrome ((Luft et al. 1962 and DiMauro, 2004).
These
disorders are especially interesting from the genetic point of view, because the respiratory chain is the only metabolic pathway in the cell that is under the dual control of the mtDNA and nDNA (Chen et al., 1999). Therefore, a genetic classification of the mitochondrial diseases distinguishes disorders due to mutations in mtDNA, and disorders due to mutations in nDNA, which are governed by the stricter rules of Mendelian genetics (Melov et al., 1999).
2.6.3. Types of mitochondrial mutations: 2.6.3.1. Mitochondrial DNA rearrangements Genome rearrangements of mtDNA can be either deletions of large fragment or more rarely duplications. Both types of mutation are heteroplasmic, are causing alteration of mtDNA those codes for the proteins and they can occasionally exist simultaneously in patients’ tissues (Finnilä, 2000). Large scale deletion The deletions ranged in size from 2 to 9 Kb in different sites in the mitochondrial DNA (DiMauro, 2004). More than 120 deletions have been identified, most are within direct repeats of varying lengths that were 3–13 nucleotides in length (Kogelnik et al. 1998). The most common large-scale deletions that are up to 50% are located between a 13-base pair direct repeat, which start from nucleotide 8470 - 8483 in the ATPase 8 gene and 13447 - 13460 in the ND5 gene and resulting of 4977 bps deletion (Moraes et al. 1989 and Solano A et al., 2001). A second common deletion site is positioned between the two direct repeats at nucleotide 8637 - 8646 and nucleotide 16,073 - 16,085 and resulting of 7.4 kbps deletion. Most of the described large-scale deletions of the mtDNA are spontaneous events that occur either in the oocyte or during the early stages of embryonic development (Wallace, 1994 and van de Corput et al., 1997). The three main clinical phenotypes that are associated with large-scale mtDNA deletions are:
-29-
Chapter Two
Literature Review
2.6.3.1.1. Pearson syndrome (PS) or Pearson Marrow-Pancreas syndrome The syndrome was first described by Pearson in 1979 (Pearson. 1979). It is very rare, less than hundred cases have been reported in medical literature worldwide. The syndrome is due to defective oxidative phosphorylation caused by large-scale deletion (4977 bps) of the mtDNA (van de Corput et al., 1997). This large deletion constitutes >30% of the entire mitochondrial genome and includes genes coding for subunits of cytochrome-c oxidase and NADHdehydrogenase. A rapidly fatal disorder of infancy characterized by sideroblastic anemia and exocrine pancreatic dysfunction. Other clinical features are failure to thrive pancreatic fibrosis with insulin-depended diabetes and exocrine pancreatic deficiency (Solano A et al., 2001). 2.6.3.1.2. Kearns–Sayre’s syndrome (KSS) Kearns-Sayre’s syndrome is caused by mitochondrial DNA deletion that varies from 1.3 to 8.0 Kb. The most common large-scale deletion is 4.9 Kbp and spans from nucleotide position (8469 to 13147) in the genome. This deletion is present in approximately one-third of people with KSS (Park et al. 2004). It is a multisystem disorder with onset before the age 20. The symptoms of the syndrome are impaired eye movements (progressive external ophthalmoplegia (PEO)), pigmentary retinopathy, and heart block. Frequent additional signs include ataxia, dementia, endocrine problems (diabetes mellitus, short stature, hypoparathyroidism), lactic acidosis, delayed sexual maturation, elevated cerebro-spinal fluid (CSF) protein (over 100 mg/dl), and RRF in the muscle biopsy is typical of laboratory abnormalities (DiMauro, 2004 and Solano A et al., 2001).
2.6.3.1.3. Chronic Progressive External Ophthalmoplegia (CPEO or PEO) A common deletion found in one-third of CPEO patients is a 4,977 bp found between direct repeats consists of 13 nucleotides. This disorder is characterized by slowly progressive paralysis of the extra-ocular muscles. Patients usually experience bilateral, symmetrical, progressive apoptosis, followed by ophthalmo paresis months to years later. Ciliary and iris muscles are not involved (DiMauro, 2004).
2.6.3.2. Point mutations -30-
Chapter Two
Literature Review
Point mutations have been identified in mtDNA from patients with a variety of disorders. The mutations are mostly in rRNA or tRNA genes, as well as genes encoding for proteins in respiratory chain complexes and multisystematic. The pathogenic point mutations are heteroplasmic. When the level of the mutant genome exceeds a certain threshold, the deleterious effects of the mutation will no longer be complemented by the coexisting of wild-type mtDNA and will be expressed phenotypically as a cellular dysfunction leading to disease (Wallace et al. 1997). Among the maternally inherited encephalomyopathies, two syndromes are more common (MELAS and MERRF) (Solano A et al., 2001). Although more than 50 deleterious point mutations have been identified to date, 4 mutations (A3243G ‘MELAS’, A8344G ‘MERRF’, T8993G ‘NARP’ and the G11778A ‘LHON’) are by far the most frequent. Others mutations are found less often, while still there are other mutations that have been described only in single individuals or families (Finnilä, 2000). The investigation of pathogenic mitochondrial DNA mutations has revealed a complex relation between patient genotype and phenotype (Schon A et al. 1997).
2.6.3.2.1. Mitochondrial Encephalomyopathy, Lactic Acidosis and Stroke-like episodes (MELAS) This disease is characterized by cerebrovascular accidents at an early age, which provokes sub-acute cerebral malfunction and changes in the cerebral structure and by lactic acidosis. These characteristics are usually accompanied by generalized convulsions, headaches, deafness, dementia and RRFs (Solano et al., 2001). The disease has been fundamentally associated with mutation in the human mitochondrial genes: 1) tRNALeu (UUR) gene at nucleotide positions “A3243G, A3251G, A3252G, C3256T, T3271C, T3291C, and T3308C). 2) tRNAVal (GUR) gene at nucleotide positions G1642A. 3) COXIII gene at nucleotide positions T9957C, and 4) 4-nucleotides deletion beginning at nucleotide 14787-14791 of cytochrom-b gene” (Rocha H et al., 1999). The point mutation A3243G in the tRNAleu is the most common mutation that has been identified in approximately 80% of the cases (Goto et al. 1990; Goto, 1995 and Urata et al., 2004). Therefore,this site has been considered as an aetiological hot spot for mtDNA mutations (Moraes et al., 1993 and Finnilä, 2000). -31-
Chapter Two
Literature Review
Furthermore, 7–15% of MELAS patients have been found to harbor the point mutation T3271C in tRNAleu while the remaining MELAS-associated point mutations are very rare (Morten et al., 1992, Moraes et al., 1993, Goto et al., 1994; GOTO, 1995 and Rocha H et al., 1999).
2.6.3.2.2. Myoclonic Epilepsy and Ragged Red Muscle Fibers (MERRF) This maternally inherited syndrome is characterized by myoclonic epilepsy, generalized convulsions and myopathy with the presence of ragged-red fiber. Other clinical symptoms are dementia, deafness, neuropathy, optical atrophy, respiratory failure and cardiomyopathy. It appears both in infancy and adulthood. The disease is associated with the presence of mutations in the mtDNA gene for tRNALys. In most of the cases, 80-90% are due to a mutation at the position A8344G, but other less common mutations have also been found such as T8356C and G8363A all in the heteroplasmic form (Wong et al., 2002). The percentage of the mutant variant in heteroplasmia that affects a patient varies between the young, which is about 95% and the older 60-70 years of age that is about 60% of mutant variant present in heteroplasmia (Solano A et al., 2001). Only 1 patient has been diagnosed with a MERRF syndrome that harbors a mutation in tRNAPhe at the position G611A (Mancuso et al., 2004). Thus, not surprisingly syndromes associated with tRNA mutations can affect every system in the body, including the eye (optic atrophy; retinitis pigmentosa and cataracts), hearing (neurosensory deafness), the endocrine system (short stature, diabetes mellitus and hypoparathyroidism), the heart (hypertrophic cardiomyopathies; conduction blocks), the gastrointestinal tract (exocrine pancreas dysfunction; intestinal pseudo-obstruction
and
gastroesophageal reflux), and the kidney (renal tubular acidosis). Any combination of the symptoms and signs listed above should raise the suspicion of a mitochondrial disorder, especially if there is evidence of maternal transmission (DiMauro, 2004).
2.6.3.2.3. Non-syndromic inherited hearing loss (deafness)
-32-
Chapter Two
Literature Review
The nonsyndromic deafness is associated with the damage in the structures of the inner ear that is called sensorineural deafness. This syndrom is caused by mutation in the 12S rRNA gene at position G709A (wei et al., 2009), which is a hot-spot for deafness-associated mutations in the Chinese population (Z Li et al., 2005).
2.6.3.3. Mutations in protein coding genes In this category, two syndromes are more common: 2.6.3.3.1. Maternally inherited Leigh syndrome (MILS) This syndrome is associated with two different mutations at the nucleotide position 8993 of the ATPase6 gene and the mutation can be either T8993G or T8993C respectively, in which both of the mutations are converting a conserved leucine (CUG) to arginine (CGG) (Uziel et al., 1997 and Finnilä, 2000). This adult-onset syndrome is characterized by developmental delays, altered control over breathing, neurogenic muscular weakness with prominent effects on swallowing, speech and eye movements, ataxia and pigment retinitis. It usually involves dementia, convulsions and axonal sensory neuropathy RRFs are absent in a muscle biopsy (Tatuch et al, 1992; Finnilä, 2000 and Solano A et al., 2001),). 2.6.3.3.2. Leber’s Hereditary Optic Neuropathy (LHON) This disease is associated with three point mutations in mitochondrial OXPHOS system complex I genes (ND genes). These are G11778A in ND4, G3460A in ND1 and T14484C in ND6 (DiMauro, 2004). G11778A is responsible in 50-70% of the cases and causes the most severe form of the disease (Solano A et al., 2001 and Tatuch et al, 1992). It is characterized by acute or subacute painless loss of vision usually in one eye and subsequently affects the other eye weeks or months later (Finnilä, 2000), this is caused by atrophy of the optic nerve in young adults more frequently males and with onset in the second or third decade of life, due to bilateral optic atrophy (Carelli, 2002), exercise intolerance, myalgia and sometimes recurrent myoglobinuria (DiMauro, 2004).
-33-
Chapter Two
Literature Review
2.7. Mitochondrial genome and origin of Homo sapiens Archaeology and some historical evidence beside the resent advance in the human mitochondrial genetics have been used to infer the geographical origin of human evolution and ancestors of the human population (Brown et al., 1992; Torroni et al., 1996; González et al., 2006 and Wallace et al., 1999). The two contrasting models (Out-of-Africa hypothesis and multiregional evolution hypothesis) have been traditionally used to explain the origin of Homo sapiens. Both models have been subjected to intense criticism, but most of the evidence that has emerged over the last 15 years has been supportive to the Out-of-Africa hypothesis. This hypothesis postulates that Homo sapiens originated in Africa and the original African population is the ancestor of all present human populations (Nei, 1995 and Tishkoff and Williams, 2002). The first anatomically modern humans evolved from a small population of about 10,000 people in Africa 100,000 200,000 years ago (Nei, 1995). As the population evolved, it spread along the coastal zones of Africa into Asia for about 60,000 to 70,000 years ago, and in to Europe 40,000 to 50,000 years ago then they migrated from Asia and Europe to colonies America (Wallace et al., 1999 and Maca-Meyer et al., 2001). Furthermore, Templeton (1993) puts forward a refined definition of the Out-of-Africa hypothesis, which she termed the Eve or mitochondrial Eve hypothesis. The mitochondrial Eve hypothesis postulates that all the variation in mtDNA exhibited in Homo sapiens beings was derived from a single female predecessor most recent common ancestor (MRCA). Since mtDNA does not recombine and is maternally inherited in primates, it can be hypothesised that all copies of human mtDNA can be traced to a common female ancestor. This common female ancestor inhabited the African continent, around 200,000 years ago (Tishkoff and Williams, 2002). Furthermore, the Out-of Africa hypothesis is also supported by archeological finding, in which iron tool-making technology evolved much earlier in sub-Saharan Africa 90,000 years ago than in Europe 40,000 years ago. The body size and the proportions of the human body parts have been used as indicators of ethnicity, nutritional history, socioeconomic status and a measure of adaptation to the temperature of that individual (Bogin and Rios, 2003). Geographical distribution, similarities in languages, skin colour and surnames have also been used to infer phylogenetic relationships among humans (Sykes and Irven, 2000; Parra et al., 2004 and Vigilant et al., 1989). However, -34-
Chapter Two
Literature Review
the highest possible resolution for evolutionary analysis of populations is provided by DNA sequences (Vigilant et al., 1989). One tool used in modern evolutionary analysis of populations is the mitochondrial DNA study, the two regions of mtDNA (coding region and non-coding (Dloop) region) are used in human evolution origin (Wilkinson-Herbots et al., 1996). The D-loop is the most variable region and the most polymorphic nucleotide sites within this loop are concentrated in two hypervariable regions (HV1 at positions 16024–16383, and HV2 at positions 57–372) and the remaining part is the coding region. Furthermore, some neutral point polymorphism mutations are used in human evolution origin. The human evolution and the origin have been studied by either mtDNA restriction site variants, or by sequencing of whole mtDNA and compare to the revised Cambridge Reference Sequence (rCRS) for human mitochondrial DNA that was first published in 1981 (Finnilä, 2000). As humans migrated out from Africa, their mtDNA accumulated variations from our most recent common ancestor (MRCA) mitochondrial Eve was transferred to next generation. These variations and their combinations divide humans into haplogroups or groups of haplotype having the same single nucleotide polymorphism (SNP) that are characteristic of certain ethnic groups. (Torroni et al. 1996 and Wallace et al. 1999.) Moreover, the haplogroups of mtDNA show geographical and continental distributions, which are denoted by English capital letters. The letter names of the haplogroups run from A to Z and some subgroups of each letter for each haplogroups were divided into sub-haplogroups (clades), which are denoted by English number excepte four superhaplogroups writen by this system (L0, L1, L2, and L3). The clades were divided to sub-clades which are denoted by small Engilsh letters (a to z) the sub-clades divided to branch and branch to sub-branch. As haplogroups were named in the order of their discovery, they do not reflect the actual genetic relationships (Figure 2.19) (Torroni et al. 1996). The African haplogroups were subsequently assigned to a lineage which was conventionally termed L (mitochondrial Eve) (Chen et al., 1995) and that contains several superhaplogroups (L0, L1, L2, and L3). European haplogroups are H, I, J, K, T, U, V, W and X. The Asian or Native American haplogroups (A, B, C and D) can be identified (Niemi et al. 2003, Herrnstadt & Howell 2004). All non-African mtDNA sequences belong to the superhaplogroups (M and N) appear to be descendents from the haplogroup L3. All the European haplogroups belong to superhaplogroup N, whereas the Asian or Native American haplogroups belong to both -35-
Chapter Two
Literature Review
M and N superhaplogroups. It has been shown that the European haplogroups H and V, and correspondingly J and T are sister clades and that haplogroup K is actually a subgroup of haplogroup U. Additional haplogroups and sub-haplogroups are still likely to be identified, e.g. In Asian and Native American populations. This is illustrated in Figure 2.20 (Herrnstadt & Howell. 2004). It has been proposed that the different haplogroups may modulate the function of the MRC, so that certain haplogroups may predispose individuals to or protect them against certain diseases (Wallace et al. 1999), such as type 2 diabetes mellitus (Tanaka et al., 2004). Haplogroups have also been associated with physiological conditions, including ageing intelligence quotient and adaptation to cold climates (Skuder et al. 1995; Niemi et al. 2003 and Annunen-Rasila, 2007).
-36-
Chapter Two
Literature Review
-36-
Chapter Two
Literature Review
MRCA (Mitochondrial Eve)
3594 16189 16278
2352 750 150
16223 10873
16147 16172 16248 16320 16355 204
2706 7028 73
Next page -37-
Chapter Two
Literature Review
3010
1438
6776
3992 5004 9123
4769 73
709 13101162 88 146
4336
750 315 +C 309 +C 204 73 8860
H2a2a
15326
CRS
Start Here
263
4793
3591 4310 13020 16168
14470
8448 13579 16311 195
3936 14552 195
7645 10217 11377
6253 55 57
10394
2259
Figure 2.19: All mitochondrial DNA haplogroups and mutations site (http://www.genebase.com/doc/mtdnaHaplogroupTree_Ref.pdf)
-38-
3915
Chapter Two
Literature Review
Figure 2.20: World mitochondrial DNA migration (Barbieri., 2011)
-39-
Linguistic Evaluation Certification
I hereby certify that this thesis has been read and checked and after indicating all the grammatical and spelling mistakes; the thesis was given again to the candidate to make the adequate correction. After the second reading, I found that the candidate corrected the indicated mistakes. Therefore, I certify that this thesis is free from mistakes.
Name: Ari Mohammed Abdulrahman Signature: Date:
/
/ 2014
English Department / College of Languages / Sulaimani University.
Linguistic Evaluation Certification
I hereby certify that this thesis has been read and checked and after indicating all the grammatical and spelling mistakes; the thesis was given again to the candidate to make the adequate correction. After the second reading, I found that the candidate corrected the indicated mistakes. Therefore, I certify that this thesis is free from mistakes.
Name: Ari Mohammed Abdulrahman Signature: Date:
/
/ 2014
English Department / College of Languages / Sulaimani University.
List of Abbreviations
LIST OF ABBREVIATIONS Abbreviations
Details
2DAGE
Two Dimensional Agarose Gel Electrophoresis
A A site Acetyl-CoA ATP ATPase 6 ATPase 8 bp C
Alanine Amino Acid Aminoacyl or Acceptor Site Acetyle Co-Enzyme A Adenosine Triphosphate Adenosine Triphosphatase 6 Adenosine Triphosphatase 8 Base Pair Cysteine Amino Acid
Ca2++ CO2 CPEO CSF Cyt-b D D-loop
Calcium Ion Carbone Dioxide Chronic Progressive External Ophthalmoplagias Cerebro-Spinal Fluid Cytochrom-B Aspartic Acid Amino Acid Displacement Loop
E E site EDTA ETC F FADH2 FADH2-CoQ
Glutamic Acid Amino Acid Exit Site Ethylene Diamine Tetra Acetic Acid Electron Transport Chain Phenylalanine Amino Acid Flavin Adenine Dinucleotide Flavin Adenine Dinucleotide Co-Enzyme Q
fMet-tRNA G GDP GTP H H2O2 Hmt
N-Formylmethionine-Trna Glycine Amino Acid Guanosine Diphosphate Guanosine Triphosphate Histidine Amino Acid Hydrogen Peroxide Human Mitochondria
HSP1 HSP2
Heavy Strand Promoter 1 Heavy Strand Promoter 2
H-strand HV1
Heavy Strand Hypervariable 1
HV2
Hypervariable 2 -IX-
List of Abbreviations
I IMM IMS iP K
Isoleucine Amino Acid Inner Mitochondrial Membrane Inner Membrane Space Inorganic Phosphate Lysine Amino Acid
Kb KD KISSR KSS L1
Kilo Base Pair Kilo Dalton Kurdistan Institution For Strategic Studies And Scientific Research Sulaimamia Kearns-Sayre’s Syndrome Leucine1 Amino Acid
L2 LHON LSP
Leucine2 Amino Acid Leber’s Hereditary Optic Neuropathy Light Strand Promoter
L-strand LSU
Light Strand Large Ribosomal Subunit
M MELAS
Methionine Amino Acid Mitochondrial Encephalomyopathy, Lactic Acidosis and Stroke-Like Episodes
MERRF MILS MMR MRCA mRNA mtDNA mtEFG1 mtEFG2 mtEFTu
Myoclonic Epilepsy and Ragged Red Muscle Fibers Maternally Inherited Leigh Syndrome Mismatch Repair Most Recent Common Ancestor Messenger RNA Mitochondrial DNA (Genome) Mitochondrial Elongation Factor G1 Mitochondrial Elongation Factor G2 Mitochondrial Elongation Factor Tu
mtIF2 mtIF3
Mitochondrial Translational Imitational Factor 2 Mitochondrial Translational Initiation Factor 3
mtPTP mtRRF
Mitochondrial Permeably Transition Pore Mitochondrial Ribosomal Recycling Factor
MTS N NADH NADH-CoQ NARP ND1 ND2
Marix targeting sequence Asparagine Amino Acid Nicotinamide Adenine Dinucleotide Nicotinamide Adenine Dinucleotide Co-Enzyme Q Neuropathy, Ataxia, and Retinitis Pigmentosa NADH Dehydrogenase 1 NADH Dehydrogenase 2 -X-
List of Abbreviations
ND3 ND4 ND4L ND5 ND6 nDNA NEB NER nt O2.OH• OMM OriH OriL
NADH Dehydrogenase 3 NADH Dehydrogenase 4 NADH Dehydrogenase 4L NADH Dehydrogenase 5 NADH Dehydrogenase 6 Nuclear DNA (Chromosomes) New England Biolab Nucleotide-Excision Repair Nucleotide Superoxide anion hydroxyl radical Outer Mitochondrial Membrane Heavy strand Origin of replication Light strand Origin of replication
OXOPHOS P P site PCD PCR PEO POLRMT PS
Oxidative Phosphorylation Proline amino acid Peptidyl Site Programmed Cell Death Polymerase Chain Reaction Progressive External Ophthalmoplagias Mitochondrial RNA polymerase Pearson Syndrome
Q R
Glutamine amino acid Arginine amino acid
rCRS RFLP RITOLS ROS RRF
Revise Cambridge Reference Sequence Restriction Fragment Length Polymorphism Ribonucleotide Incorporation Throughout the Lagging Strand Reactive Oxygen Species Ragged-Red Fibers
rRNA S1 S2 SNP
Ribosomal RNA Serine1 Amino Acid Serine2 Amino Acid Single Nucleotide Polymorphism
SSU T TBE
Small Ribosomal Subunit Threonine Amino Acid Tris Boric Acid EDTA
TFAM TFB2M
Mitochondrial Transcription factor A Mitochondrial transcription factor B2 -XI-
List of Abbreviations
tRNA UCP1
Transfer RNA Uncoupling protein 1
V W Y
Valine amino acid Tryptophan amino acid Tyrosine amino acid
Δ
Delta
-XII-
List of Figures
LIST OF FIGURES Title
Page
Figure 2.1: Left electron microscope figure of mitochondrionand right schematic diagram of a surface cut mitochondrion with its internal structure.
1
Figure 2.2: Chemical structure of diphospholipid
Figure 2.3: Stages of cellular respiration Figure 2.4: Steps of glycolysis
2 5 6
Figure 2.5: Steps of Krebs (citric acid) cycle
7
Figure 2.6: Schematic representation of oxidative phosphorylation Figure 2.7: The generation of reactive oxygen species (ROS) Figure 2.8: A diagram of cellular respiration and energy production calculation Figure 2.9: A diagram of heat production in mitochondria
9 10 10 12
Figure 2.10: Serial endosymbiosis theory Figure 2.11: The coding and noncoding regions of the human mitochondrial genome
13 15
Figure 2.12: Models of mtDNA replication Figure 2.13: A model of the transcription initiation machinery and promoters in mitochondria
18 19
Figure 2.14: The human genetic codes of human mitochondrial genome
Figure 2.15: Human mitochondrial protein translation phases
20 23
Figure 2.16: Maternal inheritance of mitochondrial DNA Figure 2.17: The segregation of mitochondrial DNA mutation during the cell division Figure 2.18: Ragged-red fibers (RRF) Figure 2.19: All mitochondrial haplogroups and mutations site Figure 2.20: World mitochondrial DNA migration Figure 3.1: Four overlapped fragments (A, B, C and D)
23 25 25 38 39 48
Figure 4.1: Four overlapping PCR fragments (A, B, C and D).
57 58 59
Figure 4.2: Sub-fragments of fragment A, B and C of sample number 1 Figure 4.3: Sub-fragments a) A1D and b) E23D of fragment D for all samples. Figures 4.4 a, b, c, d, e and f: Fragment A digested by one cutter enzymes ClaI, EcoRV, KpnI, PvuII, SpeI and SphI respectively
63
Figures 4.5 a, b and c: Fragment A digested by two cutters enzymes ApaI, EcoRI and XbaI respectively
65
Figures 4.6 a and b: Fragment B digested by one cutter enzymes EcoRV and NdeI respectively
67 68
Figures 4.7 a and b: Fragment B digested by two cutters enzymes ApaI, and PstI respectively Figures 4.8 a, b, c and d: Fragment C digested by one cutter enzymes EcoRI, EcoRV, SpeI and XhoI respectively Figures 4.9 a and b: Fragment C digested by two cutter enzymes BstBI and HindIII respectively
-VII-
71 72
List of Figures
Figure 4.10: Fragment C digested by three cutters enzyme AvaI
73
Figure 4.11: Electropherogram and sequence alignment for transition mutation G709A in12S rRNA gene.
75 75
Figure 4.12: Location of G709A point mutation on secondary structure of 12S rRNA. Figure 4.13: Electropherogram and sequence alignment for transition mutation G1888A of 16S rRNA gene. Figure 4.14: Location of G1888A point mutation on secondary structure of 16S rRNA. Figure 4.15: Electropherogram and sequence alignments for transition mutations at T4216C and A4917G in the T-ND1 (left) and MT-ND2 (right) genes respectively. Figure 4.16: Electropherogram and sequence alignment for insertion mutation C in the ND1 gene at nucleotide position 3996 (+C 3996). Figure 4.17: Electropherogram and sequence alignment for insertion mutation C in the ND2 gene at nucleotide position 5437 (+C 5437). Figure 4.18: Amino acids sequence beyond the insertion mutation (+C 3996) of ND1 gene. Figure 4.19: Amino acids sequence beyond the insertion mutation (+C 5437) of ND2 gene.
76 77 79 79 80 80 80
Figure 4.20: Electropherogram and sequence alignment for deletion mutation (T) from cytochrom-b gene at nucleotide position 15721 (T 15721).
81
Figure 4.21: acids sequences beyond the deletion mutation (T 15721) in cytochrom-b gene.
82
Figure 4.22: Electropherogram and sequence alignments for heterosome mutation in the cytochrom-c gene (complex I) at the position 6737 (A6737C). Figure 4.23: Electropherogram and sequence alignment for heterosome mutation in the ND4L gene at the position 10617 Figure 4.24:(10617 Electropherogram and sequence alignments for heterosome point mutation in the ND4 A=G).
83 83 84
gene at the position 11304 (C11304G). Figure 4.25: Haplogroup H back migration from Europe to Asia.
-VIII-
86
List of Tables
LIST of TABLES Title
Page
Table 2.1: The coding genes on heavy- and light- strand of mitochondrial genome
17
Table 3.1: A list of Instruments and equipment Table 3.2: A list of chemicals and materials Table 3.3: A list of enzymes and kits Table 3.4: A list of the amplification primers Table 3.5: A list of the sequencing primers Table 3.6: The size of the 4 fragments Table 3.7: The size of semi-nested sub- fragments Table 3.8: The size of nested sub-fragments Table 3.9: Restriction enzymes Table 4.1: A list of one cutter restriction enzymes digesting fragment A Table 4.2: A list of 2 cutters restriction enzyme digesting fragment A
40 41 42 44 44 48 53 54 54 60 64
Table 4.3: A list of one cutter restriction enzymes digesting fragment B Table 4.4: A list of 2 cutters restriction enzymes digesting fragment B Table 4.5: A list of one cutter restriction enzymes digesting fragment C Table 4.6: A list of 2 cutters restriction enzymes digesting fragment C Table 4.7: A list of amino acid substitution mutations Table 4.8: A list of heterosome mutations Table 4.9: Common Single Nucleotide Polymorphisms (SNP) between the 8 tested samples Table 4.10: Single Nucleotide Polymorphisms may be related to lineage and forensic DNA
66 67 69 71 78 82 85 86
Table 4.11: New point mutations
87
-VI-
Chapter Three
Materials and Methods
3. MATERIALS AND METHODS 3.1. Materials 3.1.1. Tools and apparatus: The current study was carried out in the Microbiology Laboratory at Kurdistan Institute for Strategic Studies and Scientific Research in Sulaimani (KISSR) and a part of the work was carried out in the Microgene Diagnostic Laboratory at Harem Private Hospital in Sulaiman. The equipment used in both centers is listed in Table 3.1. Table 3.1: A list of instruments and equipment.
Equipment name
Company
Autoclave (YX-280B) Biophotometer (AG 22331) Centrifuge (5417R) Concentrator (AG22331) Deep freezer (-20oC) Deep freezer (-35oC) Deep freezer (-40oC) Distilled water system Electrophoresis power supply (EV265) Electrophoresis units (Maxfill) Electrophoresis units (Owl D2) Gel documentation system (UVT-28ME) Glassware Ice maker Magnetic agitator with heating Micropipette different size (0.5 -1ml) Micropipette tips different size Microtubes Microwave oven Nanopure system (7146) Oven pH meters(765 Calmatic) Refrigerator(+4oC)
Ningbo Hinotek Eppendorf Eppendorf Eppendorf LIEBHERR FROILABO GFL Comtech BioSurplus SIGMA Thermo Herolab Duran Ziegra IKA Eppendorf Eppendorf Eppendorf General Thermo Heraeus Knick LIEBHERR -40-
Country China Germany Germany Germany Germany Australia India Taiwan U.S.A Germany U.S.A Germany Germany U.K Germany Germany Germany Germany U.S.A U.S.A Germany New Zealand Germany
Chapter Three
Materials and Methods
Sensitive balance Thermo mixer Thermocycler (9700) Veriti® Thermocycler (PCR)
Sartorious Eppendorf Applied Biosystems Applied Biosystems
Germany Germany U.S.A U.S.A
Vortex Vortex (MS)
Applied Biosystems IKA
U.S.A Germany
3.1.2. Chemicals and buffers All chemicals and buffers listed in Table 3.2 were of highest purity and have been purchased from Fermentas/U.S.A, SIGMA-Aldrich/U.S.A and NEB/UK. Table 3.2: A list of Chemicals and Materials.
Chemical and materials
Company
6X DNA loading dye Agarose Agarose Boric acid DNA ladders (100bps and 1kbs) Ethanol 96% Ethidium bromide Ethylene Diamine Tetra Acetic acid(EDTA) Novel Juice (Safe stain) Tris base Ultra pure distilled water RNAse, DNAse free
NEB and Fermentas Cinnagen SIGMA Applichem NEB ACROS SIGMA ROTH Genedirex ROTH Fermentas
3.1.3. Enzymes and kits Molecular biology protocols are highly dependent on the quality of the enzymes and their buffers. Therefore, the enzymes were ordered from well-known companies as listed in Table 3.3.
-41-
Chapter Three
Materials and Methods
Table 3.3: A list of enzymes and kits.
Enzymes and kits
Company
AccuPower® ProFi Taq PCR PreMix(K-2631)
Bioneer
GeneJET™ genomic DNA purification kit
Fermentas
GeneJET™gel extraction kit GeneJET™PCR purification kit LongAmp® Taq PCR kit GoTaq® green master mix Taq polymerase and buffers 10X NEB buffer 4 ApaI AvaI BstBI ClaI EcoRI-HFTM EcoRV-HFTM HindIII-HFTM KpnI-HFTM NcoI-HFTM NdeI PstI-HFTM PvuII-HFTM SpeI-HFTM SphI-HFTM XbaI XhoI
Fermentas Fermentas NEB Promega Fermentas NEB NEB NEB NEB NEB NEB NEB NEB NEB NEB NEB NEB NEB NEB NEB NEB NEB
3.1.4. Electrophoresis (buffers and solutions) 3.1.4.1. Novel juice (safe stain) It was purchased from Genedirexas/UK as a solution, and 1µg / ml the solution were used in the experiment as stored in a dark bottle at room temperature or refrigerator (+4oC).
-42-
Chapter Three
Materials and Methods
3.1.4.2. Ethidium bromide It was purchased from SIGMA-Aldrich/U.S.A as powder and dissolved in ddH2O at a concentration of 1µg/ml, then the solution was stored in a dark bottle at room temperature or refrigerator (+4oC) 3.1.4.3. Ethylene Diamine Tetra Acetic acid (0.5 M EDTA): One litter of 0.5M EDTA buffer was prepared by dissolving 404.476g of EDTA in 800ml distilled water. The solution was agitated vigorously on magnetic stirrer and the pH was adjusted to 8.0 with 1N NaOH. The volume was completed to 1L with distilled water and sterilized by autoclave (Sambrook and Russell, 2001). 3.1.4.4. Tris-Boric acid-EDTA buffer (5X TBE) One liter of 5X stock solution of TBE buffer was prepared by dissolving 54g of Tris-base, and 27.5g of Boric acid in 800ml ddH2O, then 20ml of 0.5M EDTA (pH8.0) was added, the solution was agitated on magnetic terrier, and the volume was then adjusted to 1Liter by adding ddH2O (Sambrok et al., 1989). 3.1.4.5. 6X loading buffer (Dye): Loading buffer was purchased from Fermentas/U.S.A and stored at +4oC
3.2. Methods 3.2.1. Sterilization All solutions were autoclaved at 121°C p/inch2 for 15 minutes, while dry sterilization in oven was used for glassware at 180°C for 2 hours. 3.2.2. pH adjustment pH of the solutions was adjusted by using 765 (Calmatic pH meter).
-43-
Chapter Three
Materials and Methods
3.2.3. Primer design All the primers were purchased from Cybergen AB/Seweden. The designs of the primers were based on the Revised Cambridge Reference Sequence (rCRS) of the Human Mitochondrial DNA from the Entrez database, accession number NC_012920 provided by the National Centre of Biotechnology Information NCBI (http://www.ncbi.nlm.nih.gov). For complete human mitochondrial genome amplification and sequencing, twenty eight (28) primers were used (5 forwards and 23 reverses). All the primers are listed below in Tables 3.4 and 3.5. Table 3.4: A list of the amplification primers.
Name
Polarity
Mt.A.F
Forward
5'-AGG TCT ATC ACC CTA TTA ACC ACT CA -3
7-32
54oC
Mt.B.F
Forward
5'- CAA GAG CCT TCA AAG CCC TCA GTA-3'
5535-5558
52oC
Mt.C.F
Forward
5'- ACG CCA CTT ATC CAG TGA ACC ACT-3'
11002-11025
52oC
Mt.D.F
Forward
5'- CCT AGC AAT AAT CCC CAT CCT CCA -3'
15646-15669
52oC
Mt.2.R
Reverse
5'- TGA GCA AGA GGT GGT GAG GTT GAT-3'
1251-1228
52oC
Mt.9.R
Reverse
5'- GGG CAC CGA TTA TTA GGG GAA CTA -3'
6171-6148
52oC
Mt.16.R
Reverse
5'- TAT GAG AAT GAC TGC GCC GGT GAA -3'
11707-11684
52oC
Mt.23.R
Reverse
5'- CGT GAT GTC TTA TTT AAG GGG AAC GT -3'
16566-16541
54oC
Sequence
Position
Tm
Table 3.5: A list of the sequencing primers.
Name
Polarity
Mt.E.F
Forward
Mt.1.R Mt.3.R
Sequence
Position
Tm
5'- CCT CAC CCA CTA GGA TAC CAA CAA -3'
16261-16284
52oC
Reverse
5'- TGA ACT CAC TGG AAC GGG GAT GCT -3'
723-700
54oC
Reverse
5'- GCA GAA GGT ATA GGG GTT AGT CCT -3'
1852-1829
52oC
-44-
Chapter Three
Materials and Methods
Mt.4.R
Reverse
5'- ATG CCT GTG TTG GGT TGA CAG TGA -3'
2439-2416
52oC
Mt.5.R
Reverse
5'- TCT TGT CCT TTC GTA CAG GGA GGA -3'
3138-3115
52oC
Mt.6.R
Reverse
5'- CTG AGA CTA GTT CGG ACT CCC CTT -3'
3934-3911
54oC
Mt.7.R
Reverse
5'- CGG TTG CTT GCG TGA GGA AAT ACT -3'
4665-4642
52oC
Mt.8.R
Reverse
5'- GGA GTA GTG TGA TTG AGG TGG AGT -3'
5385-5362
52oC
Mt.10.R
Reverse
5'- GGA GTG TGG CGA GTC AGC TAA ATA -3'
6885-6862
52oC
Mt.11.R
Reverse
5'- AAG GGC ATA CAG GAC TAG GAA GCA -3'
7711-7688
52oC
Mt.12.R
Reverse
5'- AGG GAG GTA GGT GGT AGT TTG TGT -3'
8477-8454
52oC
Mt.13.R
Reverse
5'- GGG GTC ATG GGC TGG GTT TTA CTA -3'
9258-9235
54oC
Mt.14.R
Reverse
5'- TAT AGG GTC GAA GCC GCA CTC GTA -3'
10190-10167
54oC
Mt.15.R
Reverse
5'- GTG AGG GGT AGG AGT CAG GTA GTT -3'
10986-10963
54oC
Mt.17.R
Reverse
5'- TAG GGA AGT CAG GGT TAG GGT GGT -3'
12381-12358
54oC
Mt.18.R
Reverse
5'- AGT GCT TGA GTG GAG TAG GGC TGA -3'
13089-13066
54oC
Mt.19.R
Reverse
5'- AAT CCT GCG AAT AGG CTT CCG GCT -3'
13733-13710
54oC
Mt.20.R
Reverse
5'- GCT ATT GAG GAG TAT CCT GAG GCA -3'
14454-14431
52oC
Mt.21.R
Reverse
5'- TGC AAG CAG GAG GAT AAT GCC GAT -3'
15112-15089
52oC
Mt.22.R
Reverse
5'- GGT AGC TTA CTG GTT GTC CTC CGA -3'
15782-15759
54oC
A region with appropriate GC and AT content, free from hairpin and self- dimer was chosen for designing the primers; the length, melting temperature and hetero-dimer were designed with coordinating between forward and reverse primers. The GC and AT content, hairpin,
self-dimer
and
hetero-dimer
were
checked
by
online
internet
program
(http://www.idtdna.com/analyzer/applications/oligoanalyzer/) and the melting temperatures were calculated according to the following formula: TmoC = 2 (A+T) + 4 (G+C)
and TaoC = Tm – 20 ±5
Tm=melting temperature Ta=annealing temperature A=adinine , C=cytosine, G=guanine, and T=thymine.
-45-
(Womble, 2000)
Chapter Three
Materials and Methods
3.2.4. Studied cases In this study, venous bloods were obtained from eight Kurdish people, used for: First, possible variations in the variable regions and second, mutations in the mitochondrial genome that are supposedly related to the diseases (mitochondrial disease), which are based on symptoms and clinical signs. In this regard, 5 of the cases in this current study are suspected to harbor mitochondrial disease (mutation). 3.2.5. Sample processing Venous blood was obtained from the cases by vein puncture. 3 to 5 ml of blood were collected, using a disposable syringe and sterile non-coagulated test tube. The blood samples were transferred on ice to the Microbiology Laboratory at Kurdistan Institute for Strategic Study and Scientific Research in Sulaimani (KISSR). 3.2.6. Experimental strategy The plan of the study was carried out in the following steps: 3.2.6.1. Whole blood DNA extraction Total blood DNA was extracted using GeneJET Genomic DNA Purification Kit (Fermentas/U.S.A) which consists of:
Protenase K solution.
RNase A solution.
Lysis solution.
Wash buffer I (concentrated).
Wash buffer II (concentrated).
Elution buffer (10 mM Tris-HCl, pH 9.0, 0.5 mM EDTA).
GeneJET genomic DNA purification columns pre-assembled with collection tubes
Collection tubes (2ml).
10 ml of concentrated wash buffers I and II from the kit were diluted by adding 30ml of 96% ethanol and the final volume is 40ml.
-46-
Chapter Three
Materials and Methods
Steps of the work: 1) In 1.5ml microcentrifuge tube, 400μl of Lysis solution and 20μl of proteinase K solution were added to 200μl of whole blood and the cocktail was mixed by vortexing to obtaine uniform suspension. 2) The sample was incubated at 56oC for 10 minutes with interval vortexing (2minutes) of the suspension. 3) 200μl of 96% ethanol were added to the sample and mixed by vortexing. 4) The prepared lysate was transferred to a GeneJET Genomic DNA purification column inserted in 2ml collection tube and centrifuged for 1min at 6000xg. 5) The collection tube containing the flow-through solution was discarded, and the column was transferred to a new 2ml collection tube. 6) 500μl of wash buffer I were added to the column, and then centrifuged for 1min at 8000xg. The flow-through was discarded and the purification column was placed back into the collection tube. 7) 500μl of wash buffer II were added to the column and centrifuged for 3min at maximum speed (12000xg). The flow-through solution was discarded and the GeneJET genomic DNA purification column was transferred to a new sterile 1.5ml microcentrifuge tube. 8) 200μl of elution buffer or ddH2O were added to the center of the column membrane to elute the genomic DNA they were incubated for at least 2min at room temperature and centrifuged for 1 min at 8000xg 9) The purification column was discarded. The purified DNA was used in subsequent steps or stored at -20°C.
3.2.6.2. PCR amplification of human mitochondrial genome Due to the large size of the mitochondrial genome (16.5 kb), therefore the entire genome amplification was obtained by 4 overlapping PCR-fragments A, B, C and D (Figure 3.1). The primer sets and the estimated size of each fragment are listed in Table 3.6.
-47-
Chapter Three
Materials and Methods Mt.E.F
Mt.D.F
Mt.23.R
Fragment D
Mt.2.R
Fragment C
Mt.22.R
Mt.23.R
Mt.21.R
Mt.A.F Mt.1.R
Mt.20.R Mt.2.R Mt.19.R
Mt.2.R
Mt.18.R
Mt.3.R
Mt.17.R
Mt.4.R
MtDNA 16,569 bp
Mt.5.R
Mt.16.R Mt.16.R
Mt.C.F Mt.15.R
Mt.6.R
Mt.14.R
Mt.7.R
Fragment A
Mt.8.R
Mt.B.F
Mt.13.R
Mt.9.R
Mt.12.R Mt.10.R
Mt.11.R
Fragment B
Mt.9.R
Figure 3.1: Four overlapped fragments (A, B, C and D). Table 3.6: The size of the 4 fragments.
Fragments Forward primer A B C D
Mt.A.F Mt.B.F Mt.C.F Mt.D.F
Reverse primer
Size of PCR products
Mt.9.R Mt.16.R Mt.23.R Mt.2.R
6115 6125 5515 2127
Annealing temperature (oC) 54oC 52oC 53oC 54oC
*Sequence of primers are listed in Tables 3.4 and 3.5. 3.2.6.2.1. PCR protocols: 1) PCR kits Two different PCR kits were used for the amplification of the overlapping PCR fragments: -48-
Chapter Three
Materials and Methods
a) LongAmp® Taq PCR Kit The reaction mix was prepared as follows:
Reaction components
Volumes
Nuclease free water 5X LongAmp Taq reaction buffer 10 mM dNTPs 10µM Forward primer 10µM reverse primer LongAmp Taq DNA polymerase Template DNA Total volume
14.75 µl 5 µl 0.75 µl 1 µl 1 µl 1 µl 1.5 µl 25 µl
b) Accupower® Profi Taq PCR premix Premix tubes contains the following components: Components
Volumes
ProFi Taq DNA polymerase dNTP mix(dATP, dCTP, dGTP, dTTP) Reaction buffer (with 1.5mM MgCl2) Stabilizer and tracking dye
1U Each 250µl 1X Trace
The following components were added to the premix tube:
Reaction components Nuclease free water 10µM forward primer 10µM reverse primer Template DNA
Volumes 16.5 µl 1 µl 1 µl 1.2 µl 20µl
Total volume
-49-
Chapter Three
Materials and Methods
2) The PCR program The PCR program was the same except the annealing time, extension time and temperature depending on the type of enzyme, length of the fragment and GC-AT content of the primers.
Cycle steps
Temperature
Durations
No. of cycles 1cycle
Initial denaturation
95oC
5min
Denaturation
95oC
40 seconds
Annealing
*
40 seconds
Extension
**
***
Final extension
**
5min
1 cycle
Hold
4oC
∞
1cycle
30 cycles
*Annealing temperature depended on the amplification primers listed in the tables 3.5, 3.6 and 3.7. **Extension temperature, depending on the type of Taq polymerases (65oC for LongAmp® Taq PCR Kit, and 68oC for Accupower® Profi Taq PCR premix). ***Extension time (1minute/1kilo base pairs (1kbp)).
3.2.6.2.2. Agarose gel electrophoresis protocol 1% agarose gel was prepared as following: 1- One gram (1g) of agarose powder was added to 100ml of (1X TBE) buffer in a flask. 2- The mixture was boiled using a microwave oven for 1 to 2min, until the agarose was dissolved and the solution was clear. 3- It was left at room temperature to cool down, when the temperature reached about 50-60˚C 10µl of 1µg/ml ethidium bromide was added. The solution was stirred to disperse the ethidium bromide. 4- The agarose solution was poured into the gel tray, and left to solidify at room temperature for 30-45minutes. 5- The gel was placed into the electrophoresis chamber, the chamber was filled with 1X TBE buffer and the comb was removed.
-50-
Chapter Three
Materials and Methods
6- The DNA samples or PCR product were mixed with 0.20 volumes of 6X loading buffer, and loaded in separate wells, a properate DNA marker was also loaded in one of the lanes. In the case of using novel juice instead of ethidium bromide, DNA samples or PCR product were mixed with 0.20 volumes of novel juice and loaded in the gel wells. 7- The electrophoresis was run at a voltage 1-5volt/cm for 1hour. The gel was removed and visualized under ultraviolet light (gel documentation system) 8- The relative size of the fragments was determined based on the molecular weight of different fragments of the DNA marker. (Sambrook and Russell, 2001). 3.2.6.2.3. PCR clean up The PCR products were cleaned up from residual components by GeneJET™PCR purification kit which consists of:
Binding buffer
Wash buffer concentrated ( Before using the kit, wash buffer was diluted by adding 45ml of 96% ethanol to 9ml of concentrated wash buffer.)
Elution buffer (10mM Tris-HCl, pH8.5)
GeneJET purification columns (preassembled with collection tubes)
Steps of the work: All purification steps were carried out at room temperature. 1) 1:1volume of binding buffer was added to the complete PCR mixture and it was mixed thoroughly. 2) The solution was transferred to the GeneJET purification column, centrifuged 12000xg for 1min and the flowed-through was discarded. 3) 700µL of washing buffer (diluted with the ethanol) were added to the GeneJET purification column and centrifuged 12000xg for 1min. 4) The flowed-through was discarded, and the column was placed back into the collection tube. 5) The column was centrifuged for one additional minute to completely remove any residual washing buffer. 6) The column was transferred to a new clean 1.5ml tube.
-51-
Chapter Three
Materials and Methods
7) 50µL of elution buffer or nuclease free water (ddH2O) were added to the center of the GeneJET purification column membrane and centrifuged 12000xg for 1min. 3.2.6.2.4. Recovery of PCR product from agarose gel Some PCR products from agarose gel were recovered from unspecific band(s) by using GeneJET™ Gel extraction kit, which consists of components same as components of PCR clean up kit in section 3.2.6.2.3 of page 13. Steps of the work: All purification steps were carried out at room temperature. 1) A clean scalpel or razor blade was used to cut the gel containing the DNA fragment as close as possible to the fragment to minimize the gel volume. The gel slice was placed into a pre-weighed 1.5ml tube and it was weighed again to measure the weight of the gel slice. 2) 1:1volume of binding buffer was added to the gel slice (volume: weight). 3) The gel mixture was incubated at 50-60°C for 10min or until the gel slice was completely dissolved. The gel slice was mixed by inversion every few minutes to facilitate the melting process until the gel is completely dissolved. 4) The color of the solution was observed throughout the dissolving process, if the color changed to orange or violet, 10µl of 3M sodium acetate (pH5.2) were added to the solution that the color of the solution will be changed to yellow. 5) The solubilized gel solution was transferred to the GeneJET purification column. 6) It was centrifuged 12000xg for 1min, the flowed-through was discarded and the column was placed back into the same collection tube. 7) Since the fragments were aimed to sequencing and sequencing reaction requires highly pure product, therefore, the following additional purification steps were obtained for the PCR fragments. 100µl of binding buffer were added to the GeneJET purification column and centrifuged at 12000x g for 1min. The flowed-through was discarded and the column was placed back into the same collection tube. * Subsequent purification steps are exactly as the steps 3-7 of PCR clean up steps (section 3.2.6.2.3 of page 13).
-52-
Chapter Three
Materials and Methods
3.2.6.3. Semi-nested PCR Each of three PCR fragments A, B and C was re-amplified by forward and different reverse primers that were designed inside each fragment. The estimated size of each of the sub-fragments is listed in Table 3.7. Table 3.7: The size of semi-nested sub-fragments.
Fragments
Sub-fragments
A
B
C
A1 A2 A3 A4 A5 A6 A7 A8 B9 B10 B11 B12 B13 B14 B15 C16 C17 C18 C19 C20 C21 C22
Forward primers
Mt.A.F
Mt.B.F
Mt.C.F
Reverse primers
Size of PCR products
Annealing temperatures
Mt.1.R Mt.2.R Mt.3.R Mt.4.R Mt.5.R Mt.6.R Mt.7.R Mt.8.R Mt.9.R Mt.10.R Mt.11.R Mt.12.R Mt.13.R Mt.14.R Mt.15.R Mt.16.R Mt.17.R Mt.18.R Mt.19.R Mt.20.R Mt.21.R Mt.22.R
667 1195 1796 2383 3082 3878 4609 5329 589 1303 2129 2895 3676 4608 5404 658 1332 2040 2684 3405 4063 4733
54 oC 54 oC 54 oC 54 oC 54 oC 54 oC 52 oC 54 oC 54 oC 50 oC 52 oC 54 oC 54 oC 54 oC 56 oC 54 oC 54 oC 54 oC 54 oC 54 oC 54 oC 54 oC
*Sequence of primers is listed in Tables 3.4 and 3.5.
3.2.6.4. Nested PCR The PCR fragment (D) was re-amplified by two different forward and reverse primers. The estimated size of each of the nested sub- fragments is listed in Table 3.8.
-53-
Chapter Three
Materials and Methods
Table 3.8: The size of nested sub-fragments.
Fragment
Sub- Fragments
Forward Primer
Reverse Primer
Size of PCR Products
Annealing Temperatures
D
D A1 D E23
Mt.A.F Mt.E.F
Mt.1.R Mt.23.R
667 256
54 oC 54 oC
*Sequence of primers is listed in Tables 3.4 and 3.5. PCR protocols: The PCR protocols of nested and seminested PCR are the same as protocols that are illustrated in section 3.2.6.2.1 of PCR protocols. 3.2.6.5. Restriction digestion for fragments A, B and C Each of the fragments (A, B and C) was digested with different restriction enzymes according to restriction map from NEB cutter V2.0 program. Table 3.9: Restriction enzymes.
Restriction enzymes ApaI AvaI BstBI ClaI EcoRI-HFTM EcoRV-HFTM HindIII-HFTM KpnI-HFTM NcoI-HFTM NdeI PstI-HFTM PvuII-HFTM SpeI-HFTM SphI-HFTM XbaI XhoI
Recognition sites
Incubation temperature
Inactivation temperature
GGGCCC VYCGRG TTCGAA ATCGAT GAATTC GATATC AAGCTT GGTACC CCATGG CATATG CTGCAG CAGCTG ACTAGT GCATGC TCTAGA CTCGAG
25oC 37oC 65oC 37oC 37oC 37oC 37oC 37oC 37oC 37oC 37oC 37oC 37oC 37oC 37oC 37oC
65oC 80oC NO 65oC 65oC 65oC 80oC NO 80oC 65oC NO NO 80oC 65oC 65oC 65oC
-54-
Chapter Three
Materials and Methods
The reaction digestion mixes were prepared as in the table below:
Components
Volume
Nuclease free water
9µl
10X NEB buffer 4
5µl
Purified PCR product
5µl
Restriction enzyme (20 U/µl)
1µl
Total volume
20 µl
The mixes were spined briefly and incubated at optimum temperature for 4 hours, and reactions were stopped by heating for 20 minutes to inactivate the enzyme. The incubation and inactivation temperatures are illustrated in the Table 3.8. 3.2.6.6. Sequencing Four PCR products fragments (A, B, C, and D) were used as templates for sequencing with the primers listed in Table 3.4 and 3.5, by using Big Dye Terminator v3.1 cycle sequencing kit and depending on the cycle sequencing technology (dideoxy chain termination; Sanger sequencing) on 6 Applied Biosystems 3730xl and 9 ABI 3700 in Macrogene: http://dna.macrogen.com/eng/ and (Applied Biosystems ABI PRISM® 310 Genetic Analyzer) in Microgene Diagnostic Laboratory at Harem Private Hospital in Sulaimani. 3.2.6.7. Alignment of sequences Homology searches were conducted using NCBI BLAST between the sequence of standard Revised Cambridge Reference Sequence (rCRS) of the Human Mitochondrial DNA from the Entrez database; accession number NC_012920 (Andrews et al., 1999).
-55-
Conclusions and Recommendations
CONCLUSIONS 1.
Mitochondrial genome harbors 2 types of mutations: homosome and heterosome
mutations. The homosome mutations are in most of the case related to the lineage and Haplogroups, while the heterosome mutations are mostly related to disease (mitochondrial disease). 2.
Neutral homosome mutations are both lineage and forensics related mutations.
3.
Pathogenic homosome mutations might cause deleterious (lethal) mutations.
4.
Disease symptoms in heterosome mutations are dependent on the level of mutant variants
existence in the population of mitochondrial genome in the cell. 5.
Mutation rate in mitochondrial DNA is higher than the nuclear DNA which is due to the
lack of most of the repair DNA mechanisms in mitochondrial.
RECOMMENDATIONS 1.
It is important to identify the common neutral mutations (SNP) and find out the precise
Kurdish lineages, in order to achieve this point the size of the samples must be increased enormously. 2.
To identify most of the pathogenic mutations in the Kurdish population, the increase of
the sample sizes in most of the suspected cases is required. 3.
Use of mitochondrial diagnosis in the health individual in Kurdistan.
-102-
.
References
Abu-Amero K. K., (2011). Leber’s hereditary optic neuropathy: The mitochondrial connection revisited.
Aiello, L. C., (1993).The fossil evidence for modern human origins in Africa: A revised view. Am. Anthropol., 95(1):73-76.
Andrews, R. M.; Kubacka, I.; Chinnery, P. F.; Lightowlers, R. N.; Turnbull, D.M.; Howell, N., (1999). Reanalysis and revision of the Cambridge reference sequence for human mitochondrial DNA. Nat Genet, 23:147.
Annunen-Rasila, J., (2007). Molecular and cell phenotype changes in mitochondrial diseases. PH. D. dissertation, Faculty of Medicine, University of Oulu. Oulu-Finland.
Balaban, R. S.; Nemoto, S.; Finkel, T., (2005). Mitochondria, oxidants, and aging. Cell 120:483–95.
Becker, R. A.; Erik, R.; Janus, E. R.; White, R. D.; Kruszewski, F. H.; Brackett, R. F., (2009). Good Laboratory Practices and safety assessments [Letter]. Environ Health Perspect 117:A482–A483.
Berg F.; Gustafson U.; Andersson L., (2006). The uncoupling protein 1 gene (UCP1) is disrupted in the pig lineage: A genetic explanation for poor thermoregulation in piglets. PLoS Genet. 2:1178-1181.
Bhargava, K.; Spremulli, L. L., (2005). Role of the N- and C terminal extensions on the activity of mammalian mitochondrial translational initiation factor 3. Nucleic Acids Research. 33(22):7011–7018.
Bhargava, K.; Templeton, P.; Spremulli, L. L., (2004). Expression and characterization of isoform 1 of human mitochondrial elongation factor G. Protein Expression and Purification. 37(2):368–376.
Bogenhagen, D. F., (1999). Repair of mtDNA in Vertebrates. Am. J. Hum. Genet. 64:1276–1281.
Bogin B.; Rios L., (2003). Rapid morphological change in living humans: implications for modern human origins.Comp. Biochem. Physiol., 136(1):71-84.
Bowmaker, M.; Yang, M. Y.; Yasukawa, T.; Reyes, A.; Jacobs, H. T.; Huberman, J. A.; Holt, I. J., (2003). Mammalian mitochondrial DNA replicates bidirectionally from an initiation zone. Biological Chemistry 278(51):50961-50969.
-103-
.
References
Brewer, B. J.; Fangman,W.L., (1987). The localization of replication origins on ARS plasmids in S. cerevisiae. Cell. 51:463–471.
Brown, M.D.; Voljavec, A.S.; Lott, M.T.; Torroni, A.; Yang, C.; Wallace, D.C., (1992).
Brown,W. M.; Matthe George, J. R.; Wilson, A. C., (1979). Rapid evolution of animal mitochondrial DNA. Genetics, 76(4):1967-1971.
Byrd, G. S.; McNamara, B.; Suckling, K. E.; et al., (1983). Cholesterol metabolism in the adrenal cortex. Steroid Biochem, 19:1017-1027.
Cann, R.L.; Stoneking, M.; Wilson, A.C., (1987). Mitochondrial DNA and human evolution. Nature, 325:31-36.
Carelli, V.; Ross-Cisneros, F. N.; Sadun, A. A., (2002). Optic nerve degeneration and mitochondrial dysfunction: genetic and acquired optic neuropathies. Neurochem Int. 40:573-584.
Carroll, J.; Fearnley, I. M.; Skehel, J. M.; Shannon, R. J.; Hirst, J.; Walker, J. E., (2006). Bovine complex I is a complex of 45 different subunits. Biol Chem, 281:32724-32727.
Chatterjee, A.; Mambo, E.; Sidransky, D., (2006). Mitochondrial DNA mutations in human cancer. Oncogene 25:4663–4674.
Chen Tian-Jian; Richard, G.; Boles; Lee-Jun, C.; Wong, (1999). Detection of Mitochondrial DNA Mutations by Temporal Temperature Gradient Gel Electrophoresis. Clinical Chemistry, 45(8):1162–1167.
Chen, Y. S.; Torroni, A.; Excoffier, L.; Santachiara-Benerecetti, A. S.; Wallace, D. C., (1995). Analysis of mtDNA variation in African populations reveals the most ancient of all human continent-specific haplogroups. Hum Genet, 57(1):133.
Chicco, A., J.; Sparagna, G. C., (2007). Role of cardiolipin alterations in mitochondrial dysfunction and disease. Cell Physiol 292(1):C33-44.
Christian, B. E.; Spremulli, L. L., (2009) Evidence for an active role of IF3mt in the initiation of translation in mammalian mitochondria. Biochemistry. 48:3269–3278.
Chrzanowska-Lightowlers, Zofia M. A., (2011). Mammalian Mitochondria Termination of Protein Synthesis in. Biol. Chem. 286:34479-34485.
Crispim; Canani, L. H.; Gross, J. L.; et al., (2005). The G1888A variant in the mitochondrial 16S rRNA gene may be associated with Type 2 diabetes in CaucasianBrazilian patients from southern Brazil. Diabet Med. 22(12):1683-1689. -104-
.
References
Cummins, J. M., (2001). Mitochondria: potential roles in embryogenesis and nucleocytoplasmic transfer. Human Reproduction 7:217-228.
de Grey, A. D. N. J., (1999). The mitochondrial free radical theory of aging. 1st edition. R.G. Landes Company, Austin, Texas U.S.A.
DiMauro, S., (2004). Mitochondrial diseases. Biochimica et Biophysica Acta. 1658:80– 88.
DiMauro, S.; Schon, E. A., (2003). Mitochondrial respiratory-chain diseases. Med. 348:2656 –2668.
Douthwaite, S., (1992). Functional interactions within 23S rRNA involving thepeptidyltransferase center. Bacteriology, 174(4):1333-1338.
Douthwaite, S.; Prince, J. B.; Noller, H. F., (1985). Evidence for functional interaction between domains II and V of 23S ribosomal RNA from an erythromycin-resistant mutant. Biochemistry, 82:8330-8334.
Dowton’, S. B.; Slaugh, R. A., (1995). Diagnosis of Human Heritable DiseasesLaboratory Approaches and Outcomes. CLINICAL CHEMISTRY. 41(5):785-794.
Fernandez-Silva, P.; Enriquez, J. A.; Montoya, J., (2003). Replication and transcription of mammalian mitochondrial DNA. Exp Physiol. 88:41–56.
Finnilä, S., (2000). Phylogenetic analysis of mitochondrial DNA detection of mutations in patients with occipital stroke. PH. D. Dissertation University of Oulu. Oulu- Finland.
Fisher, R. P.; Clayton, D. A., (1985). A transcription factor required for promoter recognition by human mitochondrial RNA polymerase. Accurate initiation at the heavyand light-strand promoters dissected and reconstituted in vitro. Biol Chem, 260(20):11330-8.
Fontenay, M.; Cathelin, S.; Amiot, M.; Gyan, E.; Solary, E., (2006). Mitochondria in hematopoiesis and hematological diseases. Oncogene 25:4757–4767.
Garesse, R.; Vallejo, C. G., (2001). Animal mitochondrial biogenesis and function: a regulatory cross-talk between two genomes. Gene 263:1-16.
Garrett, R.; Grisham, C., (1999). Biochemistry. 2nd edition. Saunders College. U.S.A.
Gissi, C.; Pesole, G., (2003). Transcript Mapping and Genome Annotation of Ascidian mtDNA Using EST Data. Genome Research, 13:2203–2212.
-105-
.
References
González, A. M.; García, O.; Larruga, J. M.; Cabrera, V. M., (2006). The mitochondrial lineage U8a reveals a Paleolithic settlement in the Basque country. BMC Genomics, 7:1471-2164.
Goto, Y., (1995). Clinical features of MELAS and mitochondrial DNA mutations. Muscle Nerve, 3:107- 112.
Goto, Y.; Nonaka, I.; Horai, S., (1990). A mutation in the tRNALeu(UUR) gene associated with the MELAS subgroup of mitochondrial encephalomyopathies. Nature, 348:651-653.
Goto, Y.; Tsugane, K.; Tanabe, Y.; Nonaka, I.; Horai, S.; (1994). A new point mutation at nucleotide pair 3291 of the mitochondrial tRNA (Leu (UUR)) gene in a patient with mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS). Biochem Biophys Res Commun, 202:1624-1630.
Gray, M. W.; Burger, G.; Lang, B. F., (1999). Mitochondrial evolution. Science, 283 (5407):1476-81.
Greenleaf, A. L.; Kelly, J. L.; Lehman, I. R., (1986). Yeast RPO41 gene product is required for transcription and maintenance of the mitochondrial genome. Proc Natl Acad Sci U S A, 83:3391-3394.
Haque, Md. E.; Grasso, D.; Spremulli, L. L., (2008). The interaction of mammalian mitochondrial translational initiation factor 3 with ribosomes: evolution of terminal extensions in IF3mt.Nucleic Acids Research, 36(2):589–597.
Harpending, H.; Rogers, A., (2000). Genetic perspectives on human origins and differentiation. Annu. Rev. Genomics Hum. Genet. 1:361-385.
Herrnstadt, C.; Elson, J. L.; Fahy, E.; Gwen, P.; Turnbull, D. M.; Anderson, C.; Ghosh, S. S.; Olefsky, J. M.; Beal, M. F.; Davis, R. E.; Howell, N., (2002). Reduced-mediannetwork analysis of complete mitochondrial DNA coding-region sequences for the major African, Asian, and European haplogroups. Am. J. Hum. Genet. 70:1152-1171.
Herrnstadt, C.; Howell, N., (2004). An evolutionary perspective on pathogenic mtDNA mutations: haplogroup associations of clinical disorders. Mitochondrion, 4(5-6):791-798.
Holt, I.J.; Lorimer, HE. Jacobs, H.T., (2000). Coupled leading- and lagging-strand synthesis of mammalian mitochondrial DNA. Cell, 100:515-524.
-106-
.
References
http://mrkingbiochemistry.wordpress.com/page/3/)
http://www.genebase.com/doc/mtdnaHaplogroupTree_Ref.pdf)
http://www.mitomap.org/MITOMAP/HumanMitoCode
Iborra, F. J.; Kimura, H.; Cook P. R., (2004). The functional organization of mitochondrial genomes in human cells. BMC Biol, 2:9.
Jacobs, H. T.; Turnbull, D. M., (2005). Nuclear genes and mitochondrial translation: a new class of genetic disease. Trends Genet. 21:312–314.
Jastroch, M.; Divakaruni, A. S.; Mookerjee, S.; Treberg, J. R.; Brand, M. D., (2010). Mitochondrial proton and electron leaks, Essays Biochem. 47:53–67.
Jorde, L. B.; Bamshad, M.; Rogers, A. R., (1998). Using mitochondrial and nuclear DNA markers to reconstruct human evolution. Bioessays, 20:126-136.
Kiebish, M. A.; Xianlin Han; Hua Cheng; Chuang, J. H.; Seyfried, (2008). Cardiolipin and electron transport chain abnormalities in mouse brain tumor mitochondria: lipidomic evidence supporting the Warburg theory of cancer. Lipid Res. 49(12):2545–2556.
Koc E. C.; Burkhart, W.; Blackburn, K.; Moseley, A.; Spremulli, L. L., (2001). The small subunit of the mammalian mitochondrial ribosome. Identification of the full complement of ribosomal proteins present. Biol Chem. 276:19363–19374.
Kogelnik, A. M.; Lott, M. T.; Brown, M. D.; Navathe, S. B.; Wallace, D. C., (1998). MITOMAP: a human mitochondrial genome database--1998 update. Nucleic Acids Research. 26:112-115.
Korostelev, A.; Ermolenko, D. N.; Noller, H. F., (2008). Structural dynamics of the ribosome. Curr Opin Chem Biol. 12(6):674–683.
Kroemer, G., (2003). Mitochondrial control of apoptosis: an introduction. Biochemical and Biophysical Research Communications. 304:433–435.
Kutscheraa, U.; Niklasb, K. J., (2005). Endosymbiosis, cell evolution, and speciation. Biosciences. 124:1–24.
Kuznetsov, A. V.; Kehrer, I.; Kozlov, A. V.; Haller, M.; Redl, H.; Hermann, M.; Grimm, M.; Troppmair, J., (2011). Mitochondrial ROS production under cellular stress: comparison of different detection methods. Anal Bioanal Chem. 400(8):2383-2390.
-107-
.
References
Lang B. F.; Gray, M. W.; Burger, G., (1999). Mitochondrial genome evolution and the origin of eukaryotes. Annu Rev Genet. 33:351–397.
Lee D. Y.; Clayton, D. A., (1996). Properties of a Primer RNA-DNA Hybrid at the Mouse Mitochondrial DNA Leading-strand Origin of Replication. BIOLOGICAL CHEMISTRY. 271(39):24262–24269.
Levine, B.; Elazar, Z., (2011). Inheriting Maternal mtDNA. Science. 334(6059):1069– 1070.
Lodi, R.; Montagna, P.; Cortelli, P.; Iotti, S.; Cevoli, S.; Carelli, V.; Barbiroli, B., (2000). ‘Secondary’ 4216/ND1 and 13708/ND5 Leber’s hereditary optic neuropathy mitochondrial DNA mutations do not further impair in vivo mitochondrial oxidative metabolism when associated with the 11778/ND4 mitochondrial DNA mutation.Brain. 123:1896-1902.
Luft, R.; Ikkos, D.; Palmieri, G.; Ernster, L.; Afzelius, B., (1962). A case of severe hypermetabolism of nonthyroid origin with a defect in the maintenance of mitochondrial respiratory control: a correlated clinical, biochemical, and morphological study. Clin Invest 41:1776-1804.
Ma, J.; Spremulli, L. L., (1996). Expression, Purification, and Mechanistic Studies of Bovine Mitochondrial Translational Initiation Factor 2. BIOLOGICAL CHEMISTRY. 271(10):5805–5811.
Maca-Meyer, N.; González, A. M.; Larruga, J. M.; Flores, C.; Cabrera, V. M., (2001). Major genomic mitochondrial lineages delineate early human expansions. BMC Genetics, 2:1471-2156.
Mancuso, M.; Francesca, L. C.; Rocchi, A.; et al., (2004). Could mitochondrial haplogroups play a role in sporadic amyotrophic lateral sclerosis? Neurosci Lett. 371:158 –162.
Mathews, D. H.; Disney, M. D.; Childs, J. L.; Schroeder, S. J.; Zuker, M.; Turner, D. H., (2004). Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure. Proc. Natl. Acad. Sci. 101:7287– 7292.
-108-
.
References
Mattman, A.; Sandra Sirrs; Michelle, M.; Mezei; Ramona Salvarinova-Zivkovic; Majid Alfadhel; Yolanda Lillquist, (2011). Mitochondrial disease clinical manifestations:An overview. Bcmj. 53(4).
McCulloch, V.; Seidel-Rogol, B. L.; Shadel, G. S., (2002). A human mitochondrial transcription factor is related to RNA adenine methyltransferases and binds Sadenosylmethionine. Mol Cell Biol, 22(4):1116-25.
McKinney, E. A.; Oliveira. M. T., (2013). Replicating animal mitochondrial DNA. Genetics and Molecular Biology, 36, 3, 308-315.
Melov, S.; Coskun, P.; Patel, M.; Tuinstra, R.; Cottrell, B.; Jun, A. S.; Tomsz, H.; Zastawny; Dizdaroglu, M.; Stephen, I.; Goodmani; Huang, T.; Miziorko, H.; Charles, J.; Epstein; Wallace, D. C., (1999). Mitochondrial disease in superoxide dismutase 2 mutant mice. Proc. Natl. Acad. Sci. 96:846–851.
Minczuk, M.; He, J.; Duch, A. M.; Ettema, T. J.; Chlebowski, A.; Dzionek, K.; Holt, I. J., (2011). Tefm (c17orf42) is necessary for transcription of human mtDNA. Nucleic Acids Res, 39(10):4284-4299. MitochondrialDNAcomplexIandIIImutationsassociatedwithLeber’shereditaryoptic neuropathy. Genetics, 130:163-173.
Montoya, J.; Christianson, T.; Levens, D.; Rabinowitz, M.; Attardi, G., (1982). Identification of initiation sites for heavy-strand and light-strand transcription in human mitochondrial DNA. Proc Natl Acad Sci. 79:7195-7199.
Moore, S. J.; Turnpenny, P.; Quinn, A.; Glover, S.; Lloyd, D. J.; Montgomery, T.; Dean, J. C. S., (2000). A clinical study of 57 children with fetal anticonvulsant syndromes. Med Genet. 37:489-497.
Moraes, C. T.; Ciacci, F.; Bonilla, E.; Ionasescu, V.; Schon, E. A.; DiMauro, S., (1993) A mitochondrial tRNA anticodon swap associated with a muscle disease. Nature Genetics 1993; 4:284-288.
Moraes, C. T.; DiMauro, S.; Zeviani, M.; Lombes, A.; Shanske, S.; Miranda, A. F.; Nakase, H.; Bonilla, E.; Werneck, L. C.; Servidei, S.; Nonaka, I.; Koga, Y.; Spiro, A. J.; Brownell, A. K.; Schmidt, B.; Schotland, D. L.; Zupanc, M.; DeVivo, D. C.; Schon, E.
-109-
.
References
A.; Rowland, L. P., (1989) Mitochondrial DNA deletions in progressive external pohthalmoplegia and Kearns-Sayre syndrome. N Engl J Med. 320:1293-1299.
Morten, K.; Brown, G.; Lake, B.; Wilson, J.; Poulton, J., (1992). A new point mutation associated with the MELAS phenotype. 2nd Internationl Congress of Human Mitochondrial Pathology (EUROMIT):39.
MURPHY, P. M., (2009). How mitochondria produce reactive oxygen species. Biochem. J. 417, 1–13.
Nei, M. (1995). Genetic support for the out-of-Africa theory of human evolution. Proc. Natl. Acad. Sci. USA, 92:6720-6722.
Neupert, W.; Herrmann, J. M., (2007). Translocation of Proteins into Mitochondria. Annu. Rev. Biochem. 76(1):723-749.
Nicholls, D. G.; Budd, S. L., (2000). Mitochondria and Neuronal Survival. Physiol. Rev. 80(1):315-360.
Niemi, A. K.; Hervonen, A.; Hurme, M.; Karhunen, P. J.; Jylhä, M.; Majamaa, K., (2003). Mitochondrial DNA polymorphisms associated with longevity in a Finnish population. Hum Genet 112:29-33.
Ohnishi, T., (1993). NADH-quinone oxidoreductase, the most complex complex. J Bio Biomembr. 25:325-329.
Park S. B.; Ma, K. T.; Kook, K. H.; Lee, S. Y., (2004). Kearn-Syre Syndrome -3 Case Reports and Review of Clinical Feature-.Yonsei Medical Jornal. 45(4):727-735.
Parra, E. J.; Kittles, R. A.; Shriver, M. D., (2004). Implications of correlations between skin color and genetic ancestry for biomedical research. Nat Genet. 36(11):54-60.
Patil C.S.; Biradar, P. M.; Gangawane A. K., (2008). Cell Biology. 1stedition, A.P.H., NewDelhi.
Pearson, H. A.; Lobel, J. S.; Kocoshis, S. A.; Naiman, J. L.; Windmiller, J.; Lammi, A. T.; Hoffman, R.; Marsh, J. C., (1979). A new syndrome of refractory sideroblastic anemia with vacuolization of marrow precursors and exocrine pancreatic dysfunction. Pediatric, 95:976-984.
Pel, H. J.; Grivell, L. A., (1994). Protein synthesis in mitochondria. Molecular Biology Reports 19:183-194. -110-
.
References
Peralta, S.; Clemente, P.; Sanchez-Martinez, A.; Calleja, M.; Hernandez-Sierra, R.; Matsushima, Y.; Adan, C.; Ugalde, C.; Fernandez-Moreno, M. A.; Kaguni, L. S.; Garesse, R., (2012). Coiled Coil Domain-containing Protein 56 (CCDC56) Is a Novel Mitochondrial Protein Essential for Cytochrome c Oxidase Function. J. Biol. Chem. 287(29):24174-24185.
Pieczenik S. R.; Neustadt J., (2007). Mitochondrial dysfunction and molecular pathways of disease. Experimental and Molecular Pathology, 83:84–92.
Prezant, T. R.; Agapian, J. V.; Bohlmam, M. C.; Bu, X.; Ozet, S.; Qiu, W.; Arnos, K. S.; Cortopassi, G. A.; Jabber, L.; Rotter, J. I.; Shohat, M.; Fischel-Ghodsian, N., (1993) . Mitochondrial ribosomal RNA mutation associated with both antibiotic-induced and non syndromic deafness. Natur genetics. 4:289-294.
Rocha, H.; Flores, C.; Campos, Y.; Arenas, J.; Vilarinho, L.; Santorelli, F. M.; Torroni, A., (1999). About the "pathological" role of the mtDNA T3308C mutation. Human Genetics, 65(5):1457-1459.
Rossignol, R.; Faustin, B.; Rocher, C.; Malgat, M.; Mazat, J.; Letellier, T., (2003). Mitochondrial threshold effects. Biochem. J. 370, 751±762
Saelens, X.; Festjens, N.; Vande Walle. L.; van Gurp, M.; van Loo, G.; Vandenabeele, P., (2004). Toxic proteins released from mitochondria in cell death. Oncogene, 23:2861– 2874.
Sambrook, J.; Fritsch, E. F.; Maniatis, T., (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Sambrook, J.; Russell, D. W., (2001). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Saraste, M., (1999). Oxidative Phosphorylation at the fin de siecle. Science, 283(5407):1488-1493.
Schafer, K.; Seelert, H.; Reifschneider, N. H.; Krause, F.; Dencher, N. A.; Vonck, J., (2006). Architecture of active mammalian respiratory super complexes. Biological Chemistry. 281(22):15370-15375.
Schon, E. A.; Bonilla, E; DiMauro, S., (1997). Mitochondrial DNA mutations and pathogenesis. Bioenergetics & Biomembranes, 29(2):131-149. -111-
.
References
Sequeira, A.; Martin M. V.; Rollins, B.; Moon, E. A.; Bunney, W. E.; Macciardi, F.; Lupoli, S.; Smith, E. N.; Kelsoe, J.; Magnan, C. N.; Oven, M.; Baldi, P.; Wallace, D. C.; Vawter, M. P., (2012). Mitochondrial mutations and polymorphisms in psychiatric disorders. FRONTIERS IN GENETICS. 3(103).
Sharma, H.; Singh, A.; Sharma, C.; Kumar Jain, S.; Singh, N., (2005). Mutations in the mitochondrial DNA D-loop region are frequent in cervical cancer, Cancer Cell International. 5:34.
Shi Y.; Dierckx, A.; Wanrooij, P. H.; Wanrooij, S.; Larsson, N.; Wilhelmsson, L. M.; Falkenberg, M.; Gustafsson, C. M., (2012). Mammalian transcription factor A is a core component of the mitochondrial transcription machinery. PNAS. 109(41):16510–16515.
Skuder, P.; Plomin, R.; McClearn, G. E.; Smith, D. L.; Vignetti, S.; Chorney, M. J.; Chorney, K.; Kasarda, S.; Thompson, L. A.; Detterman, D. K.; Petrill, S. A.; Daniels, J.; Owen, M. J.; McGuffin, P., (1995). A polymorphism in mitochondrial DNA associated with IQ? Intelligence, 21:1-11.
Smits, P.; Smeitink, J.; van den Heuvel, L., (2010). Mitochondrial Translation and Beyond: Processes Implicated in Combined Oxidative Phosphorylation Deficiencies. J. Biomed. Biotechnol. 2010:737385.
Snustad, D. P.; Simmons, M. J., (2000). Principles of genetics.2nd edition. John Wiley and sons, Inc. NY.
Solano, A.; Playán, A.; López-Pérez, M. J.; Montoya, J., (2001). Genetic diseases of human mitochondrial DNA. Salud Publica Mex. 43:151-161.
Stringer, C. B.; Andrews, P., (1988). Genetic and fossil evidence for the origin of modern humans. Science, 239:1263-1268.
Sykes, B.; Irven, C., (2000). Surnames and the Y chromosome. Am. J. Hum. Genet., 66:1417-1419.
Tanaka, M.; Cabrera, V. M.; Gonza´lez, A. M.; Larruga, J. M.; Takeyasu, T.; Fuku, N.; Guo L-J, Hirose, R.; Fujita, Y.; Kurata, M.; et al, (2004). Mitochondrial genome variation in Eastern Asia and the peopling of Japan. Genome Res, 14:1832–1850.
Tapper, D. P.; Clayton, D. A., (1981). Mechanism of replication of human mitochondrial DNA. Localization of the 5' ends of nascent daughter strands. Biol Chem., 256:51095115. -112-
.
References
Tatuch, Y.; Christodoulou, J.; Feigenbaum, A.; Clarke, J. T. R.; Wherret, J.; Smith, C.; Rudd, N.; Petrova-Benedict, R.; Robinson, B. H., (1992). Heteroplasmic mtDNA mutation (T-G) at 8993 can cause Leigh disease when the percentage of abnormal mtDNA is high. Hum. Genet. 50:852-858.
Templeton, A. R., (1993). The “Eve” hypothesis: a genetic critic and reanalysis. Am. Anthropol., 95:51-72.
Tiranti, V.; Savoia, A.; Forti, F.; Dapolito, M. F.; Centra, M.; Racchi, M.; Zeviani, M.; (1997). Identification of the gene encoding the human mitochondrial RNA polymerase (h-mtRPOL) by cyberscreening of the expressed sequence tags database. Hum Mol Genet. 6:615–625.
Tishkoff, S.; Williams, S. M., (2002). Genetic analysis of African populations: human evolution and complex disease. Genetics, 3:611-621.
Torroni, A.; Huoponen, K.; Francalacci, P.; Petrozzi, M.; Morelli, L.; Scozzari, R.; Obinu, D.; Savontaus, M. L.; Wallace, D. C., (1996). Classification of European mtDNAs from an analysis of three European populations. Genetics. 144(4):1835-1850.
Urata, M.; Wada, Y.; Kim, S, H.; Chumpia, W.; Kayamori, Y.; Hamasaki, N.; Kang, D., (2004). High-Sensitivity Detection of the A3243G Mutation of Mitochondrial DNA by a Combination of Allele-Specific PCR and Peptide Nucleic Acid-Directed PCR Clamping,Clinical Chemistry. 50(11):2045–2051.
Uziel, G.; Moroni, I.; Lamantea, E.; Fratta, G. M.; Ciceri, E.; Carrara, F.; Zeviani, M., (1997). Mitochondrial disease associated with the T8993G mutation of the mitochondrial ATPase 6 gene: a clinical, biochemical, and molecular study in six families. Neurology, Neurosurgery, and Psychiatry. 63:16–22.
van de Corput, M. P. C.; van den Ouweland, J. M. W.; Dirks, R. W.; ’t Hart, L. M.; Bruining, G, J.; Maassen, J. A.; Raap, A. K., (1997). Detection of mitochondrial DNA deletions in human skin fibroblasts of patients with Pearson’s syndrome by two-color fluorescence in situ hybridization. Histochemistry & Cytochemistry. 45(1):55–61.
Vigilant, L.; Pennington, R.; Harpending, H.; Kocher, T. D.; Wilson, A. C., (1989). Mitochondrial DNA sequences in single hairs from a southern African population. Proc. Natl. Acad. Sci. USA, 86:9350-9354.
-113-
.
References
Wallace, D. C., (1994). Mitochondrial DNA sequence variation in human evolution and disease. Proceedings of the National Academy of Sciences of the United States of America. 91(19):8739-8746.
Wallace, D. C., (1999). Mitochondrial diseases in man and mouse. Science. 283 (5407):1482-1488.
Wallace, D. C.; Brown, M. D.; Lott, M. T., (1999). Mitochondrial DNA variation in human evolution and disease. Gene, 238 (1):211-230.
Wallace, D. C.; Stugard, C.; Murdock, D.; Schurr, T.; Brown, M. D., (1997). Ancient mtDNA sequences in the human nuclear genome: a potential source of errors in identifying pathogenic mutations. Proceedings of the National Academy of Sciences of the United States of America. 94(26):14900-14905.
Walsh, B., (2001). Estimating the Time to the Most Recent Common Ancestor for the Y chromosome or Mitochondrial DNA for a Pair of Individuals. Genetics 158:897–912.
Wanrooij, S.; Falkenberg, M., (2010). The human mitochondrial replication fork in health and disease. Biochim Biophys Acta.1797(8):1378-88.
Wei, Q.; Lu, Y.; Zhang, Y.; Chen, Z.; Xing, G.; Cao, X., (2009). Mutation analysis of mitochondrial 12S rRNA gene G709A in a maternally inherited pedigree with nonsyndromic deafness. cma.j. 26(6):610-614.
Wiederkehr, A.; Park, K.; Dupont, O.; Demaurex, N.; Pozzan, T.; Cline, G. W.; Wollheim, C.; B., (2009). Matrix alkalinization: a novel mitochondrial signal for sustained pancreatic b-cell activation. EMBO. 28:417–428.
Wilkinson-Herbots, H. M.; Richards, M. B.; Forster, P.; Sykes, B. C., (1996). Site 73 in hypervariable region II of the human mitochondrial genome and the origin of European populations. Ann Hum Genet. 60:499-508.
Womble, D., (2000). GCG: The Wisconsin Package of Sequence Analysis Programs. Methods Mol. Biol.132:3-22.
Wong, L. J.; Liang, M. H.; Kwon, H.; Bai, R. K.; Alper, O.; Gropman, A. A., (2002). Cystic fibrosis patient with two novel mutations in mitochondrial DNA: mild disease led to delayed diagnosis of both disorders. Medical Genetics. 113:59-64. -114-
.
References
Yasukawa, T.; Reyes, A.; Cluett, T. J.; Yang, M. Y.; Bowmaker, M.; Jacobs, H. T.; Holt, I. J., (2006). Replication of vertebrate mitochondrial DNA entails transient ribonucleotide incorporation throughout the lagging strand. EMBO. 25:5358–5371.
Z Li; Li, R.; Chen, J.; Liao, Z.; Zhu, Y.; Qian, Y.; Xiong, S.; Heman-Ackah,S.; Wu, J.; Choo,D. I.; Guan, M., (2005). Mutational analysis of the mitochondrial 12S rRNA gene in Chinese pediatric subjects with aminoglycoside-induced and nonsyndromic hearing loss. Hum Genet.117 (1):9–15.
Zollo, O.; Tiranti, V.; Sondheimer, N., (2012). Transcriptional requirements of the distal heavy-strand promoter of mtDNA. PNAS. 17(109):6508–6512.
-115-
Chapter Four
Results and Discussions
4. RESULTS AND DISCUSSIONS 4.1. Case selections Only 5 cases were selected in this study and based on the clinical phenotypes they were suspected to harbour mitochondrial diseases. The 1st case was a 35 years old lady, who had 3 sons all of them passed after the age of 6 months. The last 2 were diagnosed in both Karolinska Inst. / Sweden and Oxford/UK that they had increase lactic acid in the blood, which is mostly a sign of mitochondrial disorders. However, the type of the mutations in both cases could not be identified (medical report from Oxford and Karoliniska institutions). The 2nd case was a family of 28 years old mother (case number 2) and 2 disabled children 7 and 5 years old (cases number 3 and 4 respectively). The clinical phenotype of both children was growth and mental retardation. Case number 5 was a total paralysed 3-5 years old female. Furthermore, 3 additional cases (numbers 6, 7 and 8) were taken as a control just for the Dloop (the non-coding region).
4.2. PCR amplification of mitochondrial genome: The human mitochondrial genome is about 16.5 kb, and amplification of the entire genome in a single long PCR fragment might cause artificial errors during the amplification, which subsequently might lead to misinterpretation of the result. Therefore, the strategy used in this study was to amplify the whole mitochondrial genome in 4 overlapping regions (A, B, C, and D) (Figure 3.1 and Table 3.6) where the size of each of the fragments theoretically was calculated based on the mitochondrial sequence database. The results are shown in Figure 4.1 for each of the amplified fragments and the estimated sizes based on the molecular weight (line M) are almost consistant with data base.
-56-
Chapter Four
Results and Discussions
Fragment A
Fragment B
Fragment C
Fragment D
Figure 4.1: Four overlapping PCR fragments (A, B, C and D). Lanes M: 1 Kb DNA marker. Fragment A: lanes 1, 2, 3, 4 and 5: fragment A of five different samples with 6115 bp. Fragment B: lanes 1, 2, 3, 4 and 5: fragment B of five different samples with 6125 bp. Fragment C: lanes 1, 2, 3, 4 and 5: fragment C of five different samples with 5515 bp Fragment D: lanes 1, 2, 3, 4, 5, 6, 7 and 8: fragment D of eight different samples with 2127 bp.
-57-
Chapter Four
Results and Discussions
4.3. Confirmational amplification of the PCR products: 4.3.1. Semi-nested and nested PCR: Since the extraction of total DNA includes chromosomal and mitochondrial genomes from the selected cases, therefore, in order to confirm that the amplified fragments (A, B, C and D), are regions from the human mitochondrial genome, inner specific primers (Table 3.4), that were originally designated for sequencing of the fragments, were used to amplify sub–fragments in combination with common forward primers for each of the 3 mitochondrial fragments (A, B and C), while fragment D was amplified with 2 inner primers (Table 3.8). The results in Figures 4.2 and 4.3 imply that first: the amplified fragments are human mitochondrial genome, and secondly there are no mutations (nucleotide polymorphism) in the primer sites particularly in the 3’ site of the primers. The amplification of all sub-fragments of A, B, C and D are optimized and the estimated sizes are consistence with data base (Figures 4.2, 4.3 and Appendix 1)
-58-
Chapter Four
Results and Discussions
Sub-fragments of fragment A of sample 1
Sub-fragments of fragment B of sample 1
Sub-fragments of fragment C of sample 1
Figure 4.2: Sub-fragments of fragment A, B and C of sample number 1.
Lanes M: 1Kb DNA marker. Fragment A: Lane 1: PCR products of fragment A the estimated size is 6115 bp and Lanes 2-9: sub-fragments of fragment A the estimated sizes are 5329, 4609, 3878, 3082, 2383, 1796, 1195 and 667 bp respectively. Fragment B: Lane 1: PCR products of fragment B the estimated size is 6125 bp and Lanes 2-8: sub-fragments of fragment B the estimated sizes are 5404, 4608, 3676, 2895, 2129, 1303 and 589 bp respectively. Fragment C: Lane 1: PCR products of fragment C the estimated size is 5515 bp and Lanes 2-8: sub-fragments of fragment C the estimated sizes are 4733, 4063, 3405, 2684, 2040, 1332 and 658 bp respectively.
-59-
Chapter Four
Results and Discussions
a)
b)
Figure 4.3: Sub-fragments a) A1D and b) E23D of fragment D for all samples. Lanes M: 1Kb DNA marker. a) Lanes 1-8: A1D sub-fragment the estimated size is 667 bp. b) Lanes 1-8: E23D sub-fragment the estimated size is 256 bp.
-60-
Chapter Four
Results and Discussions
4.3.2. Restriction Fragment Length Polymorphism (RFLP): The mutation rate in the mitochondrial genome is higher than the nuclear genome that is due to limited of the most of the repair mechanisms in mitochondria (Barbieri., 2011 and Torroni et al., 1996). Therefore, it is likely to consider that mutation can occur in every single nucleotide over the mitochondrial genome. Thus, restriction fragment length polymorphism (RFLP) in this aspect is a reliable method to reveal a possible mutation in each of the 3 fragments (A, B and C) for the reasons: first, to detect mutation in the site of the restriction enzymes, and second to identify a possible genome rearrangement in the fragments. Since the sequences in the data base of the mitochondrial genome are based on other nations other than the Kurdish population, in this aspect, different restriction enzymes were used to determine the restriction map of the 3 fragments (A, B and C). Therefore, each of the 3 fragments was digested with: I)
Restriction enzymes with single recognition site (fragment A, B and C).
II) Restriction enzymes with 2 recognition sites (fragment A, B and C). III) Restriction enzymes with 3 recognition sites (fragment C). Furthermore, selection of different restriction enzymes and the digestion patterns were based on analysing the data base sequence of each of the fragments in Neb cutter program in combinations with restriction enzymes available in the laboratory. 4.3.2.1. Restriction digestion of fragment A I) The fragment contains a single recognition site for the following restriction enzymes ClaI, EcoRV, KpnI, PvuII, SpeI and SphI that each of the enzymes cleaves the fragment A at different positions generating 2 fragments as in the table below: Table 4.1: A list of one cutter restriction enzymes digesting fragment A. Restriction enzymes ClaI EcoRV KpnI PvuII SpeI SphI
Fragment 1 sizes (bp) 4932 3149 3570 3495 3892 3707
-61-
Fragment 2 sizes (bp) 1183 2966 2545 2620 2223 2408
Chapter Four
Results and Discussions
The results are shown in Figures 4.4 a, b, c, d, e and f respectively
a) Fragment A digested by ClaI
*
b) Fragment A digested by EcoRV
*
-62-
Chapter Four
Results and Discussions
c) Fragment A digested by KpnI
*
d) Fragment A digested by PvuII
*
-63-
Chapter Four
Results and Discussions
e) Fragment A digested by SpeI
*
f) Fragment A digested by SphI
*
Figures 4.4 a, b, c, d, e and f: Fragment A digested by one cutter enzymes (ClaI, EcoRV, KpnI, PvuII, SpeI and SphI respectively). Lanes M: 1kb DNA marker. Lanes 1-5: Fragment A of 5 samples was digested by ClaI, EcoRV, KpnI, PvuII, SpeI and SphI into two sub-fragments with the estimated sizes being 4932 and1183, 3149 and 2966, 3570 and 2545, 3495 and 2620, 3892 and 2223, 3707 and 2408 bp respectively. *: Neb cutter restriction patterns.
-64-
Chapter Four
Results and Discussions
The results and pattern of fragments are consistant with the restriction map in Neb cutter. II) The enzymes ApaI, EcoRI and XbaI cleave fragment A at 2 different positions that produce the following fragments: Table 4.2: A list of 2 cutters restriction enzyme digesting fragment A. Restriction enzymes
Fragment 1 sizes (bp)
Fragment 2 sizes (bp)
Fragment 3 sizes (bp)
ApaI EcoRI XbaI
2965 4089 3194
1716 1153 1760
1434 873 1161
The results are shown in Figures 4.5 a, b and c respectively
-65-
Chapter Four
Results and Discussions
a) Fragment A digested by ApaI
*
b) Fragment A digested by EcoRI
*
-66-
Chapter Four
Results and Discussions
c) Fragment A digested by XbaI
*
Figures 4.5 a, b and c: Fragment A digested by two cutters enzymes (ApaI, EcoRI and XbaI respectively) Lanes M: 1kb DNA marker. Lanes 1-5: Fragment A of 5 samples was digested by ApaI, EcoRI and XbaI into three fragments. The estimated sizes are 2965, 1716 and 1434, 4089, 1153 and 873, 3194, 1760 and 1161 bp respectively.
*: Neb cutter restriction patterns.
-67-
Chapter Four
Results and Discussions
The results and pattern of fragments are consistant with the restriction map in Neb cutter. 4.3.2.2. Restriction digestion of fragment B The PCR product of fragment B which consists of 6125 bp was digested by: I)
The 2 enzymes (EcoRV and NdeI) that cleave the fragment B at a single position generate fragments with the below estimated sizes:
Table (4.3): A list of one cutter restriction enzymes digesting fragment B. Restriction enzymes
Fragment 1 sizes (bp)
Fragment 2 sizes (bp)
EcoRV NdeI
4947 5163
1178 962
The results are shown in Figures 4.6 a and b respectively
-68-
Chapter Four
Results and Discussions
a) Fragment B digested by EcoRV
*
b) Fragment B digested by NdeI
*
Figures 4.6 a and b: Fragment B digested by one cutter enzymes (EcoRV and NdeI respectively) Lanes M: 1kb DNA marker. Lanes 1-5: Fragment B of 5 samples was digested by EcoRV and NdeI into two subFragments. The estimated sizes are 4947 and 1178, 5163 and 962 bp respectively. *: Neb cutter restriction patterns.
-69-
Chapter Four
Results and Discussions
The results and pattern of fragments are consistant with the restriction map in Neb cutter. II)
Based on NEB cutter, there must be 2 restriction sites for each of the 2 enzymes (ApaI and PstI) in the fragment B, 3 fragments will be generated by each of the 2 restriction enzymes as following:
Table 4.4: A list of 2 cutters restriction enzymes digesting fragment B. Restriction enzymes
Fragment 1 sizes (bp)
Fragment 2 sizes (bp)
Fragment 3 sizes (bp)
ApaI PstI
2695 2659
2414 2110
1016 1356
The results are shown in Figures 4.7 a and b respectively.
-70-
Chapter Four
Results and Discussions
a) Fragment B digested by ApaI
*
b) Fragment B digested by PstI
*
Figures 4.7 a and b: Fragment B digested by two cutters enzymes (ApaI, and PstI respectively) Lanes M: 1kb DNA marker. Lanes 1-5: Fragment B of 5 samples was digested by ApaI, and PstI into three subfragments with sizes 2695, 2414 and 1016, 2659, 2110 and 1356 bps respectively.
*: Neb cutter restriction patterns.
-71-
Chapter Four
Results and Discussions
The results and pattern of fragments are consistant with the restriction map in Neb cutter. 4.3.2.3. Restriction digestion of fragment C The region C which consists of 5515 bp was digested by: I)
The fragment contains a single cleaving (restriction) site for the following 4 restriction enzymes EcoRI, EcoRV, SpeI and XhoI and generated the following fragment:
Table 4.5: A list of one cutter restriction enzymes digesting fragment C. Restriction enzymes
Fragment 1 sizes (bp)
Fragment 2 sizes (bp)
EcoRI EcoRV SpeI XhoI
3900 3667 4581 3930
1615 1848 934 1585
The results are presented in Figures 4.8 a, b, c and d respectively.
-72-
Chapter Four
Results and Discussions
a) Fragment C digested by EcoRI
*
b) Fragment C digested by EcoRV
*
-73-
Chapter Four
Results and Discussions
c) Fragment C digested by SpeI
*
d) Fragment C digested by XhoI
*
Figures 4.8 a, b, c and d: Fragment C digested by one cutter enzymes (EcoRI, EcoRV, SpeI and XhoI respectively) Lanes M: 1kb DNA marker. Lanes 1-5: Fragment C of 5 samples was digested by EcoRI, EcoRV, SpeI and XhoI into two fragments with the estimated sizes 3900 and 1615, 3667 and 1848, 4581 and 934, 3930 and 1585 bps respectively. *: Neb cutter restriction patterns.
-74-
Chapter Four
Results and Discussions
The results and pattern of fragments are consistant with the restriction map in Neb cutter. III)
The enzymes BstBI and HindIII cleave the fragment C at 2 different positions, generating 3 fragments. Results are shown in Figures 4.9 a and b.
Table 4.6: A list of 2 cutters restriction enzymes digesting fragment C. Restriction enzymes
Fragment 1 sizes (bp)
Fragment 2 sizes (bp)
Fragment 3 sizes (bp)
BstBI HindIII
3136 3970
2280 890
99 655
The results are shown in Figure 4.9 a in which the smallest fragment (99 bp) has migrated out from the gel, and that it is due to smaller band than the first fragment of the DNA marker (500 bp). However, the sizes of all other bands are similar to the restriction map of Neb cutter.
-75-
Chapter Four
Results and Discussions
a) Fragment C digested by BstBI
*
b) Fragment C digested by HindIII
*
Figures 4.9 a and b: Fragment C digested by two cutter enzymes (BstBI and HindIII respectively) Lanes M: 1kb DNA marker. Lanes 1-5: Fragment C of 5 samples was digested by BstBI and HindIII into three sub-fragments with the estimated sizes 3136, 2280 and 99, 3970, 890 and 655 bp respectively. *: Neb cutter restriction patterns.
-76-
Chapter Four
Results and Discussions
The results and pattern of fragments are consistant with the restriction map in Neb cutter.
IV)
A single restriction enzyme (AvaI) was available to cleave fragment C at 3 different positions, based on Neb cutter this restriction enzyme generates 4 different fragments (1790, 1585, 1342 and 798 bp). The result is shown in Figure 4.10.
-77-
Chapter Four
Results and Discussions
Fragment C digested by AvaI
*
Figure 4.10: Fragment C digested by three cutters enzyme (AvaI). Lane M: 1kb DNA marker. Lanes 1-5: Fragment C of 5 samples was digested by AvaI into four fragments with the estimated sizes 1790, 1585, 1342 and 798 bp. *: Neb cutter restriction pattern.
-78-
Chapter Four
Results and Discussions
The results and pattern of fragments are consistant with the restriction map in Neb cutter. These results of RFLP for the fragments A, B and C imply that no mutations have occurred in these sites. As well as no major rearrangements have occurred in the mitochondrial genome, despite the high mutation rates in the genome of mitochondria. However, this conclusion is limited to the cases in this study.
4.4. DNA sequencing: Single nucleotide polymorphism (SNP), pathogenic point mutations as well as insertion, deletion of small fragments (less than 10 nucleotides) cannot be detected easily by RFLP, particularly if the mutations are in between the restriction sites. Therefore, in order to identify the mutations, all 4 fragments (A, B, C and D) for all patients were sequenced with the inner primers that were designated for each of the fragments (Tables 3.4 and 3.5). However, major rearrangement in the genome of mitochondria inform of major deletion and or insertion that has been identified in other studies (Finnilä, 2000) was not identified in this study. This might be due to either that the small fragments generated by large deletion have been missed during the amplification process and/or purification and the strategy that followed in this study (4 overlapping fragment) are optimized for correct large sizes (A, B and C). The other possibility is that the sizes of the experiment (number of cases) in this study were small that the major rearrangement is absent in the study. However, the sequencing revised 2 main types of mutations: 4.4.1. Homosome mutations This type of mutation is where the mutant is homogenous in the population. 4.4.1.1. Mutation in the protein - translational components In the mitochondrial genome, there are 2 distinct genes coding for 2 types of ribosomal RNA (mt-rRNA). These are 12S rRNA and the second is 16S rRNA. The other components such as translational factors are encoded in nDNA.
-79-
Chapter Four
Results and Discussions
Mutation in 12S rRNA The 12S rRNA consists of 964 nt and the location of the gene in the mitochondrial genome is from nucleotides (648 -1601), that is located in fragment A in this study (Figur 3.1). This molecule 12S rRNA incorporates to the SSU of the mitochondrial ribosome, in which it functions in the initiation of protein translation in the organelle. A transition mutation at the position G709A has been identified in one of the cases (case no. 5) (Figure 4.11), causing disruption of a small loop in mt-12S rRNA structure (Figure 4.12). Therefore, it is likely that the mutations have affected the initiation phase of protein translation. Clinically, the mutation is associated to deafness that has been identified in the Chinese population and it associated with non-syndromic inherited hearing loss (wei et al., 2009 and Z Li et al., 2005). Moreover, it has been claimed that it is lineage related mutation as well as, specifically in the haplogroups H, V, T and W (Finnila et al., 2001 and Herrnstadt et al., 2002).
-80-
Chapter Four
Query
661
Sbjct
659
Results and Discussions
TCCTAGCCTTTCTATTAGCTCTTAGTAAGATTACACATGCAAGCATCCCCATTCCAGTGA |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| TCCTAGCCTTTCTATTAGCTCTTAGTAAGATTACACATGCAAGCATCCCCGTTCCAGTGA
720 718
Figure 4.11: Electropherogram and sequence alignment for transition mutation G709A in12S rRNA gene.
709 G>A
Figure 4.12: Location of G709A point mutation on secondary structure of 12S rRNA.
-81-
Chapter Four
Results and Discussions
Mutation in 16S rRNA The mitochondrial 16S rRNA consists of 1558 nucleotides that is located at the position 1671-3229 on the mitochondrial genome particularly in fragment A (Figure 3.1). It incorporates into large a subunit of the mt–ribosome. The function of the large subunit is the elongation of protein synthesis (accumulation of new amino acid into the nascent peptide chain on the ribosome). A single homosome transition mutation at the position G1888A has been identified in case (patient) no. 5 (Figure 4.13). The mutation is located in domain II in the mt–16s rRNA (Figure 4.14). The mt–16S rRNA is equivalent to 23S rRNA in Escherichia coli (E. coli), which the molecule incorporates to the large subunit of the E. coli ribosome. The function of domain II in 23S rRNA is interacting with domain V in the peptidyl transferase centre (Douthwaite, 1992). Furthermore, mutations in both domains (II and V) in E. coli confer resistance to Erythromycine and Chloramphinicole that are 2 antibiotics that are known to block the elongation phase in the protein biosynthesis (Douthwaite et al., 1985). Therefore, it is likely that even the mutation G1888A in case no. 5 in this study might affect the elongation phase of protein translation. Clinically, the mutation is lineage related and it is associated to type 2 diabetes in Caucasians and haplogroups T, C and A (Herrnstadt et al., 2002), while in the African population the mutation is not so significant (Crispim et al., 2005).
-82-
Chapter Four
Query
1861
Sbjct
1859
Results and Discussions
AATTAACTAGAAATAACTTTGCAAGGAGAACCAAAGCTAAGACCCCCGAAACCAGACGAG ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| AATTAACTAGAAATAACTTTGCAAGGAGAGCCAAAGCTAAGACCCCCGAAACCAGACGAG
1920 1918
Figure 4.13: Electropherogram and sequence alignment for transition mutation G1888A of 16S rRNA gene.
1888 G>A
Figure 4.14: Location of G1888A point mutation on secondary structure of 16S rRNA.
-83-
Chapter Four
Results and Discussions
4.4.1.2. Mutations in electron transport chain (complex I) The mitochondrial electron transport chain (mtETC) consists of 4 multi–subunit enzyme complexes. Complex I or NADH: ubiquinoe oxidoreductase is the largest multi subunit enzyme complex that consists of 41 subunits. 7 of the subunits are encoded by mitochondrial genome, while the reminder 34 subunits are encoded by the nuclear genome. The mutations that have been identified in this study all are in the mitochondrial encoded gene, which is the aim of this study (mitochondrial genome mutation). 2 types of mutations have been identified: 1- base substitution leading to the amino acid substitution, 2- base insertions and deletion leading to frame-shift mutation. All of which are in ND1 (NADH dehydrogenase 1) and ND2 (NADH dehydrogenase 2) genes. Base substitution mutation (amino acid substitution) The amino acid substitutions that have been identified in this study are: 1st neutral non polar amino acid Tyrosine (TAT) to basic amino acid Histidine (CAT) that is caused by a single nucleotide substitution at the position 4216, which is T>C in the first position of the Tyrosine codon in the ND1 gene. The 2nd positive charge side chain Asparagines (AAC) was substituted to negative charge side chain Aspartate (GAC) that is caused by a single A>G substitution at nucleotide residue 4917 in the first position of the amino acid Tyrosine codon in the ND2 gene (Table 4.7): Table 4.7: A list of amino acid substitution mutations. Nucleotide residue
Gene
Wild type codon & amino acid
Mutant codon & amino acid
Found in case No.
T4216C
ND1 (complex I)
“TAT” Tyrosin (non-polar)
“CAT” Histidine (basic)
5
A4917G
ND2 (complex II)
“AAC” Asparagine (positive)
“GAC” Asparate (negative)
5
-84-
Chapter Four
Results and Discussions
Since the side chains of the amino acids (Wild type vs. Mutant) are different, therefore the mutations might affect the structure and function of the protein. Moreover, it is not clear if both of the mutations are from same cells or different cells. Clinically, both types of mutations T4216C and A4917G (Figure 4.15) cause secondary Leber's Hereditary Optic Neuropathy (LHON), despite the presence of the mutation as a dual mutations or single (separate) mutation. However, the mutated ND1 and/or ND2-dependent respiration decreases by approximately 40% in the cells. Moreover, there is an increase in the lactate to pyruvate ratio in the ND1 and/or ND2 mutant variant. All of this will lower the rate of ATP production. The neurons of the Optic nerve are the first affected by the mutations because of their high demand for ATP, some of these neurons die leading to an increase load on other neurons, those in turn die resulting in total blindness. These two mutations that cause LHON are related with haplogroup J and T respectively (Abu-Amero. 2011 and Lodi et al., 2000). Both of the mutations have been identified in same patient (case no. 5) in this study.
-85-
Chapter Four
Results and Discussions
Query 4206 TTACTTATATGACATGTCTCCATACC 4231 |||||||||||| ||||||||||||| Sbjct 4104 TTACTTATATGATATGTCTCCATACC 4229
Query 4903 AATCTCTCCCTCACTAGACGTAA 4925 |||||||||||||||| |||||| Sbjct 4901 AATCTCTCCCTCACTAAACGTAA 4923
Figure 4.15: Electropherograms and sequence alignments for transition mutations at T4216C and A4917G in the MT-ND1 (left) and MT-ND2 (right) genes respectively.
-86-
Chapter Four
Results and Discussions
Frame-shift mutation: i) Insertion mutation Frame shifting generated by the insertion of a single nucleotide has been identified in 2 of the cases (patients) that are: case no. 5 with insertion of a single cytosine (C) nucleotide at position 3996 in the ND1 gene (Figure 4.16), while the second case no.1 harbours a single nucleotide insertion at the position 5437 in the ND2 gene (Figure 4.17).
-87-
Chapter Four
Query
3960
Sbjct
3959
Results and Discussions
GCCCCTTCGCCCTATTCTTCATAGCCGAATACACAAACCATTATTATAATAAACACCCTC ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| GCCCCTTCGCCCTATTCTTCATAGCCGAATACACAAA-CATTATTATAATAAACACCCTC
4019 4017
Figure 4.16: Electropherogram for insertion mutation C in the ND1 gene at nucleotide position 3996 (+C 3996).
Query
5400 CGTAAAAATAAAATGACAGTTTGAACATACAAAACCCACCCCCATTCCTCCCCACACTCA |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbject 5399 CGTAAAAATAAAATGACAGTTTGAACATACAAAACCCA-CCCCATTCCTCCCCACACTCA
5459 5457
Figure 4.17: Electropherogram and sequence alignment for insertion mutation C in the ND2 gene at nucleotide position 5437 (+C 5437).
-88-
Chapter Four
Results and Discussions
As it shown in Figures 4.18 and 4.19 the 2 insertion mutations lead to amino acid substitutions in the rest of the amino acids beyond the insertion site (last 13 amino acids and 25 amino acids respectively). Furthermore, the insertion in ND1 (+C 3996) causes premature termination of the protein, by providing AGG stop codon at the position of GGA codon:
-89-
Chapter Four
Results and Discussions
Wild-type: 5’- Lle Ile Met Met Asn Thr Leu Thr Thr Thr Ile Phe Leu Gly -3’ Mutant: 5’- His Tyr Tyr Asn Lys His Pro His His Tyr Asn Leu Pro Stop -3’
Figure 4.18: Amino acids sequence beyond the insertion mutation (+C 3996) of ND1 gene. Wild- type: Mutant: Wild- type: Mutant:
5’ Thr Pro Phe Leu Pro Thr Leu Ile Ala Leu Thr Thr Leu Leu Leu 5’ Thr Pro Ile Pro Pro His Thr His Ala Pro Tyr His Ala Thr Pro Pro Ile Ser Pro Phe Met Leu Met Ile Leu Thr Tyr Leu Pro Phe Tyr Thr Asn Asn Leu
T 3’ AT 3’
Figure 4.19: Amino acids sequence beyond the insertion mutation (+C 5437) of ND2 gene.
-90-
Chapter Four
Results and Discussions
ii) Base deletion The other mutation identified is a deletion of a single nucleotide Thymine (T) at the position 15721 in the Cytochrome-b gene (Figure 4.20) in the case number 3 in this study. The deletion mutation causes a stretch (rest) of amino acid substitution beyond the mutation (deletion) site, as well as premature termination in the gene (Figure 4.21). Regularly, the stop codon UAA in this mRNA Cytochrome-b like most of the other mRNA in mitochondria is provided by 3’ Poly A tailing during the mRNA processing. Therefore, it is not clear that the termination codons generated from frame-shift mutation leading to complete termination of the protein translation process or the termination codon sites are leaky mutations. That only part of the mRNA will be terminated and the other fraction will be translated by 3’woble position. However, in both cases the protein is a mutant variant, which affects the ETC and ATP production.
-91-
Chapter Four
Results and Discussions
Query 15710 CCAATCACTTTA-TGACTCCTAGCCGCAGACCTCCTCATTCTAACCTGAATCGGAGGA 15767 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct 15709 CCAATCACTTTATTGACTCCTAGCCGCAGACCTCCTCATTCTAACCTGAATCGGAGGA 15766
Figure 4.20: Electropherogram and sequence alignment for deletion mutation (T) from cytochrom-b gene at nucleotide position 15721 (T 15721).
Wild-type: Tyr Trp Leu Leu Ala Ala Mutant:
Asp Leu Leu Ile Leu Thr Trp Ile Gly Gly Gln
Tyr Asp Ser Stop Pro Gln Thr Ser Ser Phe Stop Pro Glu Ser Glu Asp Asn
Wild-type: Pro Val Ser Tyr Pro Phe Thr Ile Ile Gly Gln Val Ala Ser Val Leu Tyr Mutant: Glu Stop Ala Thr Leu Leu Pro Ser Leu Asp Lys Stop His Pro Tyr Tyr Thr Wild-type: Phe Thr Thr Ile Leu Ile Leu Met Pro Thr Ile Ser Leu Ile Glu Asn Lys Mutant: Ser Gln Gln Ser Stop Ser Stop Tyr Gln Leu Ser Pro Asn Trp Lys Thr Lys Wild-type: Met Leu Lys Trp Ala Mutant: Tyr Ser Asn Gly Pro Figure 4.21: Amino acids sequences beyond the deletion mutation (T 15721) in cytochrom-b gene.
-92-
Chapter Four
Results and Discussions
4.4.2. Heterosomy mutations. The second type of mutations identified in this study is heterosome mutation, which is a specific type of mutation for mitochondrial population. In this type, both the mutant and the wild type genome variants coexist in the same mitochondrial population (same cell and different cells). Surprisingly, most of the heterosome mutations identified in this study are located in one of the subunits of the Complex I. The positions of the heterosome mutations are listed in Table 4.8 and Figures 4.22, 4.23 and 4.24. Table 4.8: A list of heterosome mutations. Nucleotide residue A6737C
Gene
Wild type codon and amino acid
Mutant codon and amino acid
Cytochrome–c
(ATA) Metheonine (ATC) Isoleucine
(complex I)
(Hydrophilic)
(Hydrophobic)
(GAC) Aspartate (Polar –ve charged (Polar +ve charged side chain) side chain)
Case no.
1
(AAC) Asparagine A10617G
ND4L (Complex I)
(ACT) Threonine C11304G
ND4 (Complex I)
(Polar
(AGT) Serine
uncharged (Polar uncharged side chain) side chain)
-93-
4
4
Chapter Four
Results and Discussions
QUERY 6726 TCTGAGCTATGATATCAATTGGCTTCCTAGGGTTTATCGTGTGAGCACACCATA |||||||||||||||||||||||||||||||||||||||||||||||||||||| SBJCT 6724 TCTGAGCTATGATATCAATTGGCTTCCTAGGGTTTATCGTGTGAGCACACCATA
6779
QUERY 6726 TCTGAGCTATGATCTCAATTGGCTTCCTAGGGTTTATCGTGTGAGCACACCATA ||||||||||||| |||||||||||||||||||||||||||||||||||||||| SBJCT 6724 TCTGAGCTATGATATCAATTGGCTTCCTAGGGTTTATCGTGTGAGCACACCATA
6779
(Wild type) 6777
(Mutant) 6777
Figure 4.22: Electropherogram and sequences alignment for heterosome mutation in the cytochrom-c gene (complex I) at the position 6737 (A6737C).
Query 10541 TACTATCGCTGTTCATTATAGCTACTCTCATAACCCTCAACACCCACTCC |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 10539 TACTATCGCTGTTCATTATAGCTACTCTCATAACCCTCAACACCCACTCC
10590
Query 10541 TACTATCGCTGTTCATTATAGCTACTCTCATAACCCTCGACACCCACTCC |||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 10539 TACTATCGCTGTTCATTATAGCTACTCTCATAACCCTCAACACCCACTCC
10590
(Wild type) 10588
(Mutant) 10588
Figure 4.23: Electropherogram and sequence alignments for heterosome mutation in the ND4L gene at the position 10617 (A10617G). -94-
Chapter Four
Results and Discussions
Query 11281 CTAAACATTCTACTACTCACTCTCACTGCCCAAGAACTATCAAACTCCTGA 11330 ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 11279 CTAAACATTCTACTACTCACTCTCACTGCCCAAGAACTATCAAACTCCTGA 11328
(Wild type)
Query 11281 CTAAACATTCTACTACTCACTCTCAGTGCCCAAGAACTATCAAACTCCTGA 11330 ||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct 11279 CTAAACATTCTACTACTCACTCTCACTGCCCAAGAACTATCAAACTCCTGA 11328
(Mutant)
Figure 4.24: Electropherogram and sequence alignments for heterosome point mutation in the ND4 gene at position 11304 (C11304G).
-95-
Chapter Four
Results and Discussions
The mutations A6737C and A10617G in the cytochrom-c and ND4 respectively are leading to a major amino acid substitution (Table 4.8). Therefore, they may be affect the structure of both proteins cytochrome-c and ND4L respectively. The structures of the amino acids are determined by the side chains, and subsequently the folding and the function of the proteins are determined by the side chains of the amino acids as well. Therefore, substitutions from hydrophilic to hydrophobic and positive (+ve) to negative (–ve) charged side chain or vice versa are considered as a major mutation and subsequently affect the structure of the protein and the function. While the third C11304G mutation in ND4 is leading to substitution Therionine to Serine, in which the 2 amino acids are in the same group (polar uncharged side chain). Thus, this mutation might not have severe effect or no effect at all on the protein structure and function. Generally, the appearance of disease symptoms from heterosom mutations is dependent on the level (percentage) of the mutant variants genome existence in the mitochondrial population (threshold level). Therefore, mutations A10617G and C11304G that identified in case number 4 are present less than 50%, as well as the mutation A6737C in case number 1 is less than 25%. The disease symptoms in both of the cases might not appear, while the high risk in this case is transferring of the mutant variant to the next generation either over the threshold level or as a homosome mutation variant. Moreover, surprisingly most of the mutations (homosomes and heterosomes) identified in this study are located in the complex I, except the 2 mutations in the mt-rRNAs (12SrRNA and 16SrRNA)
4.5. Single Nucleotide Polymorphisms (SNP) detection in this study 4.5.1. The SNP are possibly related to lineage of Kurdish population The second important region in the mitochondrial genome is the non coding D-Loop region (fragment D, Figure 3.1). This region contains two hyper variable regions (HVI and HV2), as well as it contains the regulatory elements for the genes in the coding region. The mutations in the variable region SNP are related to the human lineages and haplogroups. Despite that, the sizes of the samples (cases) in this study are few (only 8 samples). It was desired to identify the most common SNP mutations that might be related to the Kurdish lineage and haplogroup. The results are presented in Table 4.9 below and electropherogram peaks are presented in Appendices 2, 3, 4, 5, 6, 7 and 8. -96-
Chapter Four
Results and Discussions
Table 4.9: Common Single Nucleotide Polymorphisms (SNP) between the 8 tested samples. Nucleotide residue A263G 309 +C (insertion) T16519C A750G 315 +C (insertion) A73G A1438G A4769G
Location in the genome HV1 HV2 Other Genes HV2 HV2 HV1 12SrRNA HV2 HV2 12SrRNA ND2
Sample No. Lineage 1-8 (all samples) 1-7 1-8 (all samples) 1-8 (all samples) 1-8 (all samples) 1-7 1-5 1-5
CRS H2a2a H2a4 H2a2 & H2a2a H2a2a pre-HV, H, H2a, H2a2a H2 H2a
The mutations presented in Table 4.9 are identified in almost all the cases, however the last 2 mutations (A1438G and A4769G) are only presented in the first 5 cases (1, 2, 3, 4 and 5) not in the last 3 cases (6, 7 and 8). The reason is that the entire genome was sequenced for only the first 5 cases, while the 3 last cases were sequenced only for D-Loop, and the last mutations are located in the coding region that were not sequenced for last 3 cases. Therefore, it is likely that the mutation exists even in the last 3 cases (6, 7, and 8) as well. Furthermore, since all common mutations are identified to the haplogroup H and particularly H2a serial, and the H haplogroup belongs to the European population, therefore it is most likely that this haplogroup migrated back to Mesopotamia (Asia) sometime in the history (Figure 4.25).
-97-
Chapter Four
Results and Discussions
H
Figure 4.25: Haplogroup H back migration from Europe to Asia.
-98-
Chapter Four
Results and Discussions
4.5.2. The SNP may be related to different mitochondrial DNA lineage and forensic. The second type mutations identified in this study may be related to both lineage (less common between samples) and forensics (common between closely related samples) (Table 4.10) below and the electropherogram peaks in Appendices 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 and 19. Table 4.10: Single Nucleotide Polymorphisms may be related to lineage and forensic DNA. Nucleotide residue
Location in the genome HV1
T204C
HV2
Sample No. Lineage
Other Genes
HV2
2, 3 and 4
H2a2a
A2706G
16S rRNA
1&5
H
C7028T
COXI
1
H
A8860G
ATPase 6
2, 3, 4 and 5
C12705T
NAD5
1
C14766T
Cyt-b
1&5
HV
A15326G
Cyt-b
1-4
CRS
CRS R
T16189C
HV1
1, 2, 3, 4 and 7
L3
C16223T
HV1
1
R
C16278T
HV1
1
L3
A12172G
tRNA histidine
2, 3 and 4
ND
ND: Not determined in any lineage These mutations (SNP) are not common between all samples; they are rather limited between closely related cases (same family). The mutations T204C and A12172G for example, that are located in HV2 and tRNA histidine respectively, are identified only in the cases 2, 3 and 4, in which they are members of the same family (Mother (case number 2) and two sons (cases 3 and 4)). Furthermore, two mutations (A2706G and C14766T) are identified in the cases 1 and 5. Some other mutations are only identified in one or two samples not in other samples. Thus, this might imply that this type of SNP is related to the forensic DNA rather than lineages. Unfortunately, except the samples 2, 3 and 4, which were members of the same family no close relatives in other cases were investigated in this study in order to draw final conclusions -99-
Chapter Four
Results and Discussions
concerning this type of SNP. Therefore, further works are required in order to conclude this assumption. 4.5.3. New point mutations detection The mutations shown in Table 4.11 are unique because they have not been identified in other haplogroups. Thus, the interpretation might be that these mutations are unique for Kurdish population, as well as some of the mutation might belong to the forensic DNA. In order to clarify either of these possibilities, further and broader investigations are required. Table 4.11: New point mutations. Location in the genome Nucleotide residue
HV1
HV2
Other genes
Sample No.
T152C
HV2
8
T195C
HV2
1
A200G
HV2
6
C295T
HV2
8
C462T
HV2
8
T489C
HV2
8
G930A
12S rRNA
5
G1719A
16S rRNA
1
G2528A
16S rRNA
1
G5147A
NAD 2
5
T6221C
COX1
1
A6284T
COX1
1
C6371T
COX1
1
A6791G
COX1
1
G8155A
COX2
1
G8697A
ATPase 6
5
G10646A
NAD 4L
4
A10748T
NAD 4L
3
G13368A
NAD 5
5
G14905A
Cyt-b
5
-100-
Chapter Four
Results and Discussions
A15607G
Cyt-b
5
G15928A
tRNA threonine
5
T16126C
HV1
5
C16179T
HV1
1
A16182C
HV1
1
A16183C
HV1
1
C16193T
HV1
8
C16218T
HV1
7
16247 A=T
HV1
3
C16294T
HV1
5
C16296T
HV1
5
T16304C
HV1
5
C16328A
HV1
7
T16356C
HV1
8
-101-
Supervisor’s certification
I certify that this thesis was prepared under my supervision at the university of Sulaimani, college of science and do hereby recommend it to be accepted as a partial fulfillment of the requirements for the degree of Master of Science in General Genetics.
Signature: Supervisor: Farhad M. Barzinji Scientific grade: Asst. Professor Date:
/
/ 2014
In view of the available recommendations, I forward the thesis for debate by the examining committee.
Signature: Name: Huner Hiwa Arif Chairman of Biology Department. Date:
/
/ 2014
