Weed Science 2008 56:490–495

Cloning and Characterization of a Critical Meristem Developmental Gene (EeSTM) from Leafy Spurge (Euphorbia esula) Vijaya Varanasi, Tracey Slotta, and David Horvath* SHOOTMERISTEMLESS (STM) encodes a member of the class I KNOX homeodomain protein family that is required for meristem development and maintenance. We have isolated both genomic and cDNA clones of STM from the perennial weed leafy spurge. A comparison to other class I KNOX genes indicates that EeSTM represents an orthologue of AtSTM and not one of the other class I KNOX gene family members. 59 rapid amplification of cDNA ends (RACE) indicated that the transcription initiation site is close to the start of translation and is conserved between arabidopsis and leafy spurge. Putative cis-acting elements were identified in the EeSTM promoter, including a tuber-specific sucrose-responsive element, which could play a major role in the expression of EeSTM in root tissue. Nomenclature: Arabidopsis, Arabidopsis thaliana L. ARATH; leafy spurge, Euphorbia esula L. EPHES. Key words: SHOOTMERISTEMLESS, meristem development, promoter analysis, phylogenetics.

Many weeds propagate through the development and regulated growth of adventitious shoot buds. Additionally, many weeds maintain a pool of viable but dormant shoot buds as a means to survive periods of growth-inhibiting environmental conditions. In many perennial weeds, these buds are essentially fully formed shoot meristems that are initiated and develop on the underground roots, on the crown, or both. In recent years, studies on model organisms such as arabidopsis have resulted in a greater understanding of the genes required for proper shoot meristem initiation and development. One of the genes required for shoot development is STM. STM is a member of the class I KNOX homeobox gene family. KNOX-encoded transcription factors are important in regulating meristem development and maintenance in several plant species (Barton and Poethig 1993; Groover et al. 2006; Long et al. 1996). STM in particular is required for regulating stem cell fate and maintaining a population of stem cells in the central portion of the shoot apical meristem (SAM) (reviewed by Scofield and Murray 2006). STM acts synergistically with another homeobox protein WUSCHEL (WUS). Over-expression of WUS leads to an accumulation of cells in the meristem central zone. WUS also induces CLAVATA 3, whose gene product (CLV3) works together with CVL1 and CVL2 to repress WUS expression. CLV proteins also may be involved in initiating meristematic cells to begin differentiating at the periphery of the SAM (Bowman and Eshed 2000). For the process of organogenesis and growth to take place, a proper balance has to be maintained between stem cell production and differentiation of daughter cells. KNOX (KNOTTED1like homeobox) genes such as STM are regulated by ROUGH SHEATH2 (ZmRS2) in maize and ASYMMETRIC LEAVES1 (AS1) in arabidopsis (Byrne et al. 2002; Tsiantis et al. 1999). Both RS2 and AS1 code for a MYB-domain protein which down-regulates KNOX genes in developing leaves. The LATERAL ORGAN BOUNDARIES (LOB) protein, encoded by ASYMMETRIC LEAVES2 (AS2), interacts with AS1 to promote leaf differentiation through KNOX gene repression DOI: 10.1614/WS-07-192.1 * First author: Department of Plant Sciences, North Dakota State University, State University Station, Fargo ND 58105; second and third authors: U.S. Department of Agriculture, Agricultural Research Service, Biosciences Research Laboratory, P.O. Box 5674, State University Station, Fargo, ND 58105-5674; and Department of Plant Sciences, North Dakota State University, Fargo, ND 58105. Corresponding author’s E-mail: [email protected]

490

N

Weed Science 56, July–August 2008

(Xu et al. 2003). Initiation of AtSTM requires the expression of micro-RNA–regulated CUP-SHAPED COTYLEDON (CUC ) in the SAM (Kidner and Martienssen 2005). Although STM has been extensively studied in annual plant species such as arabidopsis and likely orthologues have been identified in nearly all plant species in which it has been looked for, very little is known about STM in perennials that produce adventitious buds capable of various states of dormancy. We have chosen to study STM in leafy spurge. Leafy spurge is emerging as a model perennial that is ideal for studying bud dormancy (Chao et al. 2005). Leafy spurge produces large numbers of easily identifiable adventitious buds along the lateral roots (often referred to in the literature as root buds) and on the underground stem (referred to as crown buds). Root and crown buds of leafy spurge are capable of displaying all three types of dormancy (para-, endo-, and ecodormancy) described by Lang et al. (1987). These buds form early in the summer, and enter a state of paradormancy (sometimes referred to as apical dominance or correlative inhibition). This paradormant state is maintained throughout the growing season unless the aerial portion of the plant is killed or the buds are in some other way separated from the growing shoot. Physiological studies have shown that paradormancy is maintained by two separate signals in leafy spurge. One signal is auxin, which appears to act through well-established mechanisms of apical dominance. The other signal appears to be sugar produced in the photosynthesizing leaves, which specifically inhibits G1 stage of the cell cycle through modifying the gibberellic acid/abscisic acid ratio (Chao et al. 2006; Horvath et al. 2002). In the fall, buds of leafy spurge enter an endodormant state in which the buds will not grow even if the aerial portion of the plant is excised and the plant is placed in growth-conducive conditions (Anderson et al. 2005; Chao et al. 2006). The endodormant state is released by prolonged periods of cold temperatures (Anderson et al. 2005). However, if the plant is left in the cold, the buds remain in an ecodormant state and will not develop into growing shoots until growth-conducive conditions return in the spring (Anderson et al. 2005). A wide array of genomic resources are available for leafy spurge including a whole plant normalized cDNA library, an expression sequence tags database with . 23,000 unique sequences (. 19,000 unigenes), two subtracted cDNA libraries, a two-hybrid cDNA library made from a mix of growing and dormant buds, and a genomic library (Anderson et al. 2007; Chao et al. 2005).

the overlapping sequence of the contig-forming clones was not identical, and thus the contig could represent a chimera of similar but unique genes or alleles.

Figure 1. Graphic representation of the putative gene model of leafy spurge EeSTM and arabidopsis AtSTM showing relative positions of TATA boxes, transcription start sites, and intron/exon boundaries.

We have cloned and characterized several likely orthologues of AtSTM from leafy spurge (EeSTM ). Sequence analysis of the EeSTM promoter identified putative cis-acting elements that may be important for expressing EeSTM in root and crown tissue of leafy spurge. Materials and Methods

Plant Material and Treatments. Plants used for the DNA extraction were grown in cones (5 by 20 cm) with Sunshine mix1 at the U.S. Department of Agriculture greenhouse as single stems under 16 h of natural and artificial lighting. Cloning and Characterization of EeSTM. STM gene sequences from different species including arabidopsis, poplar (Populus ssp.), and snapdragon (Antirrhinum majus) were collected from the GenBank and aligned using the ClustalX software. Conserved regions were identified and primers were designed to hybridize to the conserved regions. The primer sequences used were GATCCGGGGCTTGACCAGCT CATGGA (59) and TGCATGTCTTCAGATGGTTTCCA (39), which were designed to amplify across the second and third introns. cDNA was synthesized from total RNA isolated from growing root buds of leafy spurge, and the EeSTM primers were used to amplify the initial EeSTM fragment. The polymerase chain reaction (PCR) product was run on 1% agarose gel, and a band of the appropriate size (502 base pairs [bp]) was identified, excised, and extracted from the gel using a Qiagen PCR purification kit.2 This purified DNA fragment was cloned and sequenced to confirm its identity and then used as a probe for screening a lambda hybrid-Zap2 cDNA library from growing buds of leafy spurge. Once cDNA clones were isolated and sequenced, primers to the 59 end of the clone were designed and used to produce a probe for screening a leafy spurge genomic library. Primer sequences used to generate the 59 EeSTM-specific probe were CTTTGTGG CTATTAGATTGCGTAG (59) and GCAGTTGATG TAAGCAGCAAGGAG (39).The resulting clones were sequenced and characterized. Two of the genomic clones formed a single contig that contained , 2,000 bp of 59 promoter sequence and , 600 bp of sequence 39 to the poly A addition site of the cDNA clone EeSTM4 allowing the development of a putative gene model (Figure 1). However,

Southern Blot Analysis. A 568-bp fragment containing the 39 end of the promoter and the 59 end of the coding sequence was isolated and used as a probe for Southern blotting. Total genomic DNA was isolated from leafy spurge using the CTAB extraction procedure (Murray and Thompson 1980). DNA was digested to completion with HindIII, BamHI, and EcoRI. To ensure complete digestion, DNA was treated with restriction enzymes for 6 h with addition of fresh enzyme added after the first 3 h. Care was taken to ensure that the concentration of enzyme did not exceed one-tenth of the reaction volume to avoid star activity of glycerol-sensitive enzymes. The resulting DNA fragments were separated on a 1% agarose gel and blotted (Sambrook et al. 1989). The 568bp fragment was radio-labeled with P32 dCTP and hybridized to the Southern blot overnight. The blot was washed at high stringency (twice in 0.1 3 SSC 0.1 % sodium dodecyl sulfate at 65 C for 15 min each) and then exposed to X-ray film overnight. 59 RACE. The transcription start site of the EeSTM gene was mapped using BD SMART RACE cDNA amplification kit3 from total growing-bud RNA according to manufacturer’s specifications (Zhu et al. 2001). The EeSTM-specific 39 primer sequence was GCAGTTGATGTAAGCAGCAAG GAG. In order to improve the specificity of 59 RACE amplification, a touchdown PCR was done. The PCR product was run on agarose gel, purified, and cloned into pGEM (Promega pGEM – T Vector System I). The cloned 59 RACE fragment was sequenced and the transcription start site for EeSTM gene in leafy spurge determined. Data Mining of EeSTM Sequences. A search of all potential cis-acting sequences in the promoter of EeSTM was done using programs on the PLACE website (Higo et al. 1999). Potential micro-RNA interaction sites in arabidopsis were identified using the algorithm developed by Adai et al. (2005). Phylogenetic Analysis. DNA and amino acid sequences for full-length STM genes were obtained from GenBank. Amino acid sequences were aligned using ClustalX and an unrooted tree was generated in PAUP 4.0 (Swofford 2000) using UPGMA for similarity analysis. Bootstrap values were calculated using these parameters with 1,000 bootstrap replicates. DNA sequences were analyzed using PAUP 4.0*b. Parsimony analysis with tree bisection-reconnection (TBR) branch-swapping algorithm, steepest decent model with random addition of samples with 100 replicates was performed. Bootstrap values were calculated using these parameters with 100 bootstrap replicates. Branches collapsed with less than 50% support. Bootstrap values are indicated on one of the most parsimonious trees. Results and Discussion

Cloning and Characterization of STM from Leafy Spurge. Likely orthologues of STM have been cloned and characterized from numerous plant species. We obtained sequences Varanasi et al.: Cloning and Characterization of EeSTM

N

491

from several STM genes and aligned them to identify likely conserved regions for primer development. These primers were used to amplify a fragment containing a portion of an EeSTM gene from leafy spurge. Sequence analysis of the fragment confirmed its identity, and this fragment was used to identify other EeSTM genes from cDNA and genomic libraries for leafy spurge. Both full-length cDNA (EF636205, EF636206) and two contiguous genomic clones of EeSTM were obtained and used to develop a putative gene model (EF636204). Comparison between the various clones identified several minor differences, mostly in regions containing simple sequence repeats near the 59 end of the transcript, although there were also several single-nucleotide polymorphisms that would cause an altered codon usage. None of these differences appeared to result in frame shifts or other major differences that would disrupt the expression of the gene(or genes) suggesting that all clones represented functional genes. Multiple Copies of EeSTM Are Present in Leafy Spurge. Southern blot analysis indicated that there were multiple copies of STM genes present in the leafy spurge genome (Figure 2), including one exceptionally dark band corresponding to the known sequence of the genomic clones and five additional fainter bands of different sizes. It is undetermined if the fainter hybridization to four of the bands relative to the dark 1,220-bp band is due to multiple copies of genes producing a 1,220-bp band or if the fainter bands had less homology to the probe than the 1,220-bp band. Sequence analysis from two similar but not identical genomic clones contained appropriate restriction sites that would produce the same size fragment, and neither of these exactly matched either of the two cDNA clones that also contained the 39-most HindIII site. Thus it is most likely that the 1,220-bp band contains multiple different copies of the EeSTM. Thus, in all likelihood, there are more than five different DNA fragments hybridizing to the probe. Consequently, unlike arabidopsis, which contains only a single copy of STM, leafy spurge appears to have at least five different cross-hybridizing copies of STM genes. This was expected because leafy spurge is an auto-allo hexaploid (Schultz-Schaeffer and Gerhardt 1987) and therefore could have as many as six different copies for any given gene. Poplar, which is a diploid that is in the same order as leafy spurge, has two paralogous copies of STM (KN2 and ARBORKNOX1). Thus, there may be as many as 12 different copies of STM in leafy spurge. It will be interesting to look for specific expression patterns from some of these homeologous and paralogous genes. Phylogenetic Comparisons Suggest EeSTM Are More Closely Related to AtSTM than to Other KNOX Gene Family Members. A comparison between the genomic clones of EeSTM and the AtSTM gene indicated that there were an equivalent number of introns and the positions of these introns were highly conserved (Figure 1). A phylogenetic analysis of protein sequences of various STM-like genes from numerous different plants indicated that EeSTM is most closely related to orthologous genes from poplar and other perennials such as grape (Vitis vinifera L.) and snapdragon (Figure 3). Both poplar and leafy spurge are members of the same plant order (Malpighiales). STM-like genes from the solanaceous plants also cluster together as do those from 492

N

Weed Science 56, July–August 2008

Figure 2. Southern blot hybridization of leafy spurge genomic DNA digested with several restriction enzymes and restriction enzyme combinations. A graphic representation of the EeSTM gene is shown along with the region of the gene contained within the probe used for hybridization. The estimated size of the resulting fragments is shown to the left of the blot.

legumes and brassicas. All these are well separated from KNAT1 of arabidopsis and the STM-like genes from monocots. These results are consistent with previous phylogenetic analyses of KNOX genes (Guillet-Claude et al. 2004; Reiser et al. 2004). These results suggest that our EeSTM genes represent orthologues or recent paralogues of AtSTM rather than a different member of the class I KNOX gene family. Expression data from EeSTM is consistent with a role in meristem development (Varanasi et al., unpublished data). Further analysis is needed to confirm that the function of EeSTM is consistent with other STM orthologues. Sequence of STM orthologues is tightly conserved over considerable evolutionary distances within dicot species, but shows separation between dicot and monocot species. A similar separation was observed among other class I KNOX genes in previous studies (Guillet-Claude et al. 2004). Interestingly, analysis of the DNA sequence split the two copies of STM-like genes from poplar into two groups (Figure 4). ARBORKNOX1 clustered with AtSTM whereas poplar KN2 clustered with EeSTM1 and EeSTM4. This suggests that perhaps the EeSTM genes are paralogues to an as yet unidentified orthologue of ARBORKNOX1 and STM. If this is indeed the case, then it provides additional evidence that there are multiple copies of EeSTM in leafy spurge. Transcription Start Site and Several Putative cis-Acting Elements Are Conserved among STM-Like Genes. The transcription start site of EeSTM was mapped using 59 RACE. 59 RACE consistently produced a fragment that ended 27 bp 39 to a potential TATA box sequence and only 21 bp 59 from the putative start codon. A similarly positioned TATA box with an identical sequence to the TATA sequence from the EeSTM gene (TATATAG) is conserved in arabidopsis

Figure 3. Relationship of STM and other KNOTTED genes based on a ClustalX alignment of amino acid sequences. The unrooted tree was generated in PAUP 4.0 using UPGMA for a similarity analysis. Orders of species in specific clusters are noted. Note the position of leafy spurge, poplar, grape, and snapdragon on one branch, indicating greater sequence similarity among these perennial species.

(Figure 5). Additional similarities between the leafy spurge and arabidopsis STM genes include a conserved GAGA GAAAGAGA sequence immediately 59 to the putative start codon. Searches of potential interacting micro-RNAs and against known cis-acting elements with this sequence were negative. It is not known if the conserved sequence GAGAGAAAGAGA plays any role in regulation of the STM gene in arabidopsis or leafy spurge, however, the fact that this sequence is conserved over extensive phylogenetic distances is suggestive of some functional role. A 10-bp motif (GCTAAACAAT) was also identified within the promoter of EeSTM gene. This sequence, which is identical to a potato (Solanum tuberosum L.) tuber-specific and sucrose-inducible element, serves as the binding site for the transcription factor Storekeeper (STK) from potato

(Zourelidou et al. 2002). There is no obvious STK binding site in the AtSTM promoter. STK is a conserved DNAbinding protein first recognized in potato and shown to regulate the expression of patatin (Zourelidou et al. 2002) in tubers. It is interesting that this 10-bp motif is not found in the promoter of AtSTM gene or ARBORKNOX1. AtSTM is not normally expressed in the roots of arabidopsis, and poplar plants do not normally maintain a population of preformed adventitious shoot buds on their root systems, although poplar can and does form adventitious shoots from its roots following damage to the root system or other shoot-inducing treatments. Leafy spurge, however, forms viable shoot meristems on both the lateral roots and the hypocotyl as early as 8 d following germination (Raju 1975). Thus this STK binding site might serve to allow bud formation in a Varanasi et al.: Cloning and Characterization of EeSTM

N

493

Figure 5. Sequence of leafy spurge (a) and arabidopsis (b) promoter. The light grey box indicates the putative Storekeeper binding site. The dark grey box indicates the putative TATA boxes for both leafy spurge and arabidopsis. The italicized sequence shows the probable 59 end of the transcripts as indicated by 59 rapid amplification of cDNA ends clones, and the start codon (ATG) is marked in bold.

Figure 4. Relationship of STM and other KNOTTED genes based on a ClustalX alignment of nucleic acid sequences. The unrooted tree was generated in PAUP 4*b. Parsimony analysis with tree bisection-reconnection branch-swapping algorithm, steepest decent model with random addition of samples with 100 replicates was performed. Note that poplar KN2 clusters with EeSTM1 and EeSTM4 whereas poplar ARBORKNOX1 clusters with AtSTM from arabidopsis.

manner specific to leafy spurge. It will be interesting to determine if these elements, or other root-specific elements, are found in the STM promoter of other plants capable of maintaining populations of underground shoot buds. It might also be interesting to look for wounding-inducible elements in the STM promoters of plants capable of regenerating shoots following damage to the root system such as poplar. Combined with the requirement for STM expression in formation of axillary buds (Grbic and Bleecker 2000), the presence of functional root-specific elements is consistent with the hypothesis that these sequences are required for development of underground adventitious buds in leafy spurge, and thus may provide a potential target for developing novel means to control leafy spurge. Using Multalin (Corpet 1988), the promoter and 59 untranslated region sequence of EeSTM was aligned with the arabidopsis and poplar STM sequences. The sequences at 264 bp (CACCCATTTTCCAAAGGAAA) and at 584 bp (CTTCCTCGATTTGATCG) upstream of the putative transcription start site in EeSTM were found to be highly conserved between leafy spurge and poplar. These sequences have recently been independently identified as a portion of a 494

N

Weed Science 56, July–August 2008

larger conserved element within STM genes from different species (Uchida et al. 2007). Plant transcription factor GT-1 binds to TTTTCC, and stabilizes the TFIIA–TBP–TATA complex (Le Gourrierec et al. 1999). However, it is not known if TTTTCC element found within the conserved sequence at 2264 bp binds this factor. More work is needed to determine if any of these conserved leafy spurge–specific promoter elements play a role in regulating EeSTM expression. Additionally, given the fact that multiple copies of EeSTM-like genes are present in the leafy spurge genome, it will be interesting to determine if any of these are regulated differentially in response to developmental or environmental signals.

Sources of Materials 1

Sunshine mix potting soil, Fisons Horticulture, Inc., 110 110th Ave. N.E., Suite 490, Bellevue, WA 98004. 2 QIAquick PCR purification kit, Qiagen, Inc., 28159 Ave., Stanford, Valencia CA 91355. 3 BD SMART RACE cDNA Amplification Kit, Clontech, 1290 Terra Bella Ave., Mountain View, CA 94043.

Acknowledgments We thank Laura Kelley for technical assistance and Cheryl Kimberlin for growing leafy spurge.

Literature Cited Adai, A., C. Johnson, S. Mlotshwa, S. Archer-Evans, V. Manocha, V. Vance, and V. Sundaresan. 2005. miRNA candidates in Arabidopsis. Computational prediction of miRNAs in Arabidopsis thaliana. sundarlab.ucdavis.edu/mirna/ search_candidates.html. Accessed: April 17, 2008. Genome Res. 15:78–91. Anderson, J. V., R. W. Gesch, Y. Jia, W. S. Chao, and D. P. Horvath. 2005. Seasonal shifts in dormancy status, carbohydrate metabolism, and related gene expression in crown buds of leafy spurge. Plant Cell and Env. 28:1567–1578.

Anderson, J. V., D. P. Horvath, W. S. Chao, M. Foley, A. Hernandez, J. Thimmapuram, L. Liu, G. Gong, M. Band, R. Kim, and M. Mikel. 2007. Characterization of an EST database for the perennial weed leafy spurge: an important resource for weed biology research. Weed Sci. 55:193–203. Barton, M. K. and R. S. Poethig. 1993. Formation of the shoot apical meristem in Arabidopsis thaliana: an analysis of development in the wild type and in the shoot meristemless mutant. Development 119:823–831. Bowman, J. L. and Y. Eshed. 2000. Formation and maintenance of the shoot apical meristem. Trends Plant Sci. 5:110–115. Byrne, M. E., J. Simorowski, and R. A. Martienssen. 2002. ASYMMETRIC LEAVES1 reveals knox gene redundancy in Arabidopsis. Development 129:1957–1965. Chao, W. S., D. P. Horvath, J. V. Anderson, and M. E. Foley. 2005. Potential model weeds to study genomics, ecology, and physiology in the 21st century. Weed Sci. 53:929–937. Chao, W. S., M. D. Serpe, J. V. Anderson, R. W. Gesch, and D. P. Horvath. 2006. Sugars, hormones, and environment affect the dormancy status in underground adventitious buds of leafy spurge (Euphorbia esula). Weed Sci. 54:59–68. Corpet, F. 1988. Multiple sequence alignment with hierarchical clustering. Nucl. Acids Res. 16:10881–10890. Grbic, V. and A. B. Bleecker. 2000. Axillary meristem development in Arabidopsis thaliana. Plant J. 21:215–223. Groover, A. T., S. D. Mansfield, S. P. DiFazio, G. Dupper, J. R. Fontana, R. Millar, and Y. Wang. 2006. The Populus homeobox gene ARBORKNOX1 reveals overlapping mechanisms regulating the shoot apical meristem and the vascular cambium. Plant Mol. Biol. 61:917–932. Guillet-Claude, C., N. Isabel, B. Pelgas, and J. Bousquet. 2004. The evolutionary implications of KNOX-I gene duplications in conifers: correlated evidence from phylogeny, gene mapping, and analysis of functional divergence. Mol. Bio. Evol. 21:2232–2245. Higo, K., Y. Ugawa, M. Iwamoto, and T. Korenaga. 1999. Plant cis-acting regulatory DNA elements (PLACE) database: 1999. www.dna.affrc.go.jp/ PLACE/. Accessed: April 17, 2008. Nucleic Acids Res 27:297–300. Horvath, D. P., W. S. Chao, and J. V. Anderson. 2002. Molecular analysis of signals controlling dormancy and growth in underground adventitious buds of leafy spurge. Plant Physiol 128:1439–1446. Kidner, C. A. and R. A. Martienssen. 2005. The role of ARGONAITE (AGO1) in meristem formation and identity. Dev. Biol. 280:504–517. Lang, G. A., J. D. Early, R. L. Darnell, and G. C. Martin. 1987. Endo-, para-, and ecodormancy: physiological terminology and classification for dormancy research. HortScience 22:371–377.

Le Gourrierec, J., Y. F. Li, and D. X. Zhou. 1999. Transcriptional activation by Arabidopsis GT-1 may be through interaction with TFIIA-TBP-TATA complex. Plant J. 18:663–668. Long, J. A., E. I. Moan, J. I. Medford, and M. K. Barton. 1996. A member of the KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis. Nature 379:66–69. Murray, M. G. and W. F. Thompson. 1980. Rapid isolation of high molecularweight plant DNA. Nucl. Acids Res. 8:4321. Raju, M.V.S. 1975. Experimental studies on leafy spurge (Euphorbia esula L.). I. Ontogeny and distribution of buds and shoots on the hypocotyl. Bot. Gaz. 136:254–261. Reiser, L., P. Sa´nchez-Baracaldo, and S. Hake. 2000. Knots in the family tree: evolutionary relationships and functions of KNOX homeobox genes. Plant Mol. Biol. 42:151–166. Sambrook, E., F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Schultz-Schaeffer, J. and S. Gerhardt. 1987. Cytotaxonomic analysis of Euphorbia ssp. (‘‘Leafy Spurge’’) complex. Biol. Zentralbl. 106:429–438. Scofield, S. and J.A.H. Murray. 2006. KNOX gene function in plant stem cell niches. Plant Mol. Biol. 60:929–946. Swofford, D. L. 2000. PAUP: phylogenetic analysis using parsimony, version 4.0. Champaign, IL: Illinois Natural History Survey. Tsiantis, M., R. Schneeberger, J. F. Golz, M. Freeling, and J. A. Langdale. 1999. The maize rough sheath2 gene and leaf development programs in monocot and dicot plants. Science 284:154–156. Uchida, N., B. Townsley, K.-H. Chung, and N. Sinha. 2007. Regulation of SHOOT MERISTEMLESS genes via an upstream-conserved noncoding sequence coordinates leaf development. Proc. Nat. Acad. of Sci. 104:15953–15958. Xu, L., Y. Xu, A. Dong, Y. Sun, L. Pi, Y. Xu, and H. Huang. 2003. Novel as1 and as2 defects in leaf adaxial–abaxial polarity reveal the requirement for ASYMMETRIC LEAVES1 and 2 and ERECTA functions in specifying leaf adaxial identity. Development 130:4097–4107. Zhu, Y. Y., E. M. Machleder, A. Chenchik, R. Li, and P. D. Siebert. 2001. Reverse transcriptase template switching: a SMART approach for full-length cDNA library construction. Biotechniques 30:892–897. Zourelidou, M., M. Zabala, C. Smith, and M. W. Bevan. 2002. Storekeeper defines a new class of plant-specific DNA-binding proteins and is a putative regulator of patatin expression. Plant J. 30:489–497.

Received November 26, 2007, and approved March 31, 2008.

Varanasi et al.: Cloning and Characterization of EeSTM

N

495