Hepatitis C Virus Genotyping in HCV Positive Patients in Sulaimani Governorate
A Thesis Submitted to the Council of College of Science at the University of Sulaimani in Partial Fulfillment of the Requirements For the Degree of Master of Science in Biology (Microbiology)
By Barham Qasim Mahmood B.Sc. Biology (2010), University of Sulaimani
Supervised by Dr. Sahand Kamaludeen Arif Assistant Professor
March 2017
Newroz 2717
يم ِ بسمهللاال َّر ْح َم ِنال َّر ِح .س ْب َحانَكَ ََل ِع ْل َملَنَاإِ ََّل َما َعلَّ ْمتَنَاإِنَّكَأَنتَ ا ْل َعلِي ُما ْل َح ِكي ُم ُ قَالُوا ) 23سورةالبقرة (آيت
In the name of God, The most gracious and merciful They said, ―Glory be to You! We have no knowledge except what You have taught us. It is you who are the Knowledgeable, the Wise.‖ Quran, al-Baqarah 2:32
Supervisor’s certification I certify that the preparation of thesis titled "Hepatitis C Virus genotyping in HCV positive patients in Sulaimani Governorate" accomplished by (Barham Qasim Mahmood), was prepared under my supervision in the college of Science, at the University of Sulaimani, as partial fulfillment of the requirements for the degree of Master of Science in "Microbiology".
Signature: Name: Dr. Sahand K. Arif Title: Assistant Professor Date:
/
/ 2017
In view of the available recommendations, I forward this thesis for debate by the examining committee.
Signature: Name: Dr. Hoshyar Abdullah Azeez Head of Biology Department. Title: Date:
/
/ 2017
Linguistic Evaluation Certification
I hereby certify that this thesis titled "Hepatitis C Virus genotyping in HCV positive patients in Sulaimani Governorate" prepared by (Barham Qasim Mahmood), has been read and checked and after indicating all the grammatical and spelling mistakes; the thesis was given again to the candidate to make the adequate corrections. After the second reading, I found that the candidate corrected the indicated mistakes. Therefore, I certify that this thesis is free from mistakes.
Signature: Name: Arsto Nasir Ahmed Position: English Department, School of Languages, University of Sulaimani Date:
/
/ 2017
Examining Committee Certification We certify that we have read this thesis entitled "Hepatitis C Virus genotyping in HCV positive patients in Sulaimani Governorate" prepared by (Barham Qasim Mahmood), and as Examining Committee, examined the student in its content and in what is connected with it, and in our opinion it meets the basic requirements toward the degree of Master of Science in Biology "Microbiology".
Signature:
Signature:
Name: Bahrouz Mahmood Amin Jaff
Name: Ali Hattem Hussain
Title: Assistant Professor
Title: Assistant Professor
Date: /
Date: /
/ 2017
(Chairman)
/ 2017
(Member)
Signature:
Signature:
Name: Salih Ahmed Hama
Name: Sahand Kamaluldeen Arif
Title: Lecturer
Title: Assistant Professor
Date: /
Date:
/ 2017
(Member)
/
/ 2017
(Supervisor & Member)
Approved by the Dean of the college of Science.
Signature: Name: Dr. Bakhtiar Q. Aziz Title: Professor Date:
/
/ 2017
Dedication
This Thesis is dedicated to o My family, especially my mother and father. o My beloved wife and my dear daughter (Lanwe) o My supervisor and teachers. o Biology Department-University of Sulaimani. o My friends. o All who offered a helping hand.
Barham
Acknowledgments
Thank you my God, for your infinite grace and making everything possible for me by giving me strength to do this work, thank you for giving me the desire and facilitating the ways to carry out my study. I express my deepest gratitude and appreciation to my supervisor Dr. Sahand K. Arif for his endless patient, support, and encouragement throughout the thesis workings. A word of thanks would go to Dr. Ali Hattem Hussain (Shahid Hadi Consultant Clinic) who helped me a lot in carrying out my thesis. I express my sincere thanks to the administrator of college of Medicine who allowed me to work in their research center. I would like to express my special thanks to all of my best friends who helped me to finish this work.
Barham
Abstract To determine the frequency of the hepatitis C virus (HCV) genotypes among 72 previously Real Time - PCR based diagnosed patients in Sulaimani Governorate - Kurdistan region - Iraq, the all blood samples were confirmed as positive for HCV through reverse transcriptase nested polymerase chain reaction (RT-Nested PCR). For genotyping, the Restriction Fragment Length Polymorphism (RFLP) technique was done for 47 samples on a (174 bp) RTNested PCR amplified fragment within the 5´untranslated region (5´UTR) using four specific restriction enzymes (ScrFI, HinfI, BstNI, and BstUI). Out of the 47 samples, the genotypes were distributed as 34 (72.34%) for subtype 1a, 6 (12.77) for genotype 4, 4 (8.51) for genotype 3a, 1 (2.13%) for subtype 1b, 1 (2.13%) for subtype 2a, and 1 (2.13%) for genotype 5. According to comparison with other findings this data concluded that the pattern of the frequency of HCV genotypes in Sulaimani is similar to that of in Turkey, Iran, and most countries of Europe, and North America while it is different from the pattern included Africa and Arab countries.
I
CONTENTS Titles
Page
Abstract
…………………………………………………………… I
Contents
…………………………………………………………… II
List of Tables
……………………………………………………. VI
List of Figures
……………………………………………………. IX …………………………………………….. XI
List of Abbreviations
Chapter One: Introduction 1. Introduction
…………………………………………………… 1 Chapter Two: Literature Review
2. Literature Review
……………………………………………
2.1. Hepatitis C Virus
………………………………………….... 3
3
2.1.1. Description …………………………………………………... 3 2.1.2. Genomic organization
…………………………………….
3
2.1.3. Life cycle of HCV ………………………………………….... 5 2.2. HCV pathogenesis
………………………………………….... 8
2.3. Transmission …………………………………………………... 9 ……………………………...
11
2.5. Clinical significance of HCV genotypes ……………………....
15
2.4. HCV geographical distribution
2.5.1. Effect of HCV heterogeneity on the treatment ……………….. 15 2.6. Detection of HCV infection ……. ……………………………… 16 2.6.1. Methods for detecting Anti-HCV……………………………... 16 2.6.1.1 First ELISA generation for HCV detection …………………. 17 2.6.1.2. Second ELISA generation for HCV detection ……………… 17
II
2.6.1.3. Third ELISA generation for HCV detection ………………... 18 2.6.1.4. Supplemental tests for anti-HCV …………………………… 18 2.6.2. Methods for detecting HCV RNA……………………………... 19 2.6.3. Genotyping methods
…………………………………….
20
2.6.3.1. Direct sequencing…………………………………………… 20 2.6.3.2. RFLP
…………………………………………………... 21
2.6.3.3. Genotype specific primer
……………………………...
22
2.6.3.4. Hybridization of genotype specific probes ……………….
23
2.6.3.5. Genotype-specific antibodies ……………………………...
23
2.7. Treatment of HCV ……………………………………………
24
2.7.1. Interferon and Ribavirin ………............................................
24
2.7.2. Other new drugs
……………………………………………
24
Chapter Three: Materials and Methods 3.1. Materials
…………………………………………………... 26
3.1.1. Chemicals
……………………………………………
3.1.2. Apparatus
…………………………………………………... 27
26
3.1.3. Kits and contents ……………………………………………. 28 3.1.3.1. STRP™ Hepatitis C Virus Detection Kit …………………… 28 3.1.3.2. Restriction endonucleases …………………………………… 29 3.1.3.3. AccuPower® RocketScript RT-PCR PreMix ………………. 29 3.1.3.4. Viral Nucleic Acid Extraction Kit ΙΙ ………………………... 29 3.1.3.5. OneTwin 100 ……………………………………………..
29
3.2. Methodology …………………………………………………... 30 3.2.1. Specimen collection and storage ……………………………... 30 3.2.2. Detection of HCV ………………………………………...….. 30 III
3.2.2.1. RNA extraction ……………………………………………
30
3.2.2.2. Single tube cDNA Synthesis and first PCR Round PCR …… 31 3.2.2.3. Second round PCR …………………………………………. 31 3.2.3. HCV 5´UTR amplification by RT nested PCR ………………. 32 3.2.3.1. PCR primer design
…………….………………………. 32
3.2.3.2. Preparation of primers stock solution ……………….…..…. 33 3.2.3.3. Viral nucleic acid extraction ……………………...……..…. 33 3.2.3.4. RNA quality and quantity measurement …………………… 34 3.2.3.5. cDNA synthesis ……………………………………………. 34 3.2.3.6. First round …………………….............................................. 34 3.2.3.7. Second round ………………………………..……………... 35 3.2.3.8. Gel documentation for detection of nested PCR bands ..…..
36
3.2.4. Genotyping by RFLP technique ………..……………………
37
3.2.4.1. Gel documentation for detection of RFLP bands ..................
37
3.2.5. HCV 5´UTR sequencing ……………………………...……..
38
Chapter Four: Results 4. Results ………………………………………………………......
39
4.1 HCV detection …………………………………………………
39
4.2. Amplification of HCV 5´UTR …..…………………………....
44
4.3. Genotyping through RFLP method …………………………...
48
4.4. HCV 5´UTR Sequencing ……………………………...............
56
Chapter Five: Discussion 5. Discussion ………………………………………………………
57
Chapter Six: Conclusions and recommendations 6. Conclusions and recommendations ………………………………. 61 IV
Conclusions …………………………………………………………. 61 Recommendations …………………………………………………... 62 Appendix ……………………………………………………………. 63 References …………………………………………………………. 66
V
List of Tables Table No. 2.1
The Title
Page No.
Studies on HCV genotyping in Iraq including Kurdistan region ………………………....
14
3.1
Chemicals ………………………………………………...
26
3.2
Laboratory instruments …………………………………….
27
3.3
The Kits …………………………………………..………..
28
3.4
STRP™ Hepatitis C Virus Detection Kit contents and quantity……………………......
28
3.5
Restriction endonucleases and their sources ….…………..
29
3.6
Viral Nucleic Acid Extraction Kit ΙΙ contents …..…………
29
3.7
OneTwin 100 contents ……..……………………..............
29
3.8.
Nested PCR primers ………………………………………
32
3.9
First and second round PCR reaction components …….......
35
3.10. Nested PCR condition ……………………………………..
36
3.11. RFLP pattern of HCV genotypes adopted from Pohjanpelto, Lappalainen et al. ……………. 4.1
Percentage HCV genotypes among 47 HCV patients in Sulaimani Governorate . …………...……
4.2
38
48
Comparison between RFLP method and sequence analysis of HCV 5´UTR ………………….……..
VI
59
List of Figures Figure No.
The Title
Page No.
2.1
HCV genes and gene products ……………………………
4
2.2
Cellular entry of HCV particles …………………….…….
5
2.3
The infectious viral particle model of replication and assembly ……………………….………...
7
2.4
Natural history of HCV …………………………………..
9
2.5
World prevalence of HCV genotypes ……..……………...
12
2.6.
World HCV prevalence 2012 ……………………..……...
13
4.1a Gel electrophoresis of RT nested PCR amplicons for sample 1-20 ……………………….……....
40
4.1b Gel electrophoresis of RT nested PCR amplicons for sample 21-40 ……………………..……….
41
4.1c Gel electrophoresis of RT nested PCR amplicons for sample 41-60 ………………………………
42
4.1d Gel electrophoresis of RT nested PCR amplicons for sample 61-72 ………………………………
43
4.2a, 4.2b, 4.2c, 4.2d Gel electrophoresis results of
4.3
RT nested PCR for amplification 5´UTR ………….……...
44-47
HCV genotype distributions in Sulaimani Governorate …..
49
IX
4.4a, 4.4b, 4.4c, 4.4d, 4.4e, 4.4f, 4.4g Gel electrophoresis results of RFLP for HCV genotypes ………………………
X
49-55
List of Abbreviations Abbreviations
Meaning
µl
microliter
ALT
Alanine aminotransferase
bp
base pair
bDNA
branched DNA
C
Celsius
CD
Cluster of differentiation
cDNA
complementary deoxyribonucleic acid
CLDN
Claudin
DEPC
Diethylpyrocarbonate
DNA
deoxyribonucleic acid
dNTPs
Deoxynucleotide Triphosphates
DW
Distilled Water
E
Envelope
EDTA
Ethylenediaminetetraacetic acid
EIA
Enzyme immunoassay
ELISA
Enzyme-linked immunosorbent assay
ER
Endoplasmic reticulum
FDA
Food and Drug Administration
g
gram
GTP
Guanosine triphosphate
HAI
Hospital-acquired infection
HCC
Hepatocellular carcinoma
HCV
Hepatitis C Virus XI
IRES
Internal ribosomal entry site
IU
International unit
IVDU
Intravenous drug users
LDL
Low-density lipoproteins
ml
milliliter
NANBH
Non-A non-B hepatitis
NCBI
National Center for Biotechnology Information
NHANES
National Health and Nutrition Examination Survey
NS
Non-structural
NTPase
Nucleotide tri-phosphatase
ORF
Open reading frame
PCR
Polymerase chain reaction
PEG-INF
Pegylated interferons
pmole
picomole
qPCR
Quantitative polymerase chain reaction
RdRp
RNA-dependent RNA polymerase
RFLP
Restriction Fragment Length Polymorphism
RIBA
Recombinant ImmunoBlot Assay
RNA
Ribonucleic acid
RT-Nested PCR
Reverse-transcriptase nested polymerase chain reaction
SIA
Strip Immunoblot Assay
SVR
Sustained Virologic Response
TBE
Tris-borate-EDTA
UTR
Untranslated region
VLDL
Very-low-density lipoproteins XII
Chapter One Introduction
Chapter One
Introduction
1. Introduction
Hepatitis C virus (HCV) infection is an important public health problem, it causes liver disease and is the leading indication for liver transplantation worldwide. More than 180 million people have suffered from this virus and most of them are at risk of developing complications [1]. HCV is an enveloped virus of the Flaviviridae family having seven known genotypes and many subtypes [2]. The viral genome is a single-stranded, positive-sense ribonucleic acid (RNA) molecule with an approximately 9.6 kb containing a single open reading frame coding for all the structural and nonstructural proteins of the virus [3]. There are extensive genetic diversities reported for HCV genomes obtained worldwide, depending on this, HCV sequences obtained from clinical samples have grouped into different genotypes and subtypes [4]. Acute HCV infection is mostly asymptomatic and consists approximately 70% of all cases. About 80% of the infected patients will suffer from the chronic infection and are at high risk for the end stage of liver cirrhosis and hepatocellular carcinoma (HCC). HCC is known as a common cancer worldwide and accounts for about 5.6 % of all types of cancers. It ranks fifth cancer in the world, and the third common cancer caused deaths [5]. HCV shows a remarkably high degree of genetic heterogeneity. There are seven known genotypes (1-7). Different genotypes of HCV have 30-35% diversity at their nucleotide sequences. The genotypes are further divided into subtypes with <15% difference in their nucleotide sequence [6]. It is believed that genetic heterogeneity of HCV is contributing to the disease outcome and response to treatment, in HCV-infected patients. HCV genotype 1 is correlated with more severe clinical manifestations, higher levels of HCV viremia and less responsive to treatments than HCV genotypes 2 or 3. Patients with HCV genotype 1 and 4 may benefit from a prolonged course of therapy and genotypes 1
Chapter One
Introduction
2 and 3 are more amenable to react to a combination of interferon and Ribavirin therapy [7]. Therefore, clinical investigations of antiviral therapies require both HCV viral load and genotype information for a proper strategy of treatment. Genotyping of HCV provides clinically relevant information that can be used to determine the type and duration of antiviral therapy and to presume the possibility of sustained HCV clearance after treatment [8]. Accurate data of HCV genotype pattern and constant monitoring of the genetic variety of HCV isolates are essential for understanding the epidemiology, pathogenesis, and successful administration of the infected patients. The objectives of this study are to detect and genotyping of HCV among HCV patients in Sulaimani Governorate, irrespective of their risk factors, by using reverse transcriptase nested PCR (RT- nested PCR), typing by Restriction Fragment Length Polymorphism (RFLP), and DNA sequencing.
2
Chapter Two Literature Review
Chapter Two
Literature Review
2. Literature Review 2.1.
Hepatitis C Virus
2.1.1. Description HCV is one of the Hepatotropic viruses that causes major global health problem with an increasing rate of morbidity and mortality. Around 3% of world population, which is 180 million people, is estimated to be infected with this virus and a vaccine is not currently available [9]. The virus was initially described as non-A non-B hepatitis (NANBH)[10], later in 1989, through using molecular techniques the virus was designated as HCV [11]. Different genetic profiles of HCV made the virus that could be divided into seven genotypes (17). These genotypes have 30-35% difference at their nucleotide level. Global diversity of HCV genotypes developed by infidelity of RNA dependent RNA polymerase and the pressure exerted by the host immune system [2]. HCV can establish acute and chronic infection in liver, which leads to liver cirrhosis and even hepatocellular carcinoma (HCC) [12].
2.1.2. Genomic organization HCV belongs to the family Flaviviridae and genus Hepacivirus. It is an enveloped virus; its genome is about 9.6kb single stranded positive sense RNA with a single open reading frame (ORF) [3]. The genome composed of a polyprotein precursor, which flanked by highly conserved regions of 5´UTR and 3´UTR at both ends. In the 5´UTR terminus, there is an internal ribosomal entry site (IRES) which is essential for initiating polyprotein translation [13]. The polyprotein precursor consists of 10 different proteins, which are structural proteins of Core, envelope (E1, E2) and p7, also non-structural as well as called replication complex of six proteins: NS2, NS3, NS4A, NS4B, NS5A and NS5B. The structural and non-structural proteins are separated by peptide p7 (fig. 2.1) [14]. 3
Chapter Two
Literature Review
Figure (2.1): HCV genes and gene products [15]
The three of core, E1, and E2 are major constituents of the extracellular virion structure. Whereas non-structural proteins NS3 to NS5B are necessary for viral RNA replication. NS2 works as a protease for cleaving polyprotein at the NS2NS3 site, and the p7 protein forms cation selection ion channels. Both proteins are essential in assembly and release of the virion [16, 17]. The remaining proteins are cleaved by NS3 proteinase with the contribution of its cofactor NS4A. NS3 has RNA helicase and Nucleotide triphosphatase (NTPase) activities at the C-terminal region. The function of NS4B has not been known yet, which is an integral membrane protein. NS5 consists of two proteins NS5A which is a phosphorylated protein of unknown activity, and the main role of HCV RNA replication machinery is played by NS5B, which encodes the RNA-dependent RNA polymerase (RdRp) [15].
4
Chapter Two
Literature Review
2.1.3. Life cycle of HCV HCV is transmitted largely through blood and reaches the liver via the bloodstream. The virus circulates as the so-called lipoviroparticles associated with components of low-density lipoproteins (LDL) and very-low-density lipoproteins (VLDL) [18]. The viral envelope glycoproteins are localized on the surface, whereas the nucleocapsid is located within the hydrophobic interior of the lipoviroparticle. The nucleocapsid is made of core proteins associating with the viral RNA genome. Once the viral particle arrives the hepatocyte surface, it interacts first with the glycosaminoglycans and syndecans, followed by binding to more specific receptors, including the scavenger receptor B1 and the tetraspanin protein CD81[19, 20]. The viral particle complexed with these entry factors reaches tight junctions and engages in further interactions with claudin-1 (CLDN1) and occludin [21, 22]. The viral particle consequently enters the cell through receptor and clathrin-mediated endocytosis (fig. 2.2) [23].
Figure (2.2): Cellular entry of HCV particles [24]
After its release into the cytosol, the clathrin-coated vesicle interacts with the motor protein dynein. Dynein carries the vesicle by moving along microtubules toward the endoplasmic reticulum area. Acidification of the endosome lumen 5
Chapter Two
Literature Review
causes conformational changes of the viral envelope glycoproteins [25, 26], which in turn cooperate with the endosomal membrane, leading to fusion of viral and endosomal membranes. Membrane fusion is followed by uncoating of the nucleocapsid and the releases of the viral RNA genome into the cytosol [27, 28]. Binding and assembly of ribosome subunits on the viral RNA is the starting point of HCV polyprotein translation. A signal sequence located in the beginning of the translated polyprotein enables the ribosome to be targeted to the translocon on the endoplasmic reticulum membrane. Translation can thereby proceed further, giving rise to a polyprotein which cleaved by cellular signal peptidase and by the viral proteases into 10 mature proteins [29]. The structural proteins which make the viral particle include core and the envelope glycoproteins E1 and E2. NS2 and p7 support viral particle generation while not being incorporated into the particle. The replicase components NS3-4A, NS4B, NS5A, and NS5B are adequate to support viral RNA replication. HCV replicase proteins in concert with host factors induce rearrangements of the ER membrane, including the formation of double-membrane vesicles. These vesicles cluster to form the membranous web, which represents the site of HCV RNA replication (fig. 2.3) [30, 31]. Viral RNA synthesis is catalyzed by the RNA-dependent RNA polymerase activity of NS5B, which acts in concert with other viral non-structural proteins, as well as several host factors. After synthesis of a negative-strand RNA intermediate, multiple positive-strand progeny RNAs are generated from this template and each used for translation and replication or packaged into nucleocapsid particles [32].
6
Chapter Two
Literature Review
Figure (2.3): The infectious viral particle model of replication and assembly [24].
The later process is thought to be initiated on the surface of lipid droplets that are targeted by the core protein. It is believed that a network of NS5A transfers the viral RNA to core proteins for assembly into nucleocapsids [33]. Nucleocapsids form at the ER derived membranes, where E1 and E2 accumulate in conjunction with p7, NS2 and host factors, including apolipoprotein E [34, 35]. the viral envelope glycoproteins are obtained by budding, a process which seems to be linked to the VLDL machinery [36]. Newly synthesized virus particles are presumed to be transported to the cell surface in export vesicles through the cellular secretory pathway. Finally, they are released from the cell by exocytosis to enter the blood stream [37, 38].
7
Chapter Two
Literature Review
2.2. HCV pathogenesis The remaining of HCV RNA in the blood for at least six months after acute infection indicates chronic hepatitis C infection. Most of the HCV infections (80%) establish chronic infection and only 20% can resolve and see clearance after the occurrence of HCV RNA in blood. Of the 80%, 10-20% progress to cirrhosis (fig. 2.4). The majority of acutely infected persons 70-80% are asymptomatic, which cause infrequent diagnosis, and only 20-30% of the HCV infections develop clinical symptoms [12, 39]. Symptomatic onset varies between 3 to 12 weeks after exposure. Malaise, weakness, anorexia, and jaundice are the symptoms of the disease onset. Serum alanine aminotransferase (ALT) may rise more than ten times higher than the normal level, begin rising 2 to 8 weeks after the exposure, which causes the destruction of hepatocytes [40]. Seven to fourteen days after exposure, the HCV RNA can be detected in blood [41]. The level of HCV RNA increases immediately through the initial few weeks and then reaches between 105 to 107 IU/ml, soon before the serum aminotransferase level reaches its peak and the onset of symptoms. Acute infection of HCV can be cruel, but fulminant liver failure is uncommon [42]. Nearly after the appearance of the symptoms, HCV antibody can be detected, approximately 1 to 3 months after exposure. Up to 30% of patients will test negative for anti-HCV at the onset of their symptoms, causing anti-HCV testing inaccurate in the diagnosis of acute infection. Roughly all patients finally acquire the antibody to HCV; nonetheless, titer can be low or non-detectable in immunodeficient patients. After the first three months of HCV exposure, the anti-HCV tests can detect greater than 90% of the cases [41]. How HCV causes liver damage, acute and chronic, is unexplained, but it is assumed that immune response by the infected cell is included in the process. The risk of developing cirrhosis depends on some factors such as alcohol abuse and age at the time of infection [39]. Although the development of cirrhosis is 8
Chapter Two
Literature Review
the foremost determinant of morbidity and mortality [43], one of the most dangerous outcomes of a chronic HCV infection is the progression of hepatocellular carcinoma (HCC) in 1-5% of the cases within 20-30 years. The risk of developing HCC rises with age, span of infection and cirrhosis [39].
~20%
Acute infection
Spontaneous clearance
~80% ~10-20%
Chronic infection
Cirrhosis
~1-5% Liver cancer
Death (if no liver-transplantation) Figure (2.4): Natural history of HCV [44]
Some factors affect the rate of chronicity of the infection such as the age at the time of infection, gender, ethnicity, and development of jaundice during the acute infection. It appears that age can affect the chronicity of HCV infection. According to a study conducted by the third National Health and Nutrition Examination Survey (NHANES), it is estimated that the chronicity rate is at 30% for those who are below the age of 20 years, and 76% for those who are older than 20 years [45].
2.3. Transmission There are various ways of HCV transmission. First and foremost is due to the blood transfusion from an infected patient to a healthy one. Recently due to screening tests the risk has been reduced especially in the developed countries. 9
Chapter Two
Literature Review
Parenteral exposure to blood via inappropriate sterilized needle and medical sharing procedures are a common route of transmission. The primary route of transmission differs according to different countries. In the developed countries, most cases might be caused by drug users among intravenous drug users (IVDU), and also blood transfusion. In the undeveloped countries, mostly HCV infection is related to traditional or folk medical procedures. As mentioned above, blood transfusion is primarily a factor for transmitting the virus. According to some studies HCV infection has occurred in 80% of recipients of blood from HCV-infected blood donors [46, 47]. In this case, the screening tests are crucial to avoid the transmission. Contaminated needles and other medical tools are other important routes of HCV transmission, which is a serious factor for health care staff. Two to eight percent of needle exposure can cause HCV transmission [48, 49]. The rate of transmission through contaminated needles depends on the quantity of the transferred blood, the virus titer and depth of inoculation. In the developed countries, illegal drug users, especially needle injection is the widest rate of transmission. For the new HCV infections in the United States since 1992, at least, two-thirds of the cases have been due to drug users. It is estimated that 50-95% of the world drug user population are the carrier for HCV (11). Hospital-acquired infection (HAI), also known as Nosocomial infection, can be acquired by a patient during a hospital visit or one developing among hospital staff. Although the precise route of transmission remained unclear, patient-topatient transmission of HCV could be demonstrated. According to a reported case study, HCV infection occurred through using contaminated multidose saline vial [50]. In another study, an epidemiologic outbreak of HCV infection has been reported, in which probably contaminated multidose vial of heparin
10
Chapter Two
Literature Review
solution had been used as a source of infection. Identification was done through classical and epidemiological investigations [51]. Organ transplantation from HCV-infected patient usually transmits the disease to the recipient [52, 53], although there are controversies about the risk factors of other organ transplantation from HCV-infected person. According to some studies that show there is 4-7% risk of transmitting HCV from mother to infant [54]. HCV infection through sexual contact may occur but is less frequent. The transmission rate is higher in those with multiple sexual partners. The rate is about 5% [55]. HCV sexual transmission from male to female might be more efficient than from female to male [56].
2.4. HCV geographical distribution The worldwide distribution of HCV genotypes comprises of at least seven major genotypes, and multiple subtypes. The existence of significant geographical variations of HCV genotypes can be seen [2]. Although HCV genotypes 1, 2, and 3 seem to have a global distribution, their relative prevalence differs from one region to another (fig. 2.5). In the United States, HCV subtypes 1a and 1b are the most common genotypes [57]. They are also prevalent in Europe [58-60]. Subtype 1b is the most common type in Japan [61]. Subtype 2c is located commonly in northern Italy, while HCV subtypes 2a and 2b are relatively common in North America, Europe, and Japan. HCV genotype 3a is particularly common in (IVDU) in the United States and Europe [62]. HCV genotype 4 seems to be widespread in North Africa and the Middle East [63, 64], and genotypes 5 and 6 appear to be limited to South Africa and Hong Kong, respectively. HCV genotype 7 has been reported in immigrants to Canada from Central Africa.
11
Chapter Two
Literature Review
There are around 21.3 million HCV carriers in the Middle East and Eastern Mediterranean countries which accounts for one-fifth of the world's HCV carrier [65]. In Iraq HCV prevalence is around 3.4% [66, 67], which is relatively higher than the neighboring countries such as Syria, Turkey, Iran, Kuwait and Saudi Arabia which are 1%, 1-2.1%, 0.5%, 0.8% and 1.5% respectively [68-70] (fig. 2.6). Notably, differences in sample size and the introduction of blood donor screening with restricted policy in other countries may result in a lower prevalence. Two important reasons can be suggested as an explanation for such a high rate reported in Iraq. First, screening of blood for HCV in blood banks in Iraq started in 1996 and secondly, shortage of blood and other supplies in the health services as a result of the international sanctions against Iraq in the 1990s resulted in lower standards of cleaning and sterilization of medical instruments and a shortage of disposable syringes and needles [71].
Figure (2.5): World prevalence of HCV genotypes [2].
Various population groups have been studied for determining HCV genotype prevalence in Iraq including Kurdistan region. The prevalence of each genotype is summarized in Table (2.1). The studied populations were patient with thalassemia, chronic liver disease, liver cirrhosis, chronic renal failure, 12
Chapter Two
Literature Review
transplant patients, asymptomatic peoples, patients referred to the center and hospitals in which the studies had been done and also blood donors [72, 73].
Figure (2.6): World HCV prevalence 2012 [74].
In 5 of these studies in Iraq [71-73, 75, 76] genotype 4 was reported as the most prevalent genotype, ranging from 35.40% - 89% among the various groups, which is the genotype recorded for the middle east, Saudi Arabia, Egypt and some African countries [77-79]. In another study that had been done in Kurdistan region of Iraq, a different genotype presumed as the most prevalent genotype which is genotype 1, which accounts for 87.5% of the HCV carriers [80], which is the same genotype for Turkey [81], in which 91% of the studied patients were affected with genotype 1b and it is the same for Jordan [82]. Almost all studies were carried out in the central and the southern Iraq, suggest that genotype 4 is the most prevalent genotype. Although the most prevalent HCV genotype in Northern Iraq (Kurdistan) appears to be genotype 1, but yet 13
Chapter Two
Literature Review
needs to be ascertained. In the most of the studies on HCV infections, the rate is the same for both sexes [83, 84]. Conversely, according to some studies the rate of infection appears to be lower in women, especially younger women [85, 86].
Table (2.1): Studies on HCV genotyping in Iraq including Kurdistan region. Khalid and Abdullah 2012 [73] Genotype specific primers
Abbas, Aubaid et al. 2013 [75] Genotype specific primers
Al-mola, Tarish et al. 2013 [76] Genotype specific primers
Al Kubaisy, Al Naib et al. 2006 [71]
Kareem and Salih 2014 [80]
Type specific antibody
Direct sequencing
210
51
103
78
22
29
17
7
7
13
19
10
(8%)
(13.73%)
(6.79%)
(27.10%)
(86.36%)
(34.48%)
0
0
0
2 %
0
0
3 %
0
0
187
44
(89%) 0
Author
Method Samples No. 1a %
11
1b
Genotypes
%
4 %
(22.90%)
3 (2.91%)
Abdullah, Hardan et al. 2012 [72] Genotype specific primers
4 0
(13.79%)
2 0
(9.10%)
3
0 1
0
0
89
17
1
12
(86.27%)
(86.4%)
(35.40%)
(4.54%)
(41.38%)
0
0
0
0
0
0
0
0
(2.91%)
(3.45%)
5 %
2
6 % Mixed genotypes
0 6 (3%)
0 0
(1.94%) 1 (0.97%)
7 (14.60%)
2 0
(6.90%)
Najaf, Babylon, City
Mosul
Thi-Qar
Qadisyia, Karbala and Baghdad governorates.
14
Baghdad
Sulaimani
Baghdad
Chapter Two
Literature Review
2.5. Clinical significance of HCV genotypes Different genotypes of HCV are known to have correlations with both clinical and treatment issues of HCV virus. Many studies deal with and try to find out the details of these relations [87]. Many aspects in HCV have been related to heterogeneity of this virus and are focused on them in studies. These include epidemiology, sensitivity and specificity of HCV assays, and progression of liver disease. Epidemiology based on HCV genotypes is the most clearly known. The link between genotype and infection consequences and liver disorders are intensively studied [87, 88]. There are some controversial discussions about more efficiency of genotype 1b than non-1b genotypes in the development of chronic hepatitis to liver cirrhosis. It was approved that 1b genotype was among the most common genotypes and was more likely to progress hepatitis to liver cirrhosis [89]. Despite this, other studies showed nearly equal proportion for both genotypes 1b and 1a in progression of hepatitis [90, 91]. With respect to the epidemiology, it was known that predominant subtype of HCV is 2b genotype in some European countries. Furthermore, HCV heterogeneity may associate with the mode of transmission. Several data suggested that HCV genotypes are critical factors in mother to infant transmissions. On the other hand, it was reported that genotype 3a is strongly associated with (IVDU) and genotype 1b was more common in patients who are affected via blood transfusion [88, 92].
2.5.1. Effect of HCV heterogeneity on the treatment HCV heterogeneity also affects degree of responses to antiviral drugs. Studies showed that genotype 1b and 1a have had poor responses to interferon treatment than genotype 2 and 3 [57]. Based on a wide range of studies, there are some 15
Chapter Two
Literature Review
specializations of drugs and combinations of drugs against specific genotypes. Among recent antiviral drugs, combinations of Ledipasvir/ sofosbuvir has mostly been proposed for the treatment of genotype 1a and 1b, while combination of Sofosbuvir/Ribavirin is among the most common suggested drugs for HCV genotypes (2, 3, and 4) [93]. HCV genotype-based target of treatment may possess genetic basis since it was found that there are regions in HCV genotype 1b genome which are sensitive or responsible for sensitivity against Interferons [94].
2.6. Detection of HCV infection The assays for determining HCV infections can be distributed into two major types: serological tests for detecting antibody to HCV (anti-HCV); and also through using molecular assays for identifying, and/or characterize HCV RNA genomes within an infected patient [95].
2.6.1 Methods for detecting Anti-HCV Ab Detection of anti-HCV Ab is the primary step to screen in persons whom HCV infection is suspected. Currently available tests are very sensitive and specific. The available EIAs for anti-HCV detection have specificity and sensitivity greater than 99% in patients who suffer from HCV infections [96]. The occurrence of antibodies to HCV is an indication of past or present HCV infection. In patients with acute HCV infection, it is necessary to remember that antibodies may not be detectable 3–8 weeks following initial HCV infection [97]. Enzyme-linked immunosorbent assay (ELISA) is the most commonly used test for Anti-HCV.
This method has several advantages such as highly
reproducible results, low cost, and automation in technique. There are three generations of ELISA for Anti-HCV Ab. 16
Chapter Two
Literature Review
2.6.1.1. First ELISA generation for HCV detection The first enzyme immunoassay (EIA-1), initially used clinically in 1990, contained a single recombinant antigen from the NS4 region of the HCV genome [98]. But serious limitations were numerous false-positive reactions, particularly among groups such as blood donors, where the prevalence of hepatitis C is low. In addition, there were occasional nonspecific false-positive reactions in patients with various autoimmune disorders. Furthermore, the test was insensitive [99]. Finally, there was a considerable delay between acute HCV infection and the first evidence of anti-HCV Abs.
2.6.1.2. Second ELISA generation for HCV detection This assay, the clinical standard since 1992, contains antigens from the core and nonstructural three (NS3) and four (NS4) regions of the HCV genome. This test is both more sensitive and specific than the first-generation EIA assay[100]. Use of the second-generation assay further reduced the risk of post-transfusion hepatitis C and false-positive reactions among blood donors. Furthermore, it has proved to be quite effective as a screening test in high-risk individuals for chronic hepatitis C. Approximately 92-95% of patients in whom chronic hepatitis C is suspected can be detected using this second-generation EIA. Finally, the use of this test shortens the window from blood transfusion to the first detection of anti-HCV to approximately ten weeks compared with an average of 16 weeks with the first-generation EIA [95]. False-positive reactions with the EIA-2 assay are primarily limited to low-risk populations such as blood donors. False-negative tests are seen most commonly in immunosuppressed individuals such as transplant recipients and patients co-infected with HIV [101]. EIA-2 continues to be the test routinely used by most clinical laboratories.
17
Chapter Two
Literature Review
2.6.1.3. Third ELISA generation for HCV detection The third generation EIA (EIA-3) has been approved for screening blood donors. This assay contains reconfigured core and NS3 antigens and an additional antigen from the NS5 region of the HCV genome. This test provides a slight improvement in sensitivity over the EIA-2 test, particularly in low-risk settings such as a blood bank [102]. The time from infection to anti-HCV seroconversion is shortened to around 5 weeks [103]. It was found that the specificity of this generation of ELISA is 99.5% for the blood donor samples and is 99.4% for routine clinical specimens [104].
2.6.1.4. Supplemental tests for anti-HCV Ab Because of the high-frequency false-positive rate of EIA assays, particularly in low prevalence settings such as blood banks, supplemental tests for anti-HCV were developed. Recombinant ImmunoBlot Assay (RIBA) is a confirmatory test that detects anti-HCV. It is used for confirmation after a screening test for HCV was positive. These tests contain the same antigens as the corresponding EIA assay [105]. However, in the commonly used recombinant immunoblot assays (RIBA) individual HCV antigens are displayed on a nitrocellulose strip. As a result, antibodies against specific HCV antigens can be identified. A positive RIBA assay needs, at least, two reactive bands. Tests with only one reactive band are regarded indeterminate. RIBA tests are no more sensitive than corresponding EIA tests. However, RIBA tests can be used to distinguish falsepositive EIA results from prior exposure to HCV. Patients with false-positive EIA tests usually have negative RIBA assays. In contrast, patients previously exposed to hepatitis C typically have positive or indeterminate RIBA result [106].
18
Chapter Two
Literature Review
2.6.2. Methods for detecting HCV RNA In the diagnosis of acute and chronic HCV infection, qualitative and quantitative HCV molecular assays are utilized. The HCV RNA can be detected in serum or plasma around one week after exposure. Therefore, it is considered as a gold standard to diagnose the current HCV infection [107]. The basis of qualitative HCV assays comprises isolation of viral nucleic acid, complementary DNA synthesis, PCR amplification and detection of PCR product. Through the qualitative assays, the available HCV RNA can be detected. Because HCV is an RNA virus, reverse transcription PCR is used to identify viral RNA. HCV genomic RNA composes of several regions, of them 5´untranslated region (5´UTR) is critical in the virus detection because most of the commercial amplification procedures are targeted against this region as there is greater than 90% sequence uniqueness between various HCV genotypes [108, 109]. Other regions in HCV genome such as the core and the 3´ UTR are also used for PCR-based detection, beside 5´UTR. Although there are some other regions such as E1, E2, NS2, which are used for the detection of the virus RNA through PCR amplification but they are not in much use [110, 111]. Viral RNA detection is helpful in diagnosing HCV infection during the window period, differentiating active from resolved infection, and diagnosing chronic hepatitis patients who show negative antibody for HCV. There are some cases that nucleic acid testing for HCV is recommended: (1) for confirmation of the HCV RNA availability after the HCV antibody detection; (2) to ensure the presence of HCV RNA in seronegative but immunocompromised patients such as HIV-carrier; (3) for the babies of HCV-infected mothers as they may show false positive results until 18 months of age; and for determining the baseline state before beginning the anti-viral therapy [112]. HCV quantitative assay determines the load of the viral RNA per millileter of serum or plasma in known HCV positive patients. Lately, real time PCR19
Chapter Two
Literature Review
depended detection methods have become broadly accessible and are regarded as the detection method of choice by numerous clinicians. The broad dynamic scale and very low limit of detection, are the advantages of this technique. Three types of tests to quantify HCV RNA can be found: quantitative RT–PCR, realtime PCR, and branched DNA (bDNA) [113]. The difference between bDNA method and reverse transcription–PCR tests, is in bDNA a detection signal is amplified rather than target RNA. Significant progress in molecular diagnostics has been done by quantifying HCV RNA through using real-time PCR methods. TaqMan technology is a technique used in real-time PCR yields quantitative results with comparable sensitivity to qualitative tests. Also, real-time PCR is able to precisely measure the viral load (10 IU/mL to 100 million IU/mL) for purposes of therapeutic monitoring [114]. Therefore, both qualitative and quantitative assays can be performed with a single test.
2.6.3. Genotyping methods Because of the potential clinical effects of different genotypes of HCV, there is a need for reliable methods for the classification and characterization of the viral genome of the primary patient isolates.
2.6.3.1. Direct sequencing The gold standard and the most reliable method for determining HCV genotypes include the direct sequencing of a distinct (PCR)-amplified product of a particular portion of the viral genome obtained from a patient sample, followed by phylogenetic analysis. In this method, some of the virus regions that have been used include: NS5, core, E1 and 5′ UTR [88]. Comprehensive knowledge can be obtained through using sequencing method of the amplified desired fragment, which includes detection of polymorphisms inside the viral genome that can have clinical importance. In addition, multiple regions sequencing, in combinations with the formation of phylogenetic trees, can offer an accurate 20
Chapter Two
Literature Review
classification of the isolates [4, 115]. Although this method is the reference standard and the most definite for genotyping, it has limitation such as the inability of differentiating mixed genotypes within a given sample [116].
2.6.3.2. RFLP This method uses restriction endonucleases for genotyping based on recognition of genotype-specific cleavage position of an amplified desired DNA fragment, which leads to the determination of HCV genotypes [117]. As a result of alterations in the nucleotide sequence in or between the recognition positions of restriction enzyme, fragment sizes can change. Destructions, alters, or creation restriction enzyme sites, changing the number of fragments can be the consequences of Nucleotide changes. Construction of a restriction map of the desired DNA fragment is the initial step in RFLP method. Once the restriction map is known, the number and sizes of cut fragments of a tested DNA are matched with the number and sizes of fragments expected based on a restriction map. The difference between the patterns of the generated restriction map and the reference restriction map can reveal polymorphisms [118]. Using this assay for HCV genotyping can characterize both genotypes and subtypes. Researchers have used restriction enzymes to determine viral genotype. In an investigation 100% concordance was shown between sequence analysis, genotyping by RFLP in the 5´UTR, and serotyping with peptides derived from the NS4. In addition, it was mentioned that the serotyping was not able to discriminate between the HCV subtypes, which makes HCV serotyping less useful than RFLP [119]. Also, Daniel, David et al. (2016) showed that PCRRFLP and HCV core type-specific PCR-based assays can correctly determine HCV genotypes except for genotype 6 [120]. Investigators have used different regions of the HCV genome for restriction fragment length polymorphism, including NS5 and the 5´UTR and also they have used several restriction 21
Chapter Two
Literature Review
enzymes. Thiers, Jaffredo et al. (1997) [121] had used a combination of BstNl, BstUl and Sau3a restriction endonucleases s to discriminate between three major HCV genotypes (1, 2, and 3). AvaI, SmaI, RsaI, HaeIII, HinfI, MvaI, and ScrfI were used by Verachai, Phutiprawan et al. (2002) [122] to digest 5´UTR of HCV. Casanova, Boeira et al. (2014) have used different sets of restriction enzymes (Hae III, HinfI and BstN I, Rsa I, BfuC I and BstU I, and Rsa I) for the genotyping of HCV and they concluded concordance between RFLP and direct sequencing for all HCV-RNA positive samples in their research [123]. In other investigations, two sets of restriction enzymes were used for fragmentation of HCV 5´UTR, which were RsaI + HaeIII and HinfI +MvaI [124, 125]. Some researchers preferred using two different RFLP methods for correctly genotyping HCV. The first method is by using Acc I, Mbo I and BstN I for digesting core region of HCV. The second RFLP analysis is digestion of HCV 5´UTR with Ava I and Sma I restriction enzymes [126]. Some other investigators used different restriction endonucleases s (ScrFI, Hinf I, MvaI, and BstUI) that can differentiate between HCV genotype 1a, 1b, 2a, 2b, 3a, 3b, 4, 5, and 6. They observed compatible results between RFLP method with these enzymes and direct sequencing of HCV 5´UTR [127-129].
2.6.3.3. Genotype specific primer Okamoto and his colleagues were first introduced type-specific primer for HCV genotyping, and the primers had been designed for the core region, the method enabled differentiation of the common genotypes (1a, 1b, 1c, 2a, 2b) at that time. Later an addition has been made for genotype 3a [130]. Still the method had been questioned that genotype 1a and 1b could not be clearly discernible [131-133]. Nevertheless, improvement has been made to increase the sensitivity and specificity of the method, by changing the sense and antisense primer from the core region to another set of sense and antisense primer [130]. Furthermore, the method had been developed as reported by [134], in which 22
Chapter Two
Literature Review
modified primers designed for specific variants such as 2c and 4 had been added.
2.6.3.4. Hybridization of genotype-specific probes For HCV genotyping, some DNA hybridization assays have been reported. The assay depends on hybridization of 5´UTR amplification amplicons with genotype-specific probes immobilized on nitrocellulose strips or a 96-well microplate and are visualized using colorimetric chemistry. The presence of known mutations or genotype can be determined by the banding pattern [135]. Though the primary version had poor sensitivity, the newer version is capable of distinguishing between HCV subtypes 1a, 1b, 2a to 2c, 3a to 3c, 4a to 4h, 5a, and 6a [136]. It has been mentioned that genotyping methods using 5´UTR, in 5 to 10% of cases may not discriminate genotype 1a from 1b. Furthermore, may not differentiate between subtypes 2a and 2c [137].
2.6.3.5. Genotype-specific antibodies Researchers have invented Genotype-specific antibodies methods for HCV genotyping [138-141]. This approach has some advantages which lead it to be used for large-scale investigation such as epidemiologic studies. Low risk of contamination and the simplicity of the assay are the advantages of serologic genotyping (serotyping). Nonetheless, serologic typing appears to lack specificity and sensitivity that limits its application. The old version of the assay comprised of five mixed serotype-specific peptide sequences obtained from the NS4 region and two serotype-specific peptide sequences obtained from the core region for genotypes 1, 2, and 3 [142]. The later genotyping assay is based on the detection of genotype-specific antibodies against epitopes encoded by the NS4 region of the HCV genomes for genotypes 1 through 6 [143]. In a study conducted by Beld and his colleagues it was reported that there was a high reliability of HCV serotyping by RIBA SIA in immunocompetent 23
Chapter Two
Literature Review
patients infected with genotype 1a [144]. Although the assay had low sensitivity for those specimens containing genotype 3a or co-infected with HIV. Accordingly, the performance of this assay may be restricted to a geographical area where genotype 1a is not prevalent. Likewise, Songsivilai et al. confirmed that serotyping had low sensitivity for samples from patients infected with HCV genotype 6 [145]. In contrast, a study in the United States mentioned that there is high concordance among molecular and serologic genotyping assays of HCV [143]. These findings suggest the difference in the reliability of these assays depends on the distribution of HCV genotypes in a particular geographic area.
2.7. Treatment of HCV 2.7.1. Interferon and Ribavirin The majority of HCV treatment approach relies on medications. The most used and studied therapeutic drugs are Interferon and Ribavirin. The use of Interferon preceded Ribavirin by several years and has been used solely for treatment though only a few number of patients recovered until the combination of Interferon/ribavirin proposed and proved [93]. This combination increased the virus clearance from less than 10% by interferon mono-therapy to more than 70% using combined Interferon/Ribavirin [146, 147].
2.7.2. Recent new drugs Boceprevir and Telaprevir are the first generation of NS3/4A protease inhibitor and inhibit viral replication host cells, approved by Health Canada in 2011 and targeted against HCV genotype1 [148]. The level of sustained virologic response (SVR) can be increased by the addition of these drugs to PEG- INF and ribavirin to about 70% in HCV treatment [149]. Semiprevir is highly effective and a safe second generation NS3/A4 protease inhibitor used to treat HCV genotype 1 infection and combined with PEG-INFs and ribavirins. This was approved after first generation of protease inhibitors [150]. Ledipasvir 24
Chapter Two
Literature Review
is a potent antiviral agent against HCV genotype 1a 1b, 4a and 5b and is less active against 2a and 3a. This drug is NS5A protein inhibitor which is required for viral replication, thus causes faulty viral assembly. Lediposvir has been used in combination with other antiviral drugs [151]. Sofosbuvir was approved recently as a new HCV drug by Food and Drug Administration (FDA) for the treatment of chronic HCV infection using in combination with other types of antiviral drugs. Sofosbuvir is a nucleotide analogue, polymerase inhibiter deprives the replication of HCV via inhibition of NS5A polymerase which is an RNA dependent RNA polymerase and required by HCV. Hydrolysis is one way of metabolism of this drug when administered orally and reaches highest concentration after 0.5-2 hours. The excretion is via kidney and distributed mostly (about 60-65%) to human bound plasma proteins [152]. Resistance against this drug is very rare [153] and high level of SVR is reported which is about 90% when combined to other antiviral drugs [154].
25
Chapter Three Materials and Methods
Chapter Three
Materials and methods
3. Materials and Methods 3.1 Materials The following chemicals and instruments are used in this study. 3.1.1. Chemicals Table (3.1): Chemicals Chemical agent
No.
Company
1
Agarose
Bio Basic (Canada)
2
DNA Ladder (100-1500)bp
GeNetbio (Korea)
3
Dye (loading dye)
GeNetbio (Korea)
4
Dye (loading dye)
Genedirex (Taiwan)
5
Absolute Ethyl Alcohol
Scharlau (Spain)
6
Ethidium bromide
Geneaid (USA)
7
Isopropanol
Prolabo (France)
8
Prime Taq Premix
9
OnePCR (PCR master mix)
10
Primers
11
Chloroform
Prolabo (France)
12
Tris Borate EDTA
GeNetbio (Korea)
GeNetBio (Korea) Genedirex (Taiwan) Macrogen (Korea)
26
Chapter Three
Materials and methods
3.1.2. Apparatus Table (3.2): Laboratory instruments No.
Instrument
Company
Country
1
Oven
Lab Tech
England
2
Sensitive balance
AND
USA
3
Autoclave
Bluestone
China
4
Centrifuge
Quantum Scientific
India
5
Cold centrifuge
Quantum Scientific
India
6
Gel apparatus
Bio-rad
USA
7
Vortex
Lab Tech
England
8
Microwave
JEC
China
9
Refrigerator
Concord
Lebanon
10
Deep Freezer
GFL
German
11
Nanodrop
Janeway
England
12
Water bath
Mememrt
German
13
Thermocycler
Biocompare
USA
14
Ice maker
Lab Tech
England
15
Ultraviolet transilluminator
Lab Tech
England
16
Water distillation
T and M
Japan
27
Chapter Three
Materials and methods
3.1.3. Kits and contents Table (3.3): The Kits No. Kit
Company
Country
1
STRP™ Hepatitis C Virus Detection Kit
Sinaclon
Iran
2
Restriction enzymes (ScrFI, BstNI, and BstUI).
NEB
England
3
Restriction enzyme (HinfI)
Promega
USA
4
AccuPower® RocketScript RT-PCR PreMix
Bioneer
Korea
5
Viral Nucleic Acid Extraction Kit ΙΙ
Geneaid
Taiwan
6
OneTwin 100
GeneDirex
Taiwan
3.1.3.1. STRP™ Hepatitis C Virus Detection Kit Table (3.4) STRP™ Hepatitis C Virus Detection Kit contents and quantity No. Component
Quantity
1
RNX™-Plus
25ml
2
Mix I
1.75ml
3
Mix II
1.1ml
4
DEPC-Water
2×1ml
5
Reverse Transcriptase Enzyme (RT Enzyme)
50μl
6
Taq DNA Polymerase
25μl
7
DNA Positive control
100μl
8
Mineral oil
3ml
28
Chapter Three
Materials and methods
3.1.3.2. Restriction endonucleases Table (3.5) Restriction endonucleases and their sources No. Restriction enzyme
Microorganism source
1
HinfI
2
ScrFI
Haemophilus influenzae Rf Streptococcus cremoris F
3
BstNI
Bacillus stearothermophilus N
4
BstUI
Bacillus stearothermophilus U458
3.1.3.3. AccuPower® RocketScript RT-PCR PreMix The kit contained 0.2ml thin-wall 8-stip tubes with attached cap, 20 µl, 96 tubes.
3.1.3.4. Viral Nucleic Acid Extraction Kit ΙΙ Table (3.6) Viral Nucleic Acid Extraction Kit ΙΙ contents No. Component
Quantity
1
VB Lysis Buffer
30 ml
2
AD Buffer
4 ml
3
W1 Buffer
30 ml
4
Wash Buffer
12.5 ml
5
RNase-free Water
6 ml
6
VB Columns
50
7
2 ml Collection Tubes
100
3.1.3.5. OneTwin 100 Table (3.7) OneTwin 100 contents No. Component
Quantity
1
OnePCRTM
1.25ml
2
OneMark 100
600ul
29
Chapter Three
3.2
Materials and methods
Methodology
3.2.1. Specimen collection and storage In the present study, the blood samples were collected from 72 previously diagnosed HCV positive patients by real time PCR in Shahid Hadi Consultant Clinic and Thalassemia Center in Sulaimani-Iraq. The process of the sampling was performed between February 2016 – August 2016. The samples were transferred to the Research Center of College of Medicine in University of Sulaimani. The sera were separated from whole blood in jelly tubes after centrifugation, and the serum samples were aliquoted into two parts and preserved in a deep freezer (-80±5) until use.
3.2.2. Detection of HCV For the purpose of HCV RNA detection STRP™ Hepatitis C virus detection kit supplied by (Sinaclon company-Iran) was used, which is a conventional RT nested PCR. According to the manufacture instruction, the procedure consisted of three steps: step one is RNA extraction, step two single tube cDNA Synthesis and first PCR Round PCR, step three second round PCR, and gel documentation for the result analysis.
3.2.2.1.
RNA extraction
For the extraction, serum samples have been thawed for 10 minutes at room temperature. In 1.5ml Eppendorf tube, 50 µl of the serum was added to 450 µl cold RNX™-Plus solution, then vortexed for the clamps to be dissolved and incubated on ice for 10 minutes. After that, 100 µl of chloroform was added then vortexed again to (3-5) second and centrifuged for 5 minutes at 12,000 RPM. Later, the aqueous phase was transferred to a new tube, and an equal volume of Isopropanol (250-300 µl) was added. The tube was inverted 10 times and 30
Chapter Three
Materials and methods
incubated at (-20 ⁰C) for at least 20 minutes following centrifugation for 15 minutes at 12,000 RPM. Next, the aqueous phase was discarded and 200 µl of 70% Ethanol was added to the pellet then inverted 10 times and centrifuged for 5 minutes at 12,000 RPM. Later, the aqueous phase was discarded and the pellet, which is RNA, was dried incompletely for 20-30 minutes at room temperature. Finally, the RNA was dissolved in 30 µl Diethylpyrocarbonate (DEPC) treated water.
3.2.2.2.
Single tube cDNA Synthesis and first PCR Round PCR
First, PCR tubes for cDNA synthesis were labeled for positive, negative control, and samples. Then a mixture of (34 µl of Mix I, 1 µl of RT enzyme, 0.3 µl of Taq DNA polymerase, and 40 µl of mineral oil) was added to each tube, and the mixture was shaken and spined down. Next, the extracted RNA tubes were placed at (95⁰C) for 1 minutes then placed on ice. Then 10 µl of RNA, positive control, and DEPC Distilled Water (DW) were added to each patient, positive, and negative tubes respectively. Finally, the tubes were closed and the mixture spined down for 3-5 second and put to preheated thermocycler, which was programmed as follow: 20 minutes at 42⁰C for cDNA synthesis, 93⁰C for 2 minutes for initial denaturation, and 35 cycles of each denaturation at 93⁰C, annealing at 55⁰C, and extension at 72⁰C for 30, 40, 30 seconds, respectively.
3.2.2.3.
Second round PCR
According to the manufacture instruction, PCR tubes were prepared by adding 22 µl of (1 X PCR Mix II), 0.2μl Taq DNA Polymerase, and 20 μl Mineral oil to a new reaction tubes. Then the tubes were closed for shaking and spinning down. Next 3µl of PCR products from the first round were added to the tubes and the tubes transferred to thermal cycler programed as: 90 seconds for initial denaturation at 93⁰C, then 30 cycles of 30 second at 93⁰C, 35 second at 31
Chapter Three
Materials and methods
55⁰C, and 30 second at 72⁰C for denaturation, annealing, and extension, respectively. The amplified fragments were analyzed by loading 5 µl of PCR product in 2% agarose gel. The presence of 234bp fragments indicated as positive results.
3.2.3. HCV 5´UTR amplification by RT nested PCR 3.2.3.1.
PCR primer design
Two sets of primers were designed for nested PCR based on 5´UTR of genomic HCV using National Center for Biotechnology Information (NCBI) primer designing tool and synthesized in Macrogen Inc. Company Korea. The sequences of the primers are shown in Table (3.4). The primers which are used in the first round PCR were corresponded to HCV-1 sense oriented nucleotides 268 to 251 ROF (AGCGTCTAGCCATGGCGT), which are numbered according to Bukh et al. (1992) and antisense nucleotide (-4 to -22) ROR (GCACGGTCTACGAGACCT). The primers which are used in second round PCR were corresponded to sense oriented nucleotides -199 to -183 RIF (GTGGTCTGCGGAACCGG), and reverse nucleotides corresponded to antisense nucleotides -26 to -43 RIR (GGGCACTCGCAAGCACCC) [155].
Table (3.8): Nested PCR primers Primer name ROF ROR RIF RIR
PCR Round 1st 2nd
Primer sequence AGC GTC TAG CCA TGG CGT GCA CGG TCT ACG AGA CCT GTG GTC TGC GGA ACC GG GGG CAC TCG CAA GCA CCC
32
Product size (bp) 264
174
Chapter Three
3.2.3.2.
Materials and methods
Preparation of primers stock solution
In order to prepare 100 pmole/µl of the stock solution for the primers, 170 µl of DEPC DW was added to the lyophilized primer tubes according to the instruction supplied by the synthesizer company. Then the solution was diluted to obtain 10 pmole/ µl to be ready for PCR.
3.2.3.3.
Viral nucleic acid extraction
For the purpose of RNA extraction, Viral Nucleic Acid Extraction Kit ΙΙ supplied by (Geneaid company) was used. According to the supplier procedure, two hundred microliters sample was transferred to a 1.5µl microcentrifuge tube, then 400 µl of VB Lysis buffer was added and vortexed, then incubated at room temperature for 10 minutes. Next 450 µl of AD Buffer was added to the sample lysate and shaked vigorously to mix then 600 µl of the lysate was transferred VB column in a 2ml Collection Tube and centrifuged at 14-16,000 x g for 1 minute. This last step was repeated twice then the 2ml Collection tube was removed and the VB column was transferred to a new 2ml Collection tube. Next 400 µl of W1 Buffer was added to the VB column and centrifuged at 14-16,000 x g for 30 seconds. Then 600 µl of Wash Buffer was added to the VB column and centrifuged at 14-16,000 x g for another 30 seconds. Next the flow-through was discarded and the VB column was placed back in the 2ml Collection Tube and centrifuged at 14-16,000 x g for 3 minutes to dry the column matrix. Finally the VB column was placed in a clean 1.5ml microcentrifuge tube, 50 µl of RNasefree water was added to the center of the VB column matrix and left for at least 3 minutes to ensure the RNase-free water was absorbed by the matrix, and then centrifuged at 14-16,000 x g for 1 minute to elute the purified nucleic acid.
33
Chapter Three
3.2.3.4.
Materials and methods
RNA quality and quantity measurement
For the measurement of the quality and quantity of the RNA samples, (Genway genova nanodrop) was used. As the instructions supplied with the device firstly DEPC DW was used for blank measuring then 2 µl of the extracted RNA from each sample was used for determining purity and concentration in µl/ml unit. The purest and high concentration samples were used for the later steps.
3.2.3.5.
cDNA synthesis
AccuPower® RocketScript RT-PCR PreMix was used for cDNA synthesis. According to the kit instruction, for the purpose of obtaining 20 µl cDNA, the extracted RNA was thawed, then 3 µl of the total RNA was added to the AccuPower® RocketScript RT-PCR PreMix tubes. Next, DEPC-water was added into AccuPower® RocketScript RT-PCR PreMix tubes to a total volume of 20 µl. Finally the lyophilized white pellet was dissolved by flicking with finger or pipetting, and then briefly spined down for 3-5 second and put to preheated thermocycler, which was programmed as 42⁰C for 30 minutes.
3.2.3.6.
First round
For the first round of PCR, 25 µl of OnePCR™ pre-mix, which contains (Taq DNA polymerase, PCR buffer, dNTPs, gel loading dye, and fluorescence dye), was used with 1 µl cDNA product, and 1 µl of each primer (ROF and ROR) from outer set (Table 3.8). The process of amplification included initial denaturation for 3 minutes at 94⁰C, then running 35 cycles of amplification. The steps included 45 seconds of each denaturation, annealing, and extension at 94⁰C, 58⁰C, and 72⁰C respectively. And finally, 5 minutes at 72⁰C for the final extension (Table 3.9). 34
Chapter Three
3.2.3.7.
Materials and methods
Second round
Twenty-five microliters of One PCR™ premix, which contains (Taq DNA polymerase, PCR buffer, dNTPs, gel loading dye, and fluorescence dye), was mixed with 1µl of DNA template from the first round PCR product, then 1 µl of each primer (RIF and RIR) inner set was added (Table 3.5). The amplification process was as it follows: 3 minutes at 94⁰C for initial denaturation, then running 25 cycles of amplification. The steps of each cycle included 1 minute at 94⁰C, 65⁰C, and 72⁰C for denaturation, annealing, and extension respectively. Moreover, the final extension at 72⁰C for 4 minutes as shown in table (3.6).
Table (3.9): First and second round PCR reaction components. First round PCR
Second round PCR
components
volume(µl)
components
Master mix
25
Master mix
25
ROF Primer
1
RIF Primer
1
ROR Primer
1
RIR Primer
1
cDNA template
1
DNA template
1
DEPC DW
22
DEPC DW
22
Total
50
Total
50
35
volume(µl)
Chapter Three
Materials and methods
Table (3.10): Nested PCR condition. First round Step
Condition
Initial-denaturation
94⁰C 3-min
Denaturation
94⁰C 45-sec
Annealing
58⁰C 45-sec
Extension
72⁰C 45-sec
Final extension
72⁰C 5-min
Cycle 1
35
1
Second round Step
Condition
Initial-denaturation
94⁰C 3-min
Denaturation
94⁰C 1-min
Annealing
65⁰C 1-min
Extension
72⁰C 1-min
Final extension
72⁰C 4-min
3.2.3.8.
Cycle 1
25
1
Gel documentation for detection of nested PCR bands
For gel documentation, 2% agarose gel was prepared by dissolving 0.25g of agarose in 50ml of Tris-borate-EDTA 1X (TBE) buffer, then heated by microwave for 3 minutes. After that, 2 µl Ethidium bromide was added to the warm liquefied agarose then poured into the gel tray and left at room temperature for 20 minutes for solidification. A comb was put within the gel for making wells. After solidification of the gel, 8 µl of PCR products were loaded into the wells and a 100V electric charge was conducted for 50 minutes. The bands in the gel were visualized using UV transilluminator (UVP MultiDoc-It™ Imaging System) [156].
36
Chapter Three
Materials and methods
3.2.4. Genotyping by RFLP technique This method has been originally employed for genotyping of HCV by McOmish et al. [59] and modified by Pohjanpelto, Lappalainen et al., in which the amplified HCV 5´UTR were digested with certain restriction enzymes. In the present method a set of restriction enzymes (ScrFI, Hinf I, BstNI, and BstUI) were used [127]. The enzyme BstNI was used as isoschizomer of MvaI. The restriction enzymes were combined to make three combinations as they follow: the combination I included ScrFI/Hinf I, then the combination II composed of BstNI/Hinf I and combination III included BstUI restriction enzymes. Each sample of the PCR products were divided into 3 tubes which contained appropriate buffer, then 10 U of each combination enzymes were added and incubated at 37⁰C for ScrFI, Hinf and at 60⁰C for BstNI, and BstUI for 3 hours. The obtained digests were heated at 80⁰C for 5 minutes before gel documentation.
3.2.4.1. Gel documentation for detection of RFLP bands Two percent agarose gel was prepared for visualizing, and Ethidium bromide staining of the bands and the bands were visualized under ultraviolet light using (UVP MultiDoc-It™ Imaging System).A hundred base pair (100 bp) DNA marker was included in each gel documentation. The different pattern yielded by the enzymes digestion is the basis of determining different genotypes. The pattern of each genotype yielded in this study was compared to the pattern shown in Table (3.11) [155].
37
Chapter Three
Materials and methods
Table (3.11): RFLP pattern of HCV genotypes adopted from Pohjanpelto, Lappalainen et al. [127]. Fragment sizes (bp) HCV genotypes
Tube A
Tube B
Tube C
ScrFI/HinfI
BstNI/HinfI
BstUI
1a
97
97
129
1b
97
97
99
2a
97
174
174
2b
174
174
174
3a
129
145
99
3b
97
145
99
4
97
145
129
5
97
174
99
6
97
97
174
3.2.5. HCV 5´UTR sequencing For the purpose of sequencing, 20 µl of the PCR products from the second round Nested PCR of some representative samples with set two primers, were sent to Macrogen company- Korea to be confirmatory data for the results. The obtained data from DNA sequencing was blased on NCBI online website.
38
Chapter Four Results
Chapter Four
Results
4. Results 4.1 HCV detection The collected 72 samples were investigated through using RT-nested PCR, all samples showed positive result. The samples included 41 males and 31 females of different ages ranging from 15-61 years. According to these results, the infected males were (56.94%), and the infected females were (43.06%). The results of HCV detection on agarose gel electrophoresis were presented in figure 4.1a, 4.1b, 4.1c, and 4.1d. Two hundred and thirty four base pair (234 bp) band was used as positive control for detection of positive samples. Depending on the positive control any band parallel to it indicated as positive, and no band indicated as negative.
39
Chapter Four
Results
500 bp 400 bp 300 bp
234 bp
200 bp 100 bp
Figure (4.1a): Gel electrophoresis of RT nested PCR amplicons for 20 samples. Lane 1 M: 100 bp DNA marker, Lane 2 PC: positive control, Lane 3 NC: negative control, Lane 4-23: represent sample 1-20.
40
Chapter Four
Results
500 bp 400 bp 300 bp
234 bp
200 bp 100 bp
Figure (4.1b): Gel electrophoresis of RT nested PCR amplicons for 20 samples. Lane 1 M: 100 bp DNA marker, Lane 2 PC: positive control, Lane 3 NC: negative control, Lane 4-23: represent sample 21-40.
41
Chapter Four
Results
500 bp 400 bp 300 bp
234 bp
200 bp 100 bp
Figure (4.1c): Gel electrophoresis of RT nested PCR amplicons for 20 samples. Lane 1 M: 100 bp DNA marker, Lane 2 PC: positive control, Lane 3 NC: negative control, Lane 4-23: represent sample 41-60.
42
Chapter Four
Results
500 bp
400 bp
300 bp
234 bp
200 bp
100 bp
Figure (4.1d): Gel electrophoresis of RT nested PCR amplicons for 12 samples. Lane 1 M: 100 bp DNA marker, Lane 2 PC: positive control, Lane 3 NC: negative control, Lane 4-15: represent sample 61-72.
43
Chapter Four
Results
4.2. Amplification of HCV 5´UTR Fifty six (56) out of 72 positive samples from the purest extracted RNA samples were selected for amplification of 5´UTR through nested PCR for digestion by RFLP method. Positive results were obtained for all of the samples. Figure 4.2a, 4.2b, 4.2c, and 4.2d show results of Gel electrophoresis of (56) amplicons of HCV 5´UTR. A hundred and seventy four base pair (174 bp) band was used as positive control. Any band parallel to the positive control indicated as positive, and no bands indicated as negative.
500 bp 400 bp
174 bp
300 bp 200 bp 100 bp
Figure (4.2a): Gel electrophoresis results of RT nested PCR for amplification 5´UTR Lane 1 M: 100 bp DNA marker, Lane 2 PC: positive control, Lane 3 NC: negative control, Lane 4-17: represent sample 1-14.
44
Chapter Four
Results
500 bp 400 bp
174 bp
300 bp 200 bp 100 bp
Figure 4.2b Gel electrophoresis results of RT nested PCR for amplification 5´UTR Lane 1, 15 M: 100 bp DNA markers, Lane 2 PC: positive control, Lane 3 NC: negative control, Lane 4: represents sample 17, Lane 5: represents sample 20, Lane 6-14: represent sample 22-30.
45
Chapter Four
Results
500 bp 400 bp 300 bp
174 bp
200 bp
100 bp
Figure 4.2c Gel electrophoresis results of RT nested PCR for amplification 5´UTR Lane 1 M: 100 bp DNA marker, Lane 2 PC: positive control, Lane 3 NC: negative control, Lane 4-23: represent sample 31-50, Lane 24: represents sample 53, Lane 25: represents sample 56.
46
Chapter Four
Results
500 bp 400 bp 300 bp
174 bp 200 bp 100 bp
Figure 4.2d Gel electrophoresis results of RT nested PCR for amplification 5´UTR Lane 1 M: 100 bp DNA marker, Lane 2 PC: positive control, Lane 3 NC: negative control, Lane 4-10: represent sample 57-63, Lane 11: represents sample 67, Lane 12: represents sample 71.
47
Chapter Four
Results
4.3. Genotyping through RFLP method HCV genotypes were determined in 47 patient samples. The results of genotyping based on RFLP for 5´UTR showed that the predominant genotype in Sulaimani Governorate is subtype 1a (72.34%). Genotype 4 (12.77%), subtype 3a (8.51%), subtype 1b (2.13%), subtype 2a (2.13%), and genotype 5 (2.13%) are also present with lower prevalence (table 4.1 & fig. 4.4). The pattern of each genotype yielded in this study was compared to the pattern shown in Table (3.10).
Table (4.1): Percentage HCV genotypes among 47 HCV patients in Sulaimani Governorate.
Percentage
Male Sex Female
Genotype
Genotype
Genotype
Genotype
Genotype
Genotype
1a
1b
2a
3a
4
5
34/47
1/47
1/47
4/47
6/47
1/47
72.34%
2.13%
2.13%
8.51%
12.77%
2.13%
20
0
1
3
2
0
(58.82%)
(0%)
(100%)
(75%)
(33.33%)
(0%)
14
1
0
1
4
1
(41.17%)
(100%)
(0%)
(25%)
(66.66%)
(100%)
Figures of 4.4a, 4.4b, 4.4c, 4.4d, 4.4e, 4.4f, and 4.4g show the RFLP pattern for HCV genotypes on agarose gel electrophoresis. Each three lanes together show a pattern for one sample.
48
Chapter Four
Results
Percentage
72.34%
12.77%
8.51% 2.13%
G 1a
G4
G 3a
G 1b
2.13% G 2a
2.13% G5
Genotypes
Figure 4.3 HCV genotype distributions in Sulaimani Governorate
100 bp
Figure 4.4a Gel electrophoresis results of RFLP for HCV genotypes Lane 1 M: 100 bp DNA marker, lane 2-4, 5-7, 11-13, 14-16, 20-22, 23-25: represent genotype 1a, and lane 8-10, 17-19: represent genotype 4. G1a: 97 bp, 97 bp, 129 bp. G4: 97 bp, 145 bp, 129 bp. 49
Chapter Four
Results
500 bp
100 bp
Figure 4.4b Gel electrophoresis results of RFLP for HCV genotypes Lane 1 M: 100 bp DNA marker, lane 2-4, 5-7, 16-18, 23-25: represent genotype 1a, lane 8-10: represent genotype 4, lane 11-13: represent genotype 2a, lane 14-16: represent genotype 3a, and lane 20-22: represent genotype 5. G1a: 97 bp, 97 bp, 129 bp. G4: 97 bp, 145 bp, 129 bp. G2a: 97 bp, 174 bp, 174 bp. G3a: 129 bp, 145 bp, 99 bp. G5: 97 bp, 174 bp, 99 bp.
50
Chapter Four
Results
500 bp
100 bp
Figure 4.4c Gel electrophoresis results of RFLP for HCV genotypes Lane 1 M: 100 bp DNA marker, lane 2-4, 8-10, 11-13, 14-16: represent genotype 1a, and lane 5-7: represent genotype 1b. G1a: 97 bp, 97 bp, 129 bp. G1b: 97 bp, 97 bp, 99 bp.
51
Chapter Four
Results
500 bp
100 bp
Figure 4.4d Gel electrophoresis results of RFLP for HCV genotypes Lane 1 M: 100 bp DNA marker, lane 2-4, 5-7, 8-10, 14-16: represent genotype1a, and lane 11-13: represent genotype 4. G1a: 97 bp, 97 bp, 129 bp. G4: 97 bp, 145 bp, 129 bp.
52
Chapter Four
Results
100 bp
Figure 4.4e Gel electrophoresis results of RFLP for HCV genotypes Lane 1 M: 100 bp DNA marker, and lane 2-4, 5-7, 8-10, 11-13, 14-16, 17-19, 20-22, 23-25: represent genotype 1a. G1a: 97 bp, 97 bp, 129 bp.
53
Chapter Four
Results
500 bp
100 bp
Figure 4.4f Gel electrophoresis results of RFLP for HCV genotypes Lane 1 M: 100 bp DNA marker, lane 2-4, 5-7, 8-10, 14-16: represent genotype 1a, and lane 11-13: represent genotype 4. G1a: 97 bp, 97 bp, 129 bp. G4: 97 bp, 145 bp, 129 bp.
`
54
Chapter Four
Results
100 bp
Figure 4.4g Gel electrophoresis results of RFLP for HCV genotypes Lane 1 M: 100 bp DNA marker, lane 2-4, 14-16, 20-22: represent genotype 3a, lane 5-7, 8-10, 11-13, 23-25: represent genotype 1a, and lane 17-19: represent genotype 4. G1a: 97 bp, 97 bp, 129 bp. G3a: 129 bp, 145 bp, 99 bp. G4: 97 bp, 145 bp, 129 bp.
55
Chapter Four
Results
4.4. HCV 5´UTR Sequencing For the purpose of confirmation of the RFLP results, the amplified products of HCV 5´UTR were submitted to cycle sequencing reaction in Macrogen Company, South Korea. Seven (7) samples which represented each genotype and/or subtype were selected for the confirmation process. The obtained data from sequencing were blasted on NCBI online website for determination of the genotypes. Table 4.2 shows a comparison between RFLP method and sequence analysis of HCV 5´UTR for determination of genotypes.
Table (4.2): Comparison between RFLP method and sequence analysis of HCV 5´UTR. No.
Sample
1
Genotyping
Identities
Accession
RFLP
Sequencing
%
No.
1
1a
1a
99
FJ181999.1
2
2
1a
1a
99
FJ181999.1
3
8
4
4
99
AB550018.1
4
9
2a
2a
98
KR233149.1
5
10
1a
1a
98
KP782006.1
6
35
5
5
86
KJ925150.1
7
62
3a
3a
97
KX214759.1
56
Chapter Five Discussion
Chapter Five
Discussion
5. Discussion The difference in the geographical distribution of HCV genotypes in the world made it worthy to get a local knowledge concerning viral genotypes. HCV genotyping is regarded as an epidemiological marker and possesses importance in investigating the source of infection and illustrating the possible mode of transmission, determining the duration and benefit of antiviral therapy and implications in the development of effective vaccine [157]. In the current study, HCV RNA in 72 serum samples were detected using RTNested PCR, which are collected from Shahid Hadi Consultant Clinic and Thalassemia Center in Sulaimani Governorate. The detection of HCV for all samples, by conventional PCR was positive as they were diagnosed with prior history of HCV through quantitative PCR (qPCR). In Iraq, in two recent studies, it was appeared that the percent of HCV detected by Real time PCR among seropositive patients were 56.66% and 65% [75, 158]. In the current study, there were no negative results because all samples were previously diagnosed as HCV positive through qPCR technique. By applying amplification of 5´UTR and RFLP technique, it was appeared here that the percentage of the HCV subtype 1a is the most frequent (72.34%) among the studied sample, followed by genotype 4 (12.77%), subtype 3a (8.51%), subtype 1b (2.13%), subtype 2a (2.13%), and genotype 5 (2.13%). These results were in agreement with another finding in Sulaimani achieved by DNA sequencing on different patient groups correlated with risk factors [80], in which the genotypes 1, 2, and 4 were detected with 87.5%, 8.3%, and 4.2%, respectively. The detection of more genotypes and subtypes, in this study, belongs to the using of RFLP technique and the larger sample. In contrast to our observations, in Iraq rather than Kurdistan Region, the distribution pattern of HCV genotypes is different, in which genotype 4 is the predominant one [66, 71, 73, 76, 159]. In Baghdad HCV genotypes had 57
Chapter Five
Discussion
investigated using ELISA-III searching antibodies at thalassemic Iraqi children. It was recorded that genotype 4 as the most common type that has been found in 35.4% of the cases, followed by 1a in 27.1% of patients and genotype 1b in 22.9% while a mixed infection of genotype 1a and 4 was 14.6% [71]. Another study which carried out on patients from Najaf, Babylon, Qadisyia, Karbala, and Baghdad, the percentages of genotypes were 89.4% for genotype 4, 6.79% for 1b, 2.91% for 2b, 2.91% for 3a, and 1.94% for 6a [76]. In Mousl, the genotype 4 was recorded the most prevalent among different groups; thalassemia (94%), chronic liver disease (85%), and blood donor (80%), while subtype 1b was with 5%, 10%, and 20% for the groups, respectively [73]. It appears the result of this research is close to those researches have been done in Northern Iraq, and far from those have been done in the middle and east of Iraq, in which the most predominant genotype is 4. Similarly, in the neighbor country, in Turkey, most of the studies suggest that genotype 1 is the most prevalent genotype as this study verified [160-164]. In a study conducted on 500 patients, it was found that genotype 1 is the predominant genotype followed by genotype 2a [160]. The same as well in another study, in which they recorded genotype 1 as predominant in 89.4% of the cases, while the other genotypes found with a lower extent as follow: 2a (5.2%), 2b (1%), 3a (2.1%), and 4 (2.1%) [162]. Sanlidağ, Akcali et al. observed 92% for genotype 1 as the most common in Turkey followed by 5% and 2% for genotype 4 and 2, respectively [164]. Another study from two different regions in Turkey, recorded genotype 1 the most prevalent (72.88%) followed by genotype 2 (11.93%), 3 (13.48%), and 4 (1.70%) [161]. Studies from another neighbor, in Iran reported similar suggestions [128, 129, 165-168]. In Iran, the frequency of HCV genotypes was similar to that of the current study. A study used RFLP technique with a proper set of restriction enzymes (Apa I, Hinf I, EcoR II, and Bsh1236) and revealed that 1a (54.26%) is the most frequent in Shahrekord-Iran, followed by 1b (11.71%), 3a (27.66%), 2a 58
Chapter Five
Discussion
(2.12%), and 4 (4.25%) [165]. Slightly different percentages in Tahran-Iran were recorded where genotype 1a was the most prevalent (52.88%) followed by 1b (14.01%), 3a (27.57%), 2a (2.1%), 4 (3.44%) [128]. In Ahvaz-Iran, using RFLP, genotype 1a was of (53.8%) and 46.2% for genotype 3a [129]. These similarities between Kurdistan (North of Iraq), Turkey, and Iran regarding HCV genotypes may be are attributed to some factors like; importing of workers from those countries, many Kurdish people are traveling to the countries for medical treatment and holiday, familiar relationships especially with Iran. In Jordan depending on a study, HCV genotype 1a is the dominant (40%) followed by 1b (33.3%) and genotype 4 (26.6%) [82]. Although there are relatively little researches showed the prevalence of genotype 5 in the Middle East, but in Syria and Saudi Arabia this genotype was reported as it was reported here. In Syria, a study mentioned that genotype 4 was the most common type of HCV carriers. It occurred in 59% of the cases followed by genotype 1 in 28.5% of cases and genotype 5 that observed in 10% of the infected patients. Most of the Genotype 5 in Syria originated from the Northern Province, [169] which is close to Kurdistan. The detection of genotype 5 in Sulaimani, which has not been recorded in the past, may return to that large wave of Syrian refugees settled camps in Sulaimani due to the Syrian civilian war during conducting our study. Genotype 5 was found just in one patient in this study, this is suggesting that this genotype is not indigenous. In Saudi Arabia, a study showed that the majority (62%) of the HCV genotypes were genotype 4, while the other genotypes determined as follow: 1 (24.1%); 2 (7.4%); 3 (5.9%); and 5 (0.3%) [170]. According to Ramia and Eid-Fares in the Middle East, the pattern of HCV genotypes can be divided into two patterns: one pattern for the Arab countries (except for Jordan), the other pattern for the non-Arab countries like Turkey, Israel, and Iran, whereas genotype 4 is the most common in the Arabic countries, and genotype 1 for the non-Arabic countries [171]. If we compare the frequency of HCV genotypes from Kurdistan region with the world, The HCV 59
Chapter Five
Discussion
genotype pattern in Iraqi-Kurdistan region looks like the pattern of non-Arabic countries rather than the neighboring Arabic countries. In addition, we can see the HCV genotype frequencies, which recorded from Middle and Eastern Iraq, are similar to those recorded from Egypt, Africa, and the Middle East generally [124, 171]. But the genotypes, which recorded for Europe and America, are the same which recorded here [133, 172]. According to the literatures, HCV genotypes are distributed according to geographical regions [59, 173, 174]. Because the HCV genotype frequencies recorded in Sulaimani and North of Iraq are close to those in Europe and Asia and away from those recorded for the middle and east of Iraq, the Arabic countries and Africa, this means that the geographical distribution of HCV genotypes is also related to the ethnicity as reported in the literatures [175]. The world encountered the most prevalent HCV genotypes are genotype 1, 2, and 3 [59, 173, 174]. For North America and Northern Europe, subtype 1a is the most common followed by 2b and 3a [133, 172]. Subtype 1b is the most prevalent in Southern and Eastern Europe followed by genotype 2 and 3 [60, 176]. HCV genotype 2 was found most commonly in Northern Italy, North America and Europe [177], whereas HCV infections in Asia was predominate with genotype 3 accounting for (39%) of all the cases, which mostly occur in India and Pakistan [178], and it has been found with high frequency among (IVDU) in Europe and the USA [179, 180]. In North Africa, HCV subtype 1b appears to be common, which is the same subtype for Eastern and Southern Europe [181-183]. Although genotype 4 is rare in the Western countries, different prevalence has been reported in Southern Europe [184, 185]. In addition, genotype 4 was recorded for the USA with high prevalence among (IVDU) [186].
60
Chapter Six Conclusions and Recommendations
Chapter six
Conclusions and recommendations
6. Conclusions and recommendations 6.1. Conclusions HCV genotype 1a is the most common genotype among HCV infected patients in Sulaimani Governorate. Also there is the existence of other genotypes such as 1b, 2a, 3a, 4, and 5. The pattern of HCV genotypes in Sulaimani Governorate is a part of the pattern included the non-Arab countries in Middle East like Turkey and Iran and most European countries and North America while it is different from the pattern included Africa and Arab countries.
61
Chapter six
Conclusions and recommendations
6.2. Recommendations It is more important to study the prevalence of HCV in Sulaimani by screening a large population included urban and rural districts of the Governorate. Determination of HCV genotypes should be established in all clinical setting prior of treatment.
62
Appendix
Appendix
Appendix HCV 5‘UTR Nucleotide blast for confirmation on NCBI online website Sample 1 versus Accession No. FJ181999.1 Query
2
AAATGACGGACGACCGGGTCCTTTCTTGGATAAACCCGCTCAATGCCTGGACATTTGGGC
61
|| || ||||||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct
9
AATTGCCGGACGACCGGGTCCTTTCTTGGATAAACCCGCTCAATGCCTGGAGATTTGGGC
68
Query
62
GTGCCCCCGCAAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGC
121
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct
69
GTGCCCCCGCAAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGC
Query
122
CTGATAGGGTGCTTGCGAGTGCCC
128
145
|||||||||||||||||||||||| Sbjct
129
CTGATAGGGTGCTTGCGAGTGCCC
152
Sample 2 versus Accession No. FJ181999.1 Query
11
GACGACCGGGT-CTTTCTTGGATAAACCCGCTCCATGCCTGGACATTTGGGCGTGCCCCC
69
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| Sbjct
92
GACGACCGGGTCCTTTCTTGGATAAACCCGCTCCATGCCTGGAGATTTGGGCGTGCCCCC
151
Query
70
GCAAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGATAGG
129
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct
152
GCAAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGATAGG
Query
130
GTGCTTGCGAGTGCCC
145
|||||||||||||||| Sbjct
212
GTGCTTGCGAGTGCCC
227
63
211
Appendix
Sample 8 versus Accession No. AB550018.1 Query
11
GGATGA-CGGGT-CTTTCTTGGATCAACCCGCTCAATGCCCGGAAATTTGGGCGTGCCCC
68
|||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct
121
GGATGACCGGGTCCTTTCTTGGATCAACCCGCTCAATGCCCGGAAATTTGGGCGTGCCCC
180
Query
69
CGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGATAG
128
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct
181
CGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGATAG
Query
129
GGTGCTTGCGAGTGccc
240
145
||||||||||||||||| Sbjct
241
GGTGCTTGCGAGTGCCC
257
Sample 9 versus Accession No. KR233149.1 Query
8
GGG-AGA-TGGGTCCTTTCTTGGATAAACCCACTCTATGCCCGGCCATTTGGGCGTGCCC
65
||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct
138
GGGAAGACTGGGTCCTTTCTTGGATAAACCCACTCTATGCCCGGCCATTTGGGCGTGCCC
197
Query
66
CCGCAAGACTGCTAGCCGAGTAGCGTTGGGTTGCGAAAGGCCTTGTGGTACTGCCTGATA
125
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct
198
CCGCAAGACTGCTAGCCGAGTAGCGTTGGGTTGCGAAAGGCCTTGTGGTACTGCCTGATA
Query
126
GGGTGCTTGCGAGTGCCCAGGGAGGTCTCGTAAACCGTGCA
257
166
||| |||||||||||||| |||||||||||||||||||||| Sbjct
258
GGGAGCTTGCGAGTGCCCCGGGAGGTCTCGTAAACCGTGCA
298
Sample 10 versus Accession No. KP782006.1 Query
10
GGACGACCGGGTCCTTTCTTGGATAAACCCGCTCAATGCCTGGACATTTGGGCGTGCCCC
69
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct
50
GGACGACCGGGTCCTTTCTTGGATAAACCCGCTCAATGCCTGGACATTTGGGCGTGCCCC
109
Query
70
CGCAAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGATAG
129
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct
110
CGCAAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGATAG
Query
130
GGTGCTTGCGAGTGCCATGGGGAGGTCTCGTAGACCGTGCA ||||||||||||||||
Sbjct
170
170
||||||||||||||||||||||
GGTGCTTGCGAGTGCCCC-GGGAGGTCTCGTAGACCGTGCA
64
209
169
Appendix
Sample 35 versus Accession No. KJ925150.1 Query
10
GGG-TGA-CGGNTCCTTTCTTGGATAAACCCGCTCAATGCCCGGAGATTTGGGCGTGCTC
67
||| ||| ||| |||||||||||||||||||||||||||||||||||||||||||||| | Sbjct
177
GGGATGACCGGGTCCTTTCTTGGATAAACCCGCTCAATGCCCGGAGATTTGGGCGTGCCC
Query
68
CCGGTGATATT-CTCGC--AGTAGTGTTGGGTCCCCAAAGG |||
Sbjct
237
|| | | || ||
236
105
|||||||||||||| | |||||
CCGC-GAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGG
276
Sample 62 versus Accession No. KX214759.1 Query
7
GCTGGNGTGA-NGGGTCCTTTCTTGG-ACAACCCGCTCAATACCCAGAAATTTGGGCGTG ||||| ||||
64
|||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct
7
GCTGGGGTGACCGGGTCCTTTCTTGGAACAACCCGCTCAATACCCAGAAATTTGGGCGTG
66
Query
65
CCCCCGCGAGATCACTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTG
124
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct
67
CCCCCGCGAGATCACTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTG
Query
125
ATAGGGTGCTTGCGAGTGCCC
145
||||||||||||||||||||| Sbjct
127
ATAGGGTGCTTGCGAGTGCCC
147
65
126
References [1]
Zein, N.N. and D.H. Persing. (1996). Hepatitis C genotypes: current trends and future implications. Paper presented at the Mayo Clinic Proceedings.
[2]
Messina, J.P., I. Humphreys, A. Flaxman, A. Brown, G.S. Cooke, O.G. Pybus, and E. Barnes. (2015). Global distribution and prevalence of hepatitis C virus genotypes. Hepatology, 61(1), 77-87.
[3]
Lindenbach, B.D. and C.M. Rice. (2013). The ins and outs of hepatitis C virus entry and assembly. Nature Reviews Microbiology, 11(10), 688-700.
[4]
Simmonds, P., J. Mellor, T. Sakuldamrongpanich, C. Nuchaprayoon, S. Tanprasert, E. Holmes, and D. Smith. (1996). Evolutionary analysis of variants of hepatitis C virus found in South-East Asia: comparison with classifications based upon sequence similarity. Journal of General Virology, 77(12), 3013-3024.
[5]
Sherman,
M.
(2010).
Hepatocellular
carcinoma:
epidemiology,
surveillance, and diagnosis. Paper presented at the Seminars in liver disease. [6]
Petruzziello, A., S. Marigliano, G. Loquercio, and C. Cacciapuoti. (2016). Hepatitis C virus (HCV) genotypes distribution: an epidemiological update in Europe. Infectious agents and cancer, 11(1), 53.
[7]
Ferenci, P. (2012). Optimal treatment duration for patients with HCV genotype 1 infection. Journal of viral hepatitis, 19(s1), 7-13.
[8]
Kensington, M. (1997). National Institutes of Health Consensus Development Conference panel statement: management of hepatitis C. Hepatology, 26, 2S-10S.
[9]
Murphy, D.G., E. Sablon, J. Chamberland, E. Fournier, R. Dandavino, and C.L. Tremblay. (2015). Hepatitis C virus genotype 7, a new genotype
66
originating from central Africa. Journal of clinical microbiology, 53(3), 967-972. [10] Feinstone, S.M., A.Z. Kapikian, R.H. Purcell, H.J. Alter, and P.V. Holland. (1975). Transfusion-associated hepatitis not due to viral hepatitis type A or B. New England Journal of Medicine, 292(15), 767-770. [11] Choo, Q.-L., G. Kuo, A.J. Weiner, L.R. Overby, D.W. Bradley, and M. Houghton. (1989). Isolation of a cDNA clone derived from a blood-borne non-A, non-B viral hepatitis genome. Science, 244(4902), 359-362. [12] McCaughan, G., P. McGuinness, G. Bishop, D. Painter, A. Lien, R. Tulloch, B. Wylie, and G. Archer. (1992). Clinical assessment and incidence of hepatitis C RNA in 50 consecutive RIBA-positive volunteer blood donors. The Medical journal of Australia, 157(4), 231-233. [13] Miller, R.H. and R.H. Purcell. (1990). Hepatitis C virus shares amino acid sequence similarity with pestiviruses and flaviviruses as well as members of two plant virus supergroups. Proceedings of the National Academy of Sciences, 87(6), 2057-2061. [14] Suzuki, R., T. Suzuki, K. Ishii, Y. Matsuura, and T. Miyamura. (1999). Processing and functions of Hepatitis C virus proteins. Intervirology, 42(2-3), 145-152. [15] Penin, F., J. Dubuisson, F.A. Rey, D. Moradpour, and J.M. Pawlotsky. (2004). Structural biology of hepatitis C virus. Hepatology, 39(1), 5-19. [16] Griffin, S.D., L.P. Beales, D.S. Clarke, O. Worsfold, S.D. Evans, J. Jaeger, M.P. Harris, and D.J. Rowlands. (2003). The p7 protein of hepatitis C virus forms an ion channel that is blocked by the antiviral drug, Amantadine. FEBS letters, 535(1), 34-38. [17] Pavlović, D., D.C. Neville, O. Argaud, B. Blumberg, R.A. Dwek, W.B. Fischer, and N. Zitzmann. (2003). The hepatitis C virus p7 protein forms an ion channel that is inhibited by long-alkyl-chain iminosugar 67
derivatives. Proceedings of the National Academy of Sciences, 100(10), 6104-6108. [18] Andre, P., G. Perlemuter, A. Budkowska, C. Brechot, and V. Lotteau. (2005). Hepatitis C virus particles and lipoprotein metabolism. Paper presented at the Seminars in liver disease. [19] Pileri, P., Y. Uematsu, S. Campagnoli, G. Galli, F. Falugi, R. Petracca, A.J. Weiner, M. Houghton, D. Rosa, and G. Grandi. (1998). Binding of hepatitis C virus to CD81. Science, 282(5390), 938-941. [20] Scarselli, E., H. Ansuini, R. Cerino, R.M. Roccasecca, S. Acali, G. Filocamo, C. Traboni, A. Nicosia, R. Cortese, and A. Vitelli. (2002). The human scavenger receptor class B type I is a novel candidate receptor for the hepatitis C virus. The EMBO journal, 21(19), 5017-5025. [21] Evans, M.J., T. von Hahn, D.M. Tscherne, A.J. Syder, M. Panis, B. Wölk, T. Hatziioannou, J.A. McKeating, P.D. Bieniasz, and C.M. Rice. (2007). Claudin-1 is a hepatitis C virus co-receptor required for a late step in entry. Nature, 446(7137), 801-805. [22] Ploss, A., M.J. Evans, V.A. Gaysinskaya, M. Panis, H. You, Y.P. de Jong, and C.M. Rice. (2009). Human occludin is a hepatitis C virus entry factor required for infection of mouse cells. Nature, 457(7231), 882-886. [23] Blanchard, E., S. Belouzard, L. Goueslain, T. Wakita, J. Dubuisson, C. Wychowski, and Y. Rouillé. (2006). Hepatitis C virus entry depends on clathrin-mediated endocytosis. Journal of virology, 80(14), 6964-6972. [24] Popescu, C.-I., L. Riva, O. Vlaicu, R. Farhat, Y. Rouillé, and J. Dubuisson. (2014). Hepatitis C virus life cycle and lipid metabolism. Biology, 3(4), 892-921. [25] Koutsoudakis, G., A. Kaul, E. Steinmann, S. Kallis, V. Lohmann, T. Pietschmann, and R. Bartenschlager. (2006). Characterization of the early
68
steps of hepatitis C virus infection by using luciferase reporter viruses. Journal of virology, 80(11), 5308-5320. [26] Tscherne, D.M., C.T. Jones, M.J. Evans, B.D. Lindenbach, J.A. McKeating, and C.M. Rice. (2006). Time-and temperature-dependent activation of hepatitis C virus for low-pH-triggered entry. Journal of virology, 80(4), 1734-1741. [27] Haid, S., T. Pietschmann, and E.-I. Pécheur. (2009). Low pH-dependent hepatitis C virus membrane fusion depends on E2 integrity, target lipid composition, and density of virus particles. Journal of Biological Chemistry, 284(26), 17657-17667. [28] Lavillette, D., B. Bartosch, D. Nourrisson, G. Verney, F.-L. Cosset, F. Penin, and E.-I. Pécheur. (2006). Hepatitis C virus glycoproteins mediate low pH-dependent membrane fusion with liposomes. Journal of Biological Chemistry, 281(7), 3909-3917. [29] Moradpour, D. and F. Penin, Hepatitis C virus proteins: from structure to function, in Hepatitis C Virus: From Molecular Virology to Antiviral Therapy. 2013, Springer. p. 113-142. [30] Lohmann, V., Hepatitis C virus RNA replication, in Hepatitis C virus: from molecular virology to antiviral therapy. 2013, Springer. p. 167-198. [31] Romero-Brey, I., A. Merz, A. Chiramel, J.-Y. Lee, P. Chlanda, U. Haselman, R. Santarella-Mellwig, A. Habermann, S. Hoppe, and S. Kallis. (2012). Three-dimensional architecture and biogenesis of membrane structures associated with hepatitis C virus replication. PLoS Pathog, 8(12), e1003056. [32] Jopling, C.L., M. Yi, A.M. Lancaster, S.M. Lemon, and P. Sarnow. (2005). Modulation of hepatitis C virus RNA abundance by a liverspecific MicroRNA. Science, 309(5740), 1577-1581.
69
[33] Miyanari, Y., K. Atsuzawa, N. Usuda, K. Watashi, T. Hishiki, M. Zayas, R. Bartenschlager, T. Wakita, M. Hijikata, and K. Shimotohno. (2007). The lipid droplet is an important organelle for hepatitis C virus production. Nature cell biology, 9(9), 1089-1097. [34] Da Costa, D., M. Turek, D.J. Felmlee, E. Girardi, S. Pfeffer, G. Long, R. Bartenschlager, M.B. Zeisel, and T.F. Baumert. (2012). Reconstitution of the entire hepatitis C virus life cycle in non-hepatic cells. Journal of virology, JVI. 01066-12. [35] Hueging, K., M. Doepke, G. Vieyres, D. Bankwitz, A. Frentzen, J. Doerrbecker, F. Gumz, S. Haid, B. Wölk, and L. Kaderali. (2014). Apolipoprotein E codetermines tissue tropism of hepatitis C virus and is crucial for viral cell-to-cell transmission by contributing to a postenvelopment step of assembly. Journal of virology, 88(3), 1433-1446. [36] Gastaminza, P., G. Cheng, S. Wieland, J. Zhong, W. Liao, and F.V. Chisari. (2008). Cellular determinants of hepatitis C virus assembly, maturation, degradation, and secretion. Journal of virology, 82(5), 21202129. [37] Ariumi, Y., M. Kuroki, M. Maki, M. Ikeda, H. Dansako, T. Wakita, and N. Kato. (2011). The ESCRT system is required for hepatitis C virus production. PloS one, 6(1), e14517. [38] Corless, L., C.M. Crump, S.D. Griffin, and M. Harris. (2010). Vps4 and the ESCRT-III complex are required for the release of infectious hepatitis C virus particles. Journal of General Virology, 91(2), 362-372. [39] surveillance, G. and c.o.h. C. (1999). Report of a WHO Consultation organized in collaboration with the Viral Hepatitis Prevention Board, Antwerp, Belgium. J Viral Hepat, 6, 35-47. [40] Thimme, R., D. Oldach, K.-M. Chang, C. Steiger, S.C. Ray, and F.V. Chisari. (2001). Determinants of viral clearance and persistence during 70
acute hepatitis C virus infection. The Journal of experimental medicine, 194(10), 1395-1406. [41] Farci, P., H.J. Alter, D. Wong, R.H. Miller, J.W. Shih, B. Jett, and R.H. Purcell. (1991). A long-term study of hepatitis C virus replication in nonA, non-B hepatitis. New England Journal of Medicine, 325(2), 98-104. [42] Farci, P., H.J. Alter, A. Shimoda, S. Govindarajan, L.C. Cheung, J.C. Melpolder, R.A. Sacher, J.W. Shih, and R.H. Purcell. (1996). Hepatitis C virus–associated fulminant hepatic failure. New England Journal of Medicine, 335(9), 631-634. [43] Schuppan, D., A. Krebs, M. Bauer, and E. Hahn. (2003). Hepatitis C and liver fibrosis. Cell Death & Differentiation, 10, S59-S67. [44] Öhrngren, P. and J. Georgsson. (2004). Synthesis of a Hepatitis C Virus NS3 Serine Protease Inhibitor with a Novel Peptidomimetic Scaffold. A Master’s Degree Project in Medicinal Chemistry. [45] Chen, S.L. and T.R. Morgan. (2006). The natural history of hepatitis C virus (HCV) infection. Int J Med Sci, 3(2), 47-52. [46] Esteban, J.I., J.C. López-Talavera, J. Genescà, P. Madoz, L. Viladomiu, E. Muñiz, C. Martin-Vega, M. Rosell, H. Allende, and X. Vidal. (1991). High rate of infectivity and liver disease in blood donors with antibodies to hepatitis C virus. Annals of Internal Medicine, 115(6), 443-449. [47] Sharara, A.I., C.M. Hunt, and J.D. Hamilton. (1996). Hepatitis C. Annals of Internal Medicine, 125(8), 658-668. doi: 10.7326/0003-4819-125-8199610150-00006 [48] Kiyosawa, K., T. Sodeyama, E. Tanaka, Y. Nakano, S. Furuta, K. Nishioka, R.H. Purcell, and H.J. Alter. (1991). Hepatitis C in hospital employees with needlestick injuries. Annals of internal medicine, 115(5), 367-369.
71
[49] Ridzon, R., K. Gallagher, C. Ciesielski, E.E. Mast, M.B. Ginsberg, B.J. Robertson, C.-C. Luo, and A. DeMaria Jr. (1997). Simultaneous transmission of human immunodeficiency virus and hepatitis C virus from a needle-stick injury. New England Journal of Medicine, 336(13), 919922. [50] Krause, G., M.J. Trepka, R.S. Whisenhunt, D. Katz, O. Nainan, S.T. Wiersma, and R.S. Hopkins. (2003). Nosocomial transmission of hepatitis C virus associated with the use of multidose saline vials. Infection Control & Hospital Epidemiology, 24(02), 122-127. [51] Bruguera, M., J.-C. Saiz, S. Franco, M. Giménez-Barcons, J.M. SánchezTapias, S. Fabregas, R. Vega, N. Camps, A. Domínguez, and L. Salleras. (2002). Outbreak of nosocomial hepatitis C virus infection resolved by genetic analysis of HCV RNA. Journal of clinical microbiology, 40(11), 4363-4366. [52] Pereira, B.J., E.L. Milford, R.L. Kirkman, and A.S. Levey. (1991). Transmission of hepatitis C virus by organ transplantation. New England Journal of Medicine, 325(7), 454-460. [53] Terrault, N.A., T.L. Wright, and B. Pereira. (1995). Hepatitis C infection in the transplant recipient. Infectious disease clinics of North America, 9(4), 943-964. [54] Roberts, E.A. and L. Yeung. (2002). Maternal‐infant transmission of hepatitis C virus infection. Hepatology, 36(5B). [55] Skidmore, S.J., K.E. Collingham, and S.M. Drake. (1994). Brief report: sexual transmission of hepatitis C. Journal of medical virology, 42(3), 247-248. [56] Booth, J., G. Foster, U. Kumar, R. Galassini, R. Goldin, J. Brown, and H. Thomas. (1995). Chronic hepatitis C virus infections: predictive value of
72
genotype and level of viraemia on disease progression and response to interferon alpha. Gut, 36(3), 427-432. [57] Zein, N.N., J. Rakela, E.L. Krawitt, K.R. Reddy, T. Tominaga, and D.H. Persing. (1996). Hepatitis C virus genotypes in the United States: epidemiology, pathogenicity, and response to interferon therapy. Annals of internal medicine, 125(8), 634-639. [58] Dusheiko, G., H. Schmilovitz‐Weiss, D. Brown, F. McOmish, P.L. Yap, S. Sherlock, N. McIntyre, and P. Simmonds. (1994). Hepatitis C virus genotypes: an investigation of type‐specific differences in geographic origin and disease. Hepatology, 19(1), 13-18. [59] McOmish, F., P. Yap, B. Dow, E. Follett, C. Seed, A. Keller, T. Cobain, T. Krusius, E. Kolho, and R. Naukkarinen. (1994). Geographical distribution of hepatitis C virus genotypes in blood donors: an international collaborative survey. Journal of Clinical Microbiology, 32(4), 884-892. [60] Nousbaum, J.-B., S. Pol, B. Nalpas, P. Landais, P. Berthelot, and C. Brechot. (1995). Hepatitis C virus type 1b (II) infection in France and Italy. Annals of internal medicine, 122(3), 161-168. [61] Takada, N., S. Takase, A. Takada, and T. Date. (1993). Differences in the hepatitis C virus genotypes in different countries. Journal of hepatology, 17(3), 277-283. [62] Pawlotsky, J.-M., L. Tsakiris, F. Roudot-Thoraval, C. Pellet, L. Stuyver, J. Duval, and D. Dhumeaux. (1995). Relationship between hepatitis C virus genotypes and sources of infection in patients with chronic hepatitis C. Journal of Infectious Diseases, 171(6), 1607-1610. [63] Abdulkarim, A.S., N.N. Zein, J.J. Germer, C.P. Kolbert, L. Kabbani, K.L. Krajnik, A. Hola, M.N. Agha, M. Tourogman, and D.H. Persing. (1998). Hepatitis C virus genotypes and hepatitis G virus in hemodialysis patients 73
from Syria: identification of two novel hepatitis C virus subtypes. The American journal of tropical medicine and hygiene, 59(4), 571-576. [64] Chamberlain, R.W., N. Adams, A.A. Saeed, P. Simmonds, and R.M. Elliott. (1997). Complete nucleotide sequence of a type 4 hepatitis C virus variant, the predominant genotype in the Middle East. Journal of General Virology, 78(6), 1341-1347. [65] Sy, T. and M.M. Jamal. (2006). Epidemiology of hepatitis C virus (HCV) infection. Int J Med Sci, 3(2), 41-6. [66] Al Kubaisy, W., A. Niazi, and K. Kubba. (2002). History of miscarriage as a risk factor for hepatitis C virus infection in pregnant Iraqi women. Eastern Mediterranean Health Journal, 8(2/3), 239-244. [67] Omer, A.R., J.I. Salih, and A.A. Al-Nakshabandi. (2011). Frequency of blood-borne viral infections among leukemic patients in central Iraq. Saudi medical journal, 32(1), 55-61. [68] Fakeeh, M. and A.M. Zaki. (1999). Hepatitis C: prevalence and common genotypes among ethnic groups in Jeddah, Saudi Arabia. The American journal of tropical medicine and hygiene, 61(6), 889-892. [69] Fallahian, F. and A. Najafi. (2011). Epidemiology of hepatitis C in the Middle East. Saudi Journal of Kidney Diseases and Transplantation, 22(1), 1. [70] Khodabandehloo, M., D. Roushany, and K. Sayehmiri. (2013). Prevalence and trend of hepatitis C virus infection among blood donors in Iran: A systematic review and metaâ€‗analysis. Journal of Research in Medical Sciences, 18(8), 674-682. [71] Al Kubaisy, W., K. Al Naib, and M. Habib. (2006). Seroprevalence of hepatitis C virus specific antibodies among Iraqi children with thalassaemia. Eastern Mediterranean Health Journal, 12(1/2), 204-210.
74
[72] Abdullah, A.M., A. Hardan, and I.I. Latif. (2012). Genotyping of hepatitis C virus isolates from Iraqi hemodialysis patients by reverse transcriptionPCR and one step nested RT-PCR. Diyala Journal of Medicine, 3(1), 918. [73] Khalid, M.D. and B.A. Abdullah. (2012). Hepatitis C virus genotypes in Iraq. Iraqi Journal of Biotechnology, 11(2), 475-80. [74] Averhoff, F.M., N. Glass, and D. Holtzman. (2012). Global burden of hepatitis C: considerations for healthcare providers in the United States. Clinical Infectious Diseases, 55(suppl 1), S10-S15. [75] Abbas, Y.A., A.H. Aubaid, and B.J. Hamad. (2013). Determination of Hepatitis C Viral Load and Genotypes by Real-Time and RT-PCR at Thi_Qar Province. QMJ, 9(15). [76] Al-mola, G., H. Tarish, K.M. Abdulsada, and R.H. Lateef. (2013). Investigation of the Major HCV Genotype in Asymptomatic Patients in Iraq by the Use of Reverse-transcription PCR. International Journal of Scientific & Engineering Research, 4(12), 1306-1313. [77] Osoba, A.O. (2002). Hepatitis C virus genotypes in Saudi Arabia. Saudi medical journal, 23(1), 7-12. [78] Schreier, E., M. Roggendorf, G. Driesel, M. Hoehne, and S. Viazov, Genotypes of hepatitis C virus isolates from different parts of the world. 1996: Springer. [79] Tokita, H., H. Okamoto, H. Iizuka, J. Kishimoto, F. Tsuda, Y. Miyakawa, and M. Mayumi. (1998). The entire nucleotide sequences of three hepatitis C virus isolates in genetic groups 7-9 and comparison with those in the other eight genetic groups. Journal of general virology, 79(8), 1847-1857. [80] Kareem, B.O. and G.F. Salih. (2014). Hepatitis C virus genotyping in Sulaimani Governorate. European Scientific Journal, 10(15). 75
[81] Yildiz, E., A. Oztan, F. Sar, E. Pinarbasi, R. Cetin-Atalay, H. Akkiz, and M. Ozturk. (2002). Molecular characterization of a full genome Turkish hepatitis C virus 1b isolate (HCV-TR1): a predominant viral form in Turkey. Virus Genes, 25(2), 169-177. [82] Bdour, S. (2002). Hepatitis C virus infection in Jordanian haemodialysis units: serological diagnosis and genotyping. Journal of medical microbiology, 51(8), 700-704. [83] Alter, M.J., D. Kruszon-Moran, O.V. Nainan, G.M. McQuillan, F. Gao, L.A. Moyer, R.A. Kaslow, and H.S. Margolis. (1999). The prevalence of hepatitis C virus infection in the United States, 1988 through 1994. New England journal of medicine, 341(8), 556-562. [84] Bellentani, S. and C. Tiribelli. (2001). The spectrum of liver disease in the general population: lesson from the Dionysos study. Journal of hepatology, 35(4), 531-537. [85] Kenny-Walsh, E. (1999). Clinical outcomes after hepatitis C infection from contaminated anti-D immune globulin. New England Journal of Medicine, 340(16), 1228-1233. [86] Wiese, M., F. Berr, M. Lafrenz, H. Porst, and U. Oesen. (2000). Low frequency of cirrhosis in a hepatitis C (genotype 1b) single‐source outbreak in Germany: a 20‐year multicenter study. Hepatology, 32(1), 9196. [87] Jackowiak, P., K. Kuls, L. Budzko, A. Mania, M. Figlerowicz, and M. Figlerowicz. (2014). Phylogeny and molecular evolution of the hepatitis C virus. Infection, Genetics and Evolution, 21, 67-82. [88] Zein, N.N. (2000). Clinical significance of hepatitis C virus genotypes. Clinical microbiology reviews, 13(2), 223-235. [89] Cho, E.J., S.H. Jeong, B.H. Han, S.U. Lee, B.C. Yun, and E.T. Park. (2012). Hepatitis C virus (HCV) genotypes and the influence of HCV 76
subtype 1b on the progression of chronic hepatitis C in Korea: a single center experience. Clinical and molecular hepatology, 18(2), 219-224. [90] Han, C.J., H.-S. Lee, H.-S. Kim, J.H. Choe, and C.Y. Kim. (1997). Hepatitis C virus genotypes in Korea and their relationship to clinical outcome in type C chronic liver diseases. The Korean journal of internal medicine, 12(1), 21-27. [91] Yotsuyanagi, H., K. Koike, K. Yasuda, K. Moriya, K. Hino, K. Kurokawa, and S. Iino. (1995). Hepatitis C virus genotypes and development of hepatocellular carcinoma. Cancer, 76(8), 1352-1355. [92] Petruzziello, A., N. Coppola, A.M. Diodato, V. Iervolino, R. Azzaro, G. Di Costanzo, C.A. Di Macchia, T. Di Meo, G. Loquercio, and G. Pasquale. (2013). Age and gender distribution of hepatitis C virus genotypes in the metropolitan area of Naples. Intervirology, 56(3), 206212. [93] Lau, J.Y. and D.N. Standring. (2000). Development of novel therapies for hepatitis C. Hepatitis C. San Diego: Academic, 453-457. [94] Enomoto, N., I. Sakuma, Y. Asahina, M. Kurosaki, T. Murakami, C. Yamamoto, N. Izumi, F. Marumo, and C. Sato. (1995). Comparison of full-length sequences of interferon-sensitive and resistant hepatitis C virus 1b. Sensitivity to interferon is conferred by amino acid substitutions in the NS5A region. Journal of Clinical Investigation, 96(1), 224. [95] Gretch, D.R. (1997). Diagnostic tests for hepatitis C. Hepatology, 26(S3). [96] Pawlotsky, J.M. (2002). Use and interpretation of virological tests for hepatitis C. Hepatology, 36(S1), S65-S73. [97] Forns, X. and J. Costa. (2006). HCV virological assessment. Journal of Hepatology, 44, S35-S39. [98] Barrera, J.M., M. Bruguera, M.G. Ercilla, J.M. Sánchez-Tapias, M.P. Gil, C. Gil, J. Costa, A. Gelabert, J. Rodés, and R. Castillo. (1991). Incidence 77
of non-A, non-B hepatitis after screening blood donors for antibodies to hepatitis C virus and surrogate markers. Annals of internal medicine, 115(8), 596-600. [99] Gretch, D., W. Lee, and L. Corey. (1992). Use of aminotransferase, hepatitis C antibody, and hepatitis C polymerase chain reaction RNA assays to establish the diagnosis of hepatitis C virus infection in a diagnostic virology laboratory. Journal of clinical microbiology, 30(8), 2145-2149. [100] Alter, H.J. (1992). New kit on the block: Evaluation of second‐generation assays for detection of antibody to the hepatitis C virus. Hepatology, 15(2), 350-353. [101] Lok, A.S., D. Chien, Q.L. Choo, T.M. Chan, E.K. Chiu, I.K. Cheng, M. Houghton, and G. Kuo. (1993). Antibody response to core, envelope and nonstructural hepatitis C virus antigens: comparison of immunocompetent and immunosuppressed patients. Hepatology, 18(3), 497-502. [102] Barrera, J., B. Francis, G. Ercilla, M. Nelles, D. Achord, J. Darner, and S. Lee. (1995). Improved detection of anti‐HCV in post‐transfusion hepatitis by a third‐generation ELISA. Vox Sanguinis, 68(1), 15-18. [103] Colin, C., D. Lanoir, S. Touzet, L. Meyaud‐Kraemer, F. Bailly, and C. Trepo. (2001). Sensitivity and specificity of third‐generation hepatitis C virus antibody detection assays: an analysis of the literature. Journal of viral hepatitis, 8(2), 87-95. [104] Alborino, F., A. Burighel, F.-W. Tiller, J. van Helden, C. Gabriel, A. Raineri, R. Catapano, and H. Stekel. (2011). Multicenter evaluation of a fully automated third-generation anti-HCV antibody screening test with excellent sensitivity and specificity. immunology, 200(2), 77-83. 78
Medical microbiology and
[105] Younossi, Z. and J. McHutchison. (1996). Serological tests for HCV infection. Viral Hepatitis Rev, 2, 161-173. [106] Evans, C., L. Tobler, A. Polito, J. Stewart, D. Chien, J. Wilber, S. Quan, S. Delaney, G. Kuo, and M. Busch. (1992). Comparative evaluation of supplemental hepatitis C virus antibody test systems. Transfusion, 32(5), 408-414. [107] Pawlotsky, J.-M. (2003). Use and interpretation of hepatitis C virus diagnostic assays. Clinics in liver disease, 7(1), 127-137. [108] Simmonds, P. (1995). Variability of hepatitis C virus. Hepatology, 21(2), 570-583. [109] Yanagi, M., M.S. Claire, S.U. Emerson, R.H. Purcell, and J. Bukh. (1999). In vivo analysis of the 3′ untranslated region of the hepatitis C virus after in vitro mutagenesis of an infectious cDNA clone. Proceedings of the National Academy of Sciences, 96(5), 2291-2295. [110] Keck, Z.-Y., A.O. De Beeck, K.G. Hadlock, J. Xia, T.-K. Li, J. Dubuisson, and S.K. Foung. (2004). Hepatitis C virus E2 has three immunogenic domains containing conformational epitopes with distinct properties and biological functions. Journal of virology, 78(17), 92249232. [111] Vernelen, K., H. Claeys, H. Verhaert, A. Volckaerts, C. Vermylen, A.-M. Courouce, F. Bouchardeau, A. Girault, N. Marrec, and E. Goffin. (1994). Significance of NS3 and NS5 antigens in screening for HCV antibody. The Lancet, 343(8901), 853-854. [112] Firdaus, R., K. Saha, A. Biswas, and P.C. Sadhukhan. (2015). Current molecular methods for the detection of hepatitis C virus in high risk group population: A systematic review. World journal of virology, 4(1), 25. [113] Shiffman, M.L., A. Ferreira-Gonzalez, K.R. Reddy, R.K. Sterling, V.A. Luketic, R.T. Stravitz, A.J. Sanyal, C.T. Garrett, M. De Medina, and E.R. 79
Schiff. (2003). Comparison of three commercially available assays for HCV RNA using the international unit standard: implications for management of patients with chronic hepatitis C virus infection in clinical practice. The American journal of gastroenterology, 98(5), 1159-1166. [114] Barbeau, J.M., J. Goforth, A.M. Caliendo, and F.S. Nolte. (2004). Performance characteristics of a quantitative TaqMan hepatitis C virus RNA analyte-specific reagent. Journal of clinical microbiology, 42(8), 3739-3746. [115] Simmonds, P., A. Alberti, H.J. Alter, F. Bonino, D.W. Bradley, C. Brechot, J.T. Brouwer, S.W. Chan, K. Chayama, and D.S. Chen. (1994). A proposed system for the nomenclature of hepatitis C viral genotypes. Hepatology, 19(5), 1321-1324. [116] Hnatyszyn, H.J. (2004). Chronic hepatitis C and genotyping: the clinical significance of determining HCV genotypes. Antiviral therapy, 10(1), 111. [117] Furione, M., L. Simoncini, M. Gatti, F. Baldanti, M.G. Revello, and G. Gerna. (1999). HCV genotyping by three methods: analysis of discordant results based on sequencing. Journal of clinical virology, 13(3), 121-130. [118] Buckingham, L., Molecular diagnostics: Fundamentals, methods and clinical applications. 2011: FA Davis. 251-252. [119] Navas, S., I. Castillo, J. Martín, J.A. Quiroga, J. Bartolomé, and V. Carreno. (1997). Concordance of hepatitis C virus typing methods based on restriction fragment length polymorphism analysis in 5'noncoding region and NS4 serotyping, but not in core PCR or a line probe assay. Journal of clinical microbiology, 35(1), 317. [120] Daniel, H.D.J., J. David, S. Raghuraman, M. Gnanamony, G.M. Chandy, G. Sridharan, and P. Abraham. (2016). Comparison of Three Different Hepatitis C Virus Genotyping Methods: 5′ NCR PCR‐RFLP, Core Type‐ 80
Specific PCR, and NS5b Sequencing in a Tertiary Care Hospital in South India. Journal of Clinical Laboratory Analysis. doi: 10.1002/jcla.22045 [121] Thiers, V., F. Jaffredo, R. Tuveri, N. Chodan, and C. Bréchot. (1997). Development of a simple restriction fragment length polymorphism (RFLP) based assay for HCV genotyping and comparative analysis with genotyping and serotyping tests. Journal of virological methods, 65(1), 917. [122] Verachai, V., T. Phutiprawan, A. Theamboonlers, T. Chinchai, S. Tanprasert, B.L. Haagmans, A.D. Osterhaus, and Y. Poovorawan. (2002). Prevalence and genotypes of hepatitis C virus infection among drug addicts and blood donors in Thailand.
Southeast Asian Journal of
Tropical Medicine and Public Health, 33(4). [123] Casanova, Y.S., T.d.R. Boeira, E. Sisti, Á. Celmer, A.S.K. Fonseca, N. Ikuta, D. Simon, and V.R. Lunge. (2014). A complete molecular biology assay for hepatitis C virus detection, quantification and genotyping. Revista da Sociedade Brasileira de Medicina Tropical, 47(3), 287-294. [124] Ray, S.C., R.R. Arthur, A. Carella, J. Bukh, and D.L. Thomas. (2000). Genetic epidemiology of hepatitis C virus throughout Egypt. Journal of Infectious Diseases, 182(3), 698-707. [125] Yasmeen, A., A.A. Siddiqui, S. Hamid, T. Sultana, W. Jafri, and M.A. Persson. (2009). Genetic variations in a well conserved 5′-untranslated region of hepatitis C virus genome isolated in Pakistan. Journal of virological methods, 160(1), 38-47. [126] Chinchai, T., J. Labout, S. Noppornpanth, A. Theamboonlers, B.L. Haagmans, A.D. Osterhaus, and Y. Poovorawan. (2003). Comparative study of different methods to genotype hepatitis C virus type 6 variants. Journal of virological methods, 109(2), 195-201.
81
[127] Pohjanpelto, P., M. Lappalainen, A. Widell, K. Asikainen, and M. Paunio. (1996). Hepatitis C genotypes in Finland determined by RFLP. Clinical and diagnostic virology, 7(1), 7-16. [128] Pour, M.A., H. Keivani, F. Sabahi, and S. Alavian. (2006). Determination of HCV Genotypes in Iranian Isolates by PCR-RFLP. Iranian Journal of Public Health, 35(4), 54-61. [129] Hamidi, F.M., M. Makvandi, and E. Hajiani. (2009). Determination of HCV Genotypes among Chronic Hepatic Patients in Ahvaz. Iranian Journal of Virology, 3(2), 12-16. [130] Okamoto, H., S. Kobata, H. Tokita, T. Inoue, G.D. Woodfield, P.V. Holland, B.A. Al-Knawy, O. Uzunalimoglu, Y. Miyakawa, and M. Mayumi. (1996). A second-generation method of genotyping hepatitis C virus by the polymerase chain reaction with sense and antisense primers deduced from the core gene. Journal of virological methods, 57(1), 31-45. [131] Andonov, A. and R. Chaudhary. (1994). Genotyping of Canadian hepatitis C virus isolates by PCR. Journal of clinical microbiology, 32(8), 20312034. [132] Lau, J.Y., M. Mizokami, J.A. Kolberg, G.L. Davis, L.E. Prescott, T. Ohno, R.P. Perrillo, K.L. Lindsay, R.G. Gish, and K.-P. Qian. (1995). Application of six hepatitis C virus genotyping systems to sera from chronic hepatitis C patients in the United States. Journal of Infectious Diseases, 171(2), 281-289. [133] Mahaney, K., V. Tedeschi, G. Maertens, A.M. Di Bisceglie, J. Vergalla, J.H. Hoofnagle, and R. Sallie. (1994). Genotypic analysis of hepatitis C virus in American patients. Hepatology, 20(6), 1405-1411. [134] Spada, E., A. Ciccaglione, S. Dettori, P. Chionne, L. Kondili, P. Amoroso, V. Guadagnino, M. Greco, and M. Rapicetta. (1998). Genotyping HCV
82
isolates from Italy by type-specific PCR assay in the core region. Research in virology, 149(4), 209-218. [135] Stuyver, L., R. Rossau, A. Wyseur, M. Duhamel, B. Vanderborght, H. Van Heuverswyn, and G. Maertens. (1993). Typing of hepatitis C virus isolates and characterization of new subtypes using a line probe assay. Journal of General Virology, 74(6), 1093-1102. [136] Maertens, G. and L. Stuyver. (1997). Genotypes and genetic variation of hepatitis C virus. The molecular medicine of viral hepatitis, 183-233. [137] Smith, D.B., J. Mellor, L.M. Jarvis, F. Davidson, J. Kolberg, M. Urdea, P.-L. Yap, P. Simmonds, and I.H.C.S. Group. (1995). Variation of the hepatitis C virus 5′ non-coding region: implications for secondary structure, virus detection and typing. Journal of general virology, 76(7), 1749-1761. [138] Tsukiyama-Kohara, K., K. Yamaguchi, N. Maki, Y. Ohta, K. Miki, M. Mizokami, K.-i. Ohba, S. Tanaka, N. Hattori, and A. Nomoto. (1993). Antigenicities of Group I and II hepatitis C virus polypeptides— molecular basis of diagnosis. Virology, 192(2), 430-437. [139] Simmonds, P., K. Rose, S. Graham, S. Chan, F. McOmish, B. Dow, E. Follett, P. Yap, and H. Marsden. (1993). Mapping of serotype-specific, immunodominant epitopes in the NS-4 region of hepatitis C virus (HCV): use of type-specific peptides to serologically differentiate infections with HCV types 1, 2, and 3. Journal of clinical microbiology, 31(6), 14931503. [140] Mondelli, M.U., A. Cerino, F. Bono, A. Cividini, A. Maccabruni, M. Aricò, A. Malfitano, G. Barbarini, V. Piazza, and L. Minoli. (1994). Hepatitis C virus (HCV) core serotypes in chronic HCV infection. Journal of clinical microbiology, 32(10), 2523-2527.
83
[141] Machida, A., H. Ohnuma, F. Tsuda, E. Munekata, T. Tanaka, Y. Akahane, H. Okamoto, and S. Mishiro. (1992). Two distinct subtypes of hepatitis C virus defined by antibodies directed to the putative core protein. Hepatology, 16(4), 886-891. [142] Dixit, V., S. Quan, P. Martin, D. Larson, M. Brezina, R. DiNello, K. Sra, J. Lau, D. Chien, and J. Kolberg. (1995). Evaluation of a novel serotyping system for hepatitis C virus: strong correlation with standard genotyping methodologies. Journal of clinical microbiology, 33(11), 2978-2983. [143] Gish, R., K. Qian, S. Quan, Y. Xu, I. Pike, A. PoIito, R. DiNello, and J. Lau. (1997). Concordance between hepatitis C virus serotyping assays. Journal of viral hepatitis, 4(6), 421-422. [144] Beld, M., M. Penning, M. Van Putten, A. Van Den Hoek, V. Lukashov, M. McMorrow, and J. Goudsmit. (1998). Hepatitis C virus serotypespecific core and NS4 antibodies in injecting drug users participating in the Amsterdam cohort studies. Journal of clinical microbiology, 36(10), 3002-3006. [145] Songsivilai, S., D. Kanistanon, and T. Dharakul. (1998). A serotyping assay for hepatitis C virus in Southeast Asia. Clinical and diagnostic laboratory immunology, 5(5), 737-739. [146] Huang, C.-F., W.-L. Chuang, and M.-L. Yu. (2013). The Evolution of HCV Treatment in Taiwan. Current Hepatitis Reports, 12(3), 143-148. [147] Liang, T.J. and M.G. Ghany. (2013). Current and future therapies for hepatitis C virus infection. New England Journal of Medicine, 368(20), 1907-1917. [148] Vermehren, J. and C. Sarrazin. (2011). New HCV therapies on the horizon. Clinical Microbiology and Infection, 17(2), 122-134.
84
[149] Kiser, J.J., J.R. Burton, P.L. Anderson, and G.T. Everson. (2012). Review and management of drug interactions with boceprevir and telaprevir. Hepatology, 55(5), 1620-1628. [150] Izquierdo, L., F. Helle, C. François, S. Castelain, G. Duverlie, and E. Brochot. (2014). Simeprevir for the treatment of hepatitis C virus infection. Pharmacogenomics and personalized medicine, 7, 241. [151] Gritsenko, D. and G. Hughes. (2015). Ledipasvir/Sofosbuvir (harvoni): improving options for hepatitis C virus infection. Pharmacy and Therapeutics, 40(4), 256. [152] Cha, A. and A. Budovich. (2014). Sofosbuvir: a new oral once-daily agent for the treatment of hepatitis C virus infection. Pharmacy and Therapeutics, 39(5), 345. [153] Vermehren, J. and C. Sarrazin. (2012). The role of resistance in HCV treatment. Best practice & research Clinical gastroenterology, 26(4), 487-503. [154] Lawitz, E., A. Mangia, D. Wyles, M. Rodriguez-Torres, T. Hassanein, S.C. Gordon, M. Schultz, M.N. Davis, Z. Kayali, and K.R. Reddy. (2013). Sofosbuvir for previously untreated chronic hepatitis C infection. New England Journal of Medicine, 368(20), 1878-1887. [155] Bukh, J., R.H. Purcell, and R.H. Miller. (1992). Importance of primer selection for the detection of hepatitis C virus RNA with the polymerase chain reaction assay. Proceedings of the National Academy of Sciences, 89(1), 187-191. [156] Lee, P.Y., J. Costumbrado, C.-Y. Hsu, and Y.H. Kim. (2012). Agarose gel electrophoresis for the separation of DNA fragments. JoVE (Journal of Visualized Experiments)(62), e3923-e3923. [157] Jacobson, I.M., G.L. Davis, H. El–Serag, F. Negro, and C. Trépo. (2010). Prevalence and challenges of liver diseases in patients with chronic 85
hepatitis C virus infection. Clinical Gastroenterology and Hepatology, 8(11), 924-933. [158] Obied, H., M. Alrodhan, and M. Mallah. (2014). Molecular and immunological detection of hepatitis C virus infection among blood donors in Al-Muthanna province-Iraq. International Journal of Advanced Research, 2(6), 295-315. [159] Al-Kubaisy, W. (2012). Specific HCV antibodies, RNA, and genotypes detection correlated to the age of pregnant women in Iraq. International Journal of Infectious Diseases, 16, e67. [160] Alagöz, G.K., S.C. Karataylı, E. Karataylı, E. Çelik, O. Keskin, B. Dinç, K. Çınar, R. İdilman, C. Yurdaydın, and A.M. Bozdayı. (2014). Hepatitis C virus genotype distribution in Turkey remains unchanged after a decade: Performance of phylogenetic analysis of the NS5B, E1, and 5‘UTR regions in genotyping efficiency. Turk J Gastroenterol, 25, 405410. [161] Özturk, A.B., Ü.B. Dogan, N.A. Özturk, G. Özyazici, M. Demir, M.S. Akin, and A.S. Bingol. (2014). Hepatitis C virus genotypes in Adana and Antakya regions of Turkey. Turkish journal of medical sciences, 44(4), 661-665. [162] Rota, S., I. Fidan, Z. Lale, O. Kirisci, A. Dede, and I. Cekic. (2013). Determination of hepatitis C virus genotype in turkey by pyrosequencing technology and its associated with viral load and SGOT, SGPT levels. Acta Medica Mediterranea, 29, 397. [163] Yıldırım, D., M. Hasbek, S. Alkan, and N. Nur. Relationship Between HCV RNA and Serum Alanine Aminotransferase and HCV Genotype Distribution Hcv RNA ile Serum Alanın Aminotransferaz Düzeyi Arasındaki İlişki ve HCV Genotip Dağılımı.
86
[164] Sanlidağ, T., S. Akcali, B. Ozbakkaloğlu, D. Ertekin, and E. Akduman. (2009). [Distribution of hepatitis C virus genotypes in Manisa region, Turkey]. Mikrobiyoloji bulteni, 43(4), 613-618. [165] Tajbakhsh, E., A. Dosti, S. Tajbakhsh, M. Momeni, and F. Tajbakhsh. (2011). Determination of hepatitis C virus genotypes among HCV positive patients in Shahrekord, Iran. African Journal of Microbiology Research, 5(32), 5910-5915. [166] Kabir, A., S.-M. Alavian, and H. Keyvani. (2006). Distribution of hepatitis C virus genotypes in patients infected by different sources and its correlation with clinical and virological parameters: a preliminary study. Comparative Hepatology, 5(1), 1. [167] Sefidi, F.J., H. Keyvani, S.H. Monavari, S.M. Alavian, S. Fakhim, and F. Bokharaei-Salim. (2013). Distribution of hepatitis C virus genotypes in Iranian chronic infected patients. Hepatitis monthly, 13(1), e7991. [168] Samimi-Rad, K., F. Asgari, M. Nasiritoosi, A. Esteghamati, A. Azarkeyvan, S.M. Eslami, F. Zamani, L. Magnius, S.M. Alavian, and H. Norder. (2013). Patient-to-patient transmission of hepatitis C at Iranian thalassemia centers shown by genetic characterization of viral strains. Hepatitis monthly, 13(1), e7699. [169] Antaki, N., M. Haddad, K. Kebbewar, J. Abdelwahab, O. Hamed, R. Aaraj, N. Alhaj, S. Haffar, M. Assil, and M. Ftayeh. (2009). The unexpected discovery of a focus of hepatitis C virus genotype 5 in a Syrian province. Epidemiology and infection, 137(01), 79-84. [170] Shobokshi, O.A., F.E. Serebour, L. Skakni, Y.H. Al‐Saffy, and M.N. Ahdal. (1999). Hepatitis C genotypes and subtypes in Saudi Arabia. Journal of medical virology, 58(1), 44-48.
87
[171] Ramia, S. and J. Eid-Fares. (2006). Distribution of hepatitis C virus genotypes in the Middle East. International Journal of Infectious Diseases, 10(4), 272-277. [172] McOmish, F., S. Chan, B. Dow, J. Gillon, W. Frame, R. Crawford, P. Yap, E. Follett, and P. Simmonds. (1993). Detection of three types of hepatitis C virus in blood donors: investigation of type‐specific differences in serologic reactivity and rate of alanine aminotransferase abnormalities. Transfusion, 33(1), 7-13. [173] Bhattacherjee, V., L. Prescott, I. Pike, B. Rodgers, H. Bell, A. El-Zayadi, M. Kew, J. Conradie, C. Lin, and H. Marsden. (1995). Use of NS-4 peptides to identify type-specific antibody to hepatitis C virus genotypes 1, 2, 3, 4, 5 and 6. Journal of General Virology, 76(7), 1737-1748. [174] Silini, E. and M. Mondelli. (1995). Significance of hepatitis C virus genotypes. Viral Hepat Rev, 1, 111-120. [175] Manos, M.M., V.A. Shvachko, R.C. Murphy, J.M. Arduino, and N.J. Shire. (2012). Distribution of hepatitis C virus genotypes in a diverse US integrated health care population. Journal of medical virology, 84(11), 1744-1750. [176] Viazov, S., S. Kuzin, N. Paladi, M. Tchernovetsky, E. Isaeva, L. Mazhul, F. Vasychova, A. Widell, and M. Roggendorf. (1997). Hepatitis C virus genotypes in different regions of the former Soviet Union (Russia, Belarus, Moldova, and Uzbekistan). Journal of medical virology, 53(1), 36-40. [177] Osella, A.R., L. Sonzogni, A. Cavallini, L. Foti, V. Guerra, A. Di Leo, M.U. Mondelli, G. Misciagna, and E.M. Silini. (1999). Molecular epidemiology of hepatitis C virus infection in an area of hyperendemicity in southern Italy: a population-based study. Journal of clinical microbiology, 37(7), 2371-2372. 88
[178] Gower, E., C. Estes, S. Blach, K. Razavi-Shearer, and H. Razavi. (2014). Global epidemiology and genotype distribution of the hepatitis C virus infection. Journal of hepatology, 61(1), S45-S57. [179] Pol, S., V. Thiers, J.-B. Nousbaum, C. Legendre, P. Berthelot, H. Kreis, and C. Brechot. (1995). The changing relative prevalence of hepatitis C virus genotypes: evidence in hemodialyzed patients and kidney recipients. Gastroenterology, 108(2), 581-583. [180] Silini, E., F. Bono, A. Cividini, A. Cerino, A. Maccabruni, C. Tinelli, S. Bruno, A. Bellobuono, and M.U. Mondelli. (1995). Molecular epidemiology of hepatitis C virus infection among intravenous drug users. Journal of hepatology, 22(6), 691-695. [181] Benani, A., J. El‐Turk, S. Benjelloun, S. Sekkat, S. Nadifi, N. Hda, and A. Benslimane. (1997). HCV genotypes in Morocco. Journal of medical virology, 52(4), 396-398. [182] Cacoub, P., V. Ohayon, S. Sekkat, B. Dumont, A. Sbai, F. Lunel, A. Benslimane, P. Godeau, and M. Archane. (2000). [Epidemiologic and virologic study of hepatitis
C
virus
infections
in
Morocco].
Gastroenterologie clinique et biologique, 24(2), 169-173. [183] Djebbi, A., H. Triki, O. Bahri, I. Cheikh, A. Sadraoui, A.B. Ammar, and K. Dellagi. (2003). Genotypes of hepatitis C virus circulating in Tunisia. Epidemiology and infection, 130(03), 501-505. [184] Argentini, C., S. Dettori, U. Villano, V. Guadagnino, D. Infantolino, P. Dentico,
R.C.
Coppola,
and
M.
Rapicetta.
(2000).
Molecular
characterisation of HCV genotype 4 isolates circulating in Italy. Journal of medical virology, 62(1), 84-90. [185] Matera, G., A. Lamberti, A. Quirino, D. Focà, A. Giancotti, G.S. Barreca, V. Guadagnino, and M.C. Liberto. (2002). Changes in the prevalence of
89
hepatitis C virus (HCV) genotype 4 in Calabria, Southern Italy. Diagnostic microbiology and infectious disease, 42(3), 169-173. [186] Lyra, A.C., S. Ramrakhiani, B.R. Bacon, and A.M. Di Bisceglie. (2004). Infection with hepatitis C virus genotype 4 in the United States. Journal of clinical gastroenterology, 38(1), 68-71.
90
اخلالصُ ٍدفت الدزاسة احلالٔة اىل حتدٓد النين النْزا ٕ لينآسّل البَناك اللسند يفسنٕ مسسقا اصاببَه باليآسل املركْز بْاسطة تقئة يفqPCR
27مسٓضنا ّالنش صت نت
مدٓية السنئناىٔة قلينٔه كستسنباٌ القنساقد لقند
أظَست مجٔع القٔيات يف %011ىبائج مْجسة عيد قسبتداو تقئة يف RT-Nested PCRد مت اجساء فحص يف RFLPلبحدٓد الين الْزا ٕ لييآسّل لدى 72مسٓض حٔث مت ٍظه يف 174 bpمنً يف 5´UTRمننً املنناتِ الْزا ٔ نة فننسّل HCVبْاسننطُ ازىاتننات القا(قننُ يف ScrFI, HinFI BstNI, ّ , BstUIكاىت اليبائج بالشنل البنالٕا النين اليسعنٕ يف 1aكناٌ اككرنس تنْاتسا نه تنالِ ازطنال الْزا ٔنة 5 يف , %07.22النين اليسعنٕ 3aيف , %1..0النين اليسعنٕ 1bيف , %7.02النين اليسعنٕ 2aيف ّ %7.02النين الْزا ٕ 6يف %7.02د أسبيبجت ٍرِ الدزاسة أٌ الين الْزا ٕ اليسعٕ يف ٍْ 1aأكرس مً بن اكطنال ازىنسى ّّفقنا لينقازىنة منع ىبائج أىسى ىي ت ٍرِ السٔاىات قىل أٌ الين الشائع السئناىٔة ٓشسُ الين املْجْت ك مً تسكٔنا ّ قٓنساٌ ّ مقظه بيداٌ أّزّبا باإلظافنة اىل أمسٓلنا الشننالٔة, القسبٔةد
حن أىَنا عبينل عنً النين املبْاجند أفسٓقنا ّ الندّل
البينٔ الْزا ٕ ليسّل البَاك اللسد يفسٕ بالبَاك اللسد اليسّل
املسضى امل اب
ذلافظة السئناىٔة
زسالة مقدمة اىل دليس كئة القيْو
جامقة السئناىٔة
كجاء مً مبطيسات ىٔ صَاتة ماجسبس عيْو عيْو احلٔاة يفعيه اكحٔاء الدلٔقة
مً لس بةرٍةو قاصه حمنود بلالْزْٓل
عيْو احلٔاة يف , ٠٢٠٢جامقة السئناىٔة
باصساف تد صةٍةىد كنال الدًٓ عازف اسباذ مساعد
زجب 8341
مازت 7182
ثوختة بؤ دياريكزدىى بةربآلوى بؤماوةضةشيةكاىى ظايزؤصى ٍةوكزدىى جطةرى جؤرى صى لة ىيَواٌ حةفتا و دوو ىةخؤشى تووشبووى ثيَصرت دةصتييصااىكزاو باة ظايزؤصاةكة لةصاةر بياةماى )Real Time - PCRلاة شاارى صميَناىىٍ-ةريَنى كوردصاتاٌ -عيَازا ,ووىاةى خاويًَ كؤكزاياةوة و جةختكزاياةوة كاة تووشابووى ىةخؤشايةكةٌ لةريَى ) .reverse transcriptase nested polymerase chain reaction (RT-Nested PCRبؤ بؤماوةضةشااايةكارى تاااةكييكى )Restriction Fragment Length Polymorphism (RFLP بةكارٍيَياادرا بااؤ 58ووىااة لةصااةر )174 bpثارضااةى فزةٍيَياادكزاو بااة )RT-Nested PCRلااةىاو ) )5´untranslated region (5´UTRباة باةكارٍيَياىى ضاوار ئاةىشىى صايورداركزدٌ
restriction
.)ScrFI, HinfI, BstNI, BstUI )enzymesلةىاو ئةو 58ووىةيةدا بؤماوةضةشيةكاٌ دابةشبووبووٌ بة شيَوةى )%83.45 45بؤ ىينضة ضةشيى )%13.88 7 )1aبؤ بؤماوةضةشيى )%9.61 5 5بؤ ىينضة ضةشيى )%3.14 1 )3aبؤ ىينضة ضةشيى )%13.14 1 )1bبؤ ىينضاة ضةشايى )%3.14 1 )2aباؤ بؤماوة ضةشيى .6بة بةراوردكزدىى داتاكاىى ئةو تويَذييةوةية لةطةأل دؤسييةوةكاىى تزدا دةركةوت كة شيَواسى دابةشبووىى بؤماوةضةشيةكاىى ظايزؤصى ٍاةوكزدىى جطاةرى جاؤرى )Cلةواىاةى توركياا و ئيَازاٌ و سؤرباةى والَتة ئةورووثيةكاٌ و بااكوورى ئاةمزيكا دةضايَة لاةكاتيَكا جيااواسة لاة شايَواسى دابةشابووىةكةى لاة ئاةفزيكا و وآلتة عةرةبيةكاٌ.
بؤماوةضةشيكارى ظايزؤصى ٍةوكزدىى جطةرى جؤرى )Cلة تووشبواىى ظايزؤصةكة لةثاريَشطاى صميَناىى
ىامةيةكة ثيَصكةش كزاوة بة ئةجنومةىي كؤليَجى ساىضة لة ساىكؤى صميَناىى وةك بةشيَك لة ثيَداويضتييةكاىي بةدةصتَيَياىى بزِواىامةى ماصتةرى لة ساىضتى بايوَلؤجى مايكزؤبايؤلؤجى)
لةاليةٌ بةرٍةو قاصه حمنود بةكالوَريوَس لة بايوَلوَجى ) ، (٠٢٠٢ساىكوَى صميَناىى
بة صةرثةرشيت د .صةٍةىد كنال الديً عارف ثزؤفيضؤرى ياريدةدةر
١٧٢٧ىةورؤس
١٠٢٧مارت
