Articles in PresS. Am J Physiol Regul Integr Comp Physiol (December 24, 2008). doi:10.1152/ajpregu.90490.2008

REACTIVE OXYGEN SPECIES-DEPENDENT ENDOTHELIN SIGNALING IS REQUIRED FOR AUGMENTED HYPOXIC SENSORY RESPONSE OF THE NEONATAL CAROTID BODY BY INTERMITTENT HYPOXIA

1,2

2

2

2

2

Anita Pawar , Jayasri Nanduri , Guoxiang Yuan , Shakil A. Khan , Ning Wang , Ganesh 2

1,2

K. Kumar and Nanduri R. Prabhakar 1 2

Department of Physiology and Biophysics, Case Western Reserve University, Cleveland, OH.

Center for Systems Biology of O2 Sensing, Department of Medicine, University of Chicago, Chicago, IL.

Running title: ET-1, ROS and Neonatal Carotid Body Function

Address for Correspondence: Nanduri R. Prabhakar Center for Systems Biology of O2 Sensing Department of Medicine The University of Chicago 5841 S. Maryland Avenue Chicago, Illinois 60637 USA Tel: (773) 834-5480 Fax: (773)834-5252 email: [email protected]

1 Copyright © 2008 by the American Physiological Society.

ABSTRACT We previously reported that intermittent hypoxia (IH) augments hypoxic sensory response (HSR) and increases the number of glomus cells in neonatal carotid bodies. In the present study, we tested the hypothesis that recruitment of endothelin-1 (ET-1) signaling by reactive oxygen species (ROS) plays a critical role in IH-evoked changes in neonatal carotid bodies. Experiments were performed on neonatal rats exposed either to 10 days of IH (P0–P10; 8 h/day) or to normoxia. IH augmented hypoxic sensory response (HSR) of the carotid bodies ex vivo and resulted in hyperplasia of glomus cells. The effects of IH were associated with enhanced basal release of ET-1 under normoxia, sensitization of carotid body response to exogenous ET-1, and up-regulation of ETA but not an ETB receptor mRNA without altering the ET-1 content. An ETA but not ETB receptor antagonist prevented augmented HSR by IH. ROS levels were elevated in carotid bodies from IH treated rat pups as evidenced by increased levels of malondialdehyde. Systemic

administration

of

manganese

(III)

tetrakis

(1-methyl-4-pyridyl)

porphyrin

pentachloride (MnTMPyP; 5 mg/kg; IP), a scavenger of O2•–, prevented IH-induced elevation of ROS, basal release of ET-1, up-regulation of ETA mRNA, and augmented HSR. In striking contrast, MnTMPyP treatment had no significant effect on IH-induced hyperplasia of glomus cells. These results demonstrate that IH-evoked increase in HSR involves a ROS-mediated increase in basal ET-1 release as well as up-regulation of ETA receptor mRNA. KEYWORDS: Recurrent apneas; premature infants; chemoreflex; arterial chemoreceptors; chronic intermittent hypoxia.

2

INTRODUCTION Nearly 70% of prematurely born infants exhibit recurrent apneas (17), which are characterized by repetitive cessations of breathing (~two breaths duration) leading to periodic decreases in arterial blood O2 or intermittent hypoxia (IH). Infants having a more number of apneas exhibit greater hypoxic ventilatory response (HVR) than those having a lesser number of apneas and the enhanced HVR was attributed to augmented peripheral chemoreceptor reflexes from the carotid bodies, the principal sensory organs for detecting changes in arterial blood O2 (12). Studies on neonatal rat pups showed that IH augments the hypoxic sensory response (HSR) of the carotid body and HVR (13, 16). The effects of IH on neonatal carotid bodies were associated with increased number of glomus cells (13), the putative hypoxia sensing cells in the chemoreceptor tissue. However, the mechanisms associated with IH-evoked augmented HSR and hyperplasia of glomus cells in neonatal carotid bodies has not been examined. In adult rats, IH increase reactive oxygen species (ROS) in the carotid body and antioxidant treatment prevented IH-evoked increases in HSR (14, 15). Glomus cells of the carotid body express a variety of neurotransmitters/modulators which play important roles in hypoxic sensing/signaling (18). In adult rat carotid bodies endothelin-1 (ET-1) is expressed in few glomus cells and IH up-regulates ET-1 expression in glomus cells (20). Bosentan, an ET-1 receptor antagonist, prevented IH-induced sensitization of the HSR (20). In the present study we tested the hypothesis that ROS-dependent up-regulation of ET-1 signaling is important for IH-induced increase in HSR and hyperplasia of glomus cells in neonatal rat carotid bodies. Our results demonstrate that IH increases ROS in neonatal carotid bodies, and ROS-dependent up-regulation of ET-1 release and ETA receptors contribute to the IH-induced increase in HSR but not to the hyperplasia of glomus cells.

3

MATERIALS AND METHODS Experimental protocols were approved by the Institutional Animal Care and Use Committee of the University of Chicago. Experiments were performed on neonatal (P0 - P10) Sprague-Dawley rat pups. Exposure to intermittent hypoxia (IH) Rat pups (~ 2-6 h of age) along with their mothers were housed in feeding cages and exposed to IH as described previously (16). Briefly, cages were placed in a specialized chamber which was flushed with alternating cycles of nitrogen gas and room air. During hypoxia, the inspired O2 level reached a nadir of 5% O2 and was maintained at this level for 15 sec. This was followed by room air (21% O2), which was maintained for 5 min. The gas flows were regulated by timercontrolled solenoid valves. Animals were exposed to IH every day between 9:00 am and 5:00 pm (9 episodes/hour; 8 hours/day). Ambient O2 and CO2 levels in the chamber were monitored continuously. Ambient CO2 levels in the chamber were maintained between 0.2 and 0.5%. Control experiments were performed on neonatal rats exposed to alternating cycles of room air instead of hypoxia in the same chamber. In experiments where the potential contribution of ROS was examined, rats were given manganese (III) tetrakis (1-methyl-4-pyridyl) porphyrin pentachloride (MnTMPyP; Alexis Biochemicals, CA, USA; 5 mg kg-1 day-1 IP) every day prior to exposing them to IH or normoxia. Control experiments were performed on rats exposed to IH or normoxia treated with vehicle instead of MnTMPyP. Acute experiments were performed after 6-10 h following either IH or normoxia. Measurement of malondialdehyde (MDA) levels Carotid bodies were homogenized in 10 vol of 20 mM phosphate buffer (pH 7.4) at 4 °C. MDA levels were analyzed in supernatants as described previously (19). Briefly, 12.5 μl of sample or

4

the calibration standard, MDA was added to 6.25 μl of 8.1% (w/v) SDS, 47 μl of 20% (v/v) acetic acid and 47 μl of 0.8% (w/v) thiobarbituric acid. The samples were heated for 60 min followed by incubation for 10 min at room temperature, and centrifuged at 3000 x g for 15 min. The supernatant was removed and the absorbance of the solution was monitored at 532 nm. The results were expressed as nanomoles of MDA formed per mg of protein. Measurement of carotid body sensory activity Sensory activity from ex vivo carotid bodies was recorded as described previously (13). Briefly, carotid bodies along with the sinus nerves were harvested from anaesthetized neonatal rats (Urethane; 1.2g/kg; IP), placed in a recording chamber (250 µl volume) and superfused with physiological saline (350C) at a rate of 2 ml min-1. The composition of the medium was (mM): NaCl (125), KCl (5), CaCl2 (1.8), MgSO4 (2), NaH2PO4 (1.2), NaHCO3 (25), D-glucose (10), sucrose (5), and the solution was bubbled with 95% O2 – 5% CO2. To facilitate recording of clearly identifiable action potentials, the sinus nerve was treated with 0.1% collagenase for 5 min. Action potentials (2–5 active units) were recorded from one of the nerve bundles with a suction electrode and stored in a computer via an A/D translation board (PowerLab/8P, AD Instruments, Australia). The criteria for chemoreceptor activity include increased sensory activity in response to hypoxia (~ 30 Torr) and return to baseline after resuming the superfusion with O2 enriched medium. ‘Single’ units were selected based on the height and duration of the individual action potentials using a spike discrimination program (Spike Histogram Program, Power Laboratory, AD Instruments). In each carotid body, at least two chemoreceptor units were analyzed. The PO2 and PCO2 of the superfusion medium were determined by a blood gas analyzer (ABL 5, Radiometer, Copenhagen, Denmark).

5

Immunocytochemical and morphometric analysis of the carotid body The protocols for fixation of carotid bodies were essentially the same as described previously (13). Briefly, carotid bifurcations were harvested from anesthetized rat pups (Urethane 1.2g/kg, IP), placed in 4% paraformaldehyde for 4h at room temperature, washed in PBS, and cryoprotected in 30% sucrose/PBS at 4°C for 24h. Tissue specimens were frozen in OCT compound (Tissue Tek, VWR Scientific), serially sectioned at a thickness of 8 μm and stored at 80°C. For immunocytochemical analysis, carotid body sections were washed three times in PBS, and exposed to 20% normal goat serum and 0.2% Triton X-100 in PBS for 30 minutes followed by incubation with the monoclonal mouse anti-tyrosine hydroxylase (1:2000, Sigma, USA) or polyclonal rabbit anti-bovine SP-1/Chromogranin A (1:2000, DiaSorin Inc, MN, USA) or polyclonal rabbit anti-ET-1 (1:200, Peninsula Laboratories) in PBS with 1% normal goat serum and 0.2% Triton X-100. After washing with PBS, sections were incubated for 1h with FITC conjugated goat anti-mouse IgG (1:250, Molecular Probes, Oregon, USA) or Texas Red conjugated goat anti-rabbit IgG (1:250, Molecular Probes, Oregon, USA) in PBS with 1% normal goat serum and 0.2% Triton X-100. After washing with PBS, sections were mounted in DAPI containing media and visualized using a fluorescent microscope (Eclipse E600, Nikon). Specificity of the ET-1 staining was determined by incubations of sections with ET-1 antibody pretreated with an excess of ET-1 peptide. For morphometric analysis, carotid body morphology and glomic volume were analyzed in sections from age matched control and IH pups using IMAGE software (Scion, Frederick, MD). For estimation of the number of glomus cells, cells stained positive for either tyrosine hydroxylase or chromogranin A and DAPI (nuclear staining) were counted using a mechanical cell counter in NIH Image J software program.

6

Measurements of ET-1 content and release For measurements of ET-1 content, carotid bodies were harvested from anesthetized rat pups and homogenized in 10 vol of a mixture of 1 M acetic acid/ 20 mM HCl. The homogenate was boiled at 100oC and centrifuged at 13, 000 x g for 10 min at 40C. The supernatant was removed and stored at -80oC until further analysis. The protocols for assessing the ET-1 release from the carotid bodies were essentially the same as described previously (7). Briefly, carotid bodies harvested from anaesthetized rat pups were incubated in 100µl of Ca2+/Mg2+ free Krebs ringer bicarbonate (KRB) medium pre-equilibrated with 95% O2 – 5% CO2 (hyperoxia) for 30 min at 40C. Subsequently, tissues were transferred to a reaction vial and incubated at 370C with 60µl of normal KRB medium equilibrated with appropriate gas mixtures (containing 5% CO2) resulting in medium PO2 of either 150±3 mmHg (normoxia) or 35±2 mmHg (hypoxia) for 30 minutes respectively. The medium and the carotid bodies were removed and stored at -800C until further analysis. ET-1 levels were determined with a commercially available ET-1 enzyme immunoassay (EIA) kit (Assay Designs, Michigan, USA) following manufacturer’s instructions. All measurements were performed in duplicate. The detection limit of EIA was 0.41 pg/ml. ET-1 levels were expressed as pg/mg of protein in content experiment and as pg/mg/min for release studies. Protein content was determined by Bio-Rad DC protein assay using bovine serum albumin as the standard. Measurements of mRNA expression in the carotid body Carotid bodies were harvested from anesthetized rat pups, homogenized and RNA was extracted using TRIZOL (Invitrogen) according to the manufacture’s instructions. For reverse transcriptase polymerase chain reaction (RT-PCR), 1µl of RNA was reverse transcribed using superscript III reverse transcriptase (Invitrogen). Primer sequences for RT-PCR amplification were as follows:

7

ET-1

(377bp):

forward

TCCAAGCGTTGCTCCTGCTC

GTTGCTGATGGCCTCCAACC,

ETA

receptor

(570

and bp):

reverse forward

GAAGTCCTCGGTGGGGATCA and reverse CCGATGTAATCCATGAGCAG, ETB (475 bp) receptor:

forward

TTCACCTCAGCAGGATTCTG

AGGTGTGGAAAGTTAGAACG, ACCACAGTCCATGCCATCAC

GAPDH and

reverse

(452

and bp):

TCCACCACCCTGTTGCTGTA.

reverse forward Initial

denaturation was performed at 940C for 2 min followed by an amplification phase of 35 cycles: 940C for 90s, 540C for 60s and 720C for 90s. A final extension was carried out at 720C for 7 min. PCR products were analyzed by gel electrophoresis on a 1% agarose gel stained with ethidium bromide. Band intensities were quantified using IMAGE software (Scion, Frederick, MD). Primer sequences for real time RT-PCR amplification were as follows: ET-1 (133 bp): forward CCGAGCCCAAAGTACCATGC and reverse GCTGATGGCCTCCAACCTTC, ETA receptor (119

bp):

forward

CTCGACGCTGCTTGAGGTGT,

CTTCTGCATGCCCTTGGTGT ETB

(117

bp)

and

reverse

receptor:

forward

AAGTCGTGTTTGTGCTGCTGGTG and reverse GCTGGAGCGGAAGTTGTCGT. 18S rRNA (151

bp):

forward

GTAACCCGTTGAACCCCATT

and

reverse

CCATCCAATCGGTAGTAGCG. Real-time PCR was carried out using a MiniOpticon system (Bio-Rad Laboratories, Hercules, California, USA) with SYBR green as a fluorogenic binding dye (Invitrogen). The reactions were incubated at 500C for 2 min (action of uracil DNA glycosylase ), then at 950C for 8 min and 30 seconds (uracil DNA glycosylase inactivation and DNA polymerase activation), followed by 40 two-step cycles of 15 sec at 950C and 1 min at 600C. The products were analyzed by Opticon MonitorTM software, using a standard curve. The values were normalized to its 18S rRNA. Purity and specificity of all products were confirmed

8

by omitting the template and by appropriate size and single melting temperature. Experimental protocols Series 1. MDA levels (index of ROS) were determined in carotid bodies harvested from control (normoxia), IH, control + MnTMPyP and IH + MnTMPyP treated pups (n = 3 experiments in each group run in duplicate and 3 carotid bodies/experiment). Series 2. Carotid body sensory response to graded hypoxia (medium PO2 = 139±4; 70±5; 34±4 mmHg and PCO2= 36±3 mmHg) was determined in control, IH and IH + MnTMPyP treated rat pups (n = 7-8 carotid bodies from 4 pups from three different litters). Each level of hypoxia was maintained for 5 min followed by a recovery period of 5min. Series 3. Morphometric analysis of carotid bodies was performed on control, IH and IH + MnTMPyP treated rat pups (n = 6 carotid bodies from 3 pups in each group) with two established markers of glomus cells; tyrosine hydroxylase and chromogranin A (9, 10). Series 4. ET-1-like immunoreactivity in carotid body from control and IH-conditioned rat pups was determined (n = 3 pups in each group). Series 5. ET-1 content of the carotid bodies was analyzed in control and IH exposed rat pups by EIA (n = 3 experiments run in duplicate; 10 carotid bodies/experiment). Series 6. Basal and acute hypoxia evoked release of ET-1 from carotid bodies from control, IH and IH + MnTMPyP treated rat pups was determined by EIA (n = 4 experiments each; 5 carotid bodies/experiment). Series 7. In this series the effects of exogenous administration of ET-1 on HSR of the carotid body from control and IH exposed rat pups were examined. HSR was recorded in presence of vehicle or increasing concentrations of ET-1 (10-15–10-11M). Carotid bodies were superfused for 5min with each concentration of ET-1 prior to the hypoxic challenge (n = 6 carotid bodies in each group). The concentrations of ET-1 were chosen from preliminary experiments. Series 8. mRNA levels of pre-pro ET-1, ETA, ETB receptor and GAPDH (house keeping gene) were determined by RT-PCR as well as by real time

9

RT-PCR in carotid bodies harvested from rat pups exposed to normoxia, IH and IH + MnTMPyP (3 individual experiments each; n = 10 carotid bodies/experiment). Series 9. The effect of BQ610 (an ETA antagonist) on carotid body response to graded hypoxia was determined. In the initial experiments (n = 4) the effects of increasing concentrations of BQ-610 (30 nM, 100 nM, 300 nM, 1 μM and 3 μM) on sensory response to hypoxia (medium PO2 = 32±2 mmHg) were determined in IH exposed neonatal carotid bodies. BQ-610 prevented IH-evoked augmentation of HSR in a dose-dependent manner and maximal effect was seen with 1μM. Increasing the BQ610 concentration to 3μM had no further attenuating effect on the HSR compared to 1μM. Based on these observations, 1μM of BQ-610 was chosen to examine the carotid body response to graded isocapnic hypoxia in IH and control rat pups (n = 7 carotid bodies from 7 pups). The results were compared with the effects of equimolar concentrations of BQ-788 (1μM), an ETB antagonist on the HSR of the IH exposed carotid body (n = 7 carotid bodies). Data Analysis Carotid body sensory activity (discharge from ‘single’ units) was analyzed every 10 sec for 5 min at baseline as well as during the entire period of hypoxia, and the data were averaged and expressed as impulses/sec. The data were analyzed as absolute values or delta imp/sec (i.e., hypoxia − baseline activity). All data are presented as mean ± S.E.M. Statistical significance was assessed by two-way ANOVA with repeated measures followed by Tukey's test. p < 0.05 were considered significant.

10

RESULTS ROS mediates IH-induced augmented HSR but not the morphological changes in the carotid body MDA levels were monitored in carotid bodies from IH and normoxia treated rat pups as an index of ROS (19). MDA levels were ~6 fold higher in IH-exposed carotid bodies compared to controls (p < 0.005) and MnTMPyP, a potent scavenger of O2•−, abolished this response (Fig. 1). To determine the involvement of ROS, we examined the effects of MnTMPyP on IH-evoked increase in HSR. To this end, the effects of graded hypoxia on the sensory response of the ex vivo carotid body were determined in IH exposed rat pups with and without treatment with MnTMPyP. Control experiments were performed on carotid bodies isolated from IH pups treated with vehicle (saline). As shown in Figure 2 HSR was augmented in IH treated carotid bodies compared to controls (i.e., carotid bodies from normoxia exposed pups) and MnTMPyP treatment abolished this response. The magnitude of the remaining HSR in IH rats treated with MnTMPyP was nearly the same as in the control carotid bodies harvested from rat pups reared under normoxia (Figure 2B). To test whether ROS contributes to IH-induced changes in the morphology of the carotid bodies morphometric analysis was performed on carotid bodies from control and IH-exposed rat pups with and without MnTMPyP treatment. Carotid bodies were stained for tyrosine hydroxylase (TH) or chromogranin A (CGA), established markers of glomus cells (9, 10). Both TH and CGA yielded qualitatively similar results. Therefore, results obtained with TH are summarized in Table 1. Glomic cell volume and the ratio of glomic volume to total cell volume, as well as the number of glomus cells (analyzed with DAPI+TH stained cells) were significantly increased in IH treated carotid bodies and MnTMPyP treatment had no significant effect on these variables (p

11

> 0.05; Table 1). Effect of IH on ET-1 expression in neonatal carotid bodies To begin to assess the role of ET-1 in IH-induced up-regulation of HSR, we first monitored ET1-like expression in carotid bodies from rat pups exposed to IH or normoxia. ET-1-like immunoreactivity was expressed in many glomus cells in the control carotid bodies as evidenced by co-localization with TH, a marker of glomus cells (Figure 3A). The specificity of ET-1 staining was confirmed by the absence of ET-1 staining following incubation of carotid body sections with ET-1 antibody treated with excess of ET-1 peptide prior to immunostaining (Figure 3A; right panel). In IH treated carotid bodies, ET-1 expression was comparable with control carotid bodies from rat pups reared under normoxia. Because, immunocytochemistry provides only qualitative information, ET-1 peptide levels were quantified in IH and control carotid bodies by enzyme based immunoassay (EIA). Control carotid bodies expressed substantial ET-1like peptide (23 ± 2 pg/mg of protein) and IH had no significant effect on carotid body ET-1 levels (25.7 ± 2.8 pg/mg of protein; Control vs. IH, p > 0.05; Figure 3B). Analysis of pre-pro ET1 mRNA expression in the carotid bodies by conventional RT-PCR revealed no significant differences between control and IH exposed tissues (Figure 3C), which was further confirmed by real time RT-PCR. IH augments ET-1 release from the carotid bodies We examined whether IH affects ET-1 release from the carotid body. Basal release of ET-1 under normoxia (medium PO2 = 150±3 mmHg) was 33% higher in IH compared to control carotid bodies (p < 0.005), which was absent in carotid bodies from IH exposed rat pups treated with MnTMPyP (Figure 4A). On the other hand, ET-1 release by acute hypoxia (medium PO2 = 35±2 mmHg) was comparable in control, IH and IH exposed rat pups treated with MnTMPyP

12

(Figure 4B; p > 0.05). IH sensitizes carotid body response to exogenous ET-1 Previous study reported that exogenous ET-1 potentiates HSR without altering the baseline activity in adult rabbit carotid body (2). The following experiments were performed to assess whether IH affects the potentiating effects of ET-1 on HSR. In these experiments the effects of increasing concentrations of ET-1 were examined on carotid body sensory response to moderate hypoxia (medium PO2 = ~60 mmHg), because severe hypoxia might saturate the sensory response confounding interpretation of results. In control carotid bodies, hypoxia augmented the sensory activity by +2.2±0.6imp/sec. ET-1 had no effect on HSR at 10-15M; whereas at 10-12M, it significantly augmented HSR without altering the baseline activity (Figure 5A; left panel). Increasing ET-1 concentration to 10-11M, however, attenuated HSR. In contrast, in IH exposed carotid bodies comparable levels of hypoxia evoked a greater HSR compared to controls and 1015

M ET-1 evoked small but significant potentiation of HSR (figure 5; right panels). Increasing

ET-1 concentrations to either 10-12M or 10-11M attenuated HSR in IH treated carotid bodies (Figure 5B). IH up-regulates ETA but not ETB receptor mRNA in neonatal carotid bodies Biological actions of ET-1 are mediated by ETA and ETB receptors (21). To determine whether IH influences ET-1 receptors, ETA and ETB receptor mRNA expression was analyzed in control and IH carotid bodies by RT-PCR. ETA receptor mRNA expression was ~3.5 fold higher in IH compared to controls (Figure 6). This increase in ETA mRNA was not seen in IH carotid bodies treated with MnTMPyP. On the other hand, ETB receptor mRNA expression levels were comparable in control, IH and IH + MnTMPyP treated carotid bodies (Figure 6). Quantitative real time RT-PCR approach was employed to further validate the results obtained with RT-PCR.

13

Real time RT-PCR analysis revealed that IH treatment increased ETA mRNA expression by 548% relative to controls. MnTMPyP treatment prevented IH-induced up-regulation of ETA mRNA expression (41% increase). Similar to the data with RT-PCR approach, IH had no significant effect on ETB mRNA expression. ETA but not ETB receptor antagonist prevents IH-induced up-regulation of HSR The effects of BQ-610, an ETA receptor antagonist on the carotid body response to graded hypoxia were examined in carotid bodies from IH and control rat pups. Based on preliminary studies (see Methods) we chose 1μM of BQ-610 for these studies. As shown in Figure 7, BQ-610 prevented IH-induced augmentation of HSR, whereas it had no significant effect on the HSR in control carotid bodies. The effects of BQ-610 completely reversed within 20 min after removing the antagonist from the superfusate (Figure 7A; extreme right panel). On the other hand, 1μM of BQ-610 had no effect on carotid body sensory response to depolarizing stimulus (40mM KCl). More importantly, BQ-788, an ETB receptor antagonist at equimolar concentrations (1μM) tended to potentiate the HSR in IH exposed carotid bodies, but this effect was not significant (IH = +20±1 Δ imp/sec vs BQ-788 = +26±3 Δ imp/sec; p > 0.05).

14

DISCUSSION Major findings of the present study were: a) IH increased basal release of ET-1 but had no effect on ET-1 expression in neonatal carotid bodies; b) IH-sensitized carotid body response to exogenous ET-1; c) ETA but not ETB receptor antagonist prevented IH-evoked sensitization of the HSR; d) IH up-regulated ETA but ETB receptor mRNA in the neonatal carotid body and e) IH-increased ROS levels in the neonatal carotid body and anti-oxidant prevented augmented HSR, enhanced basal release of ET-1, up-regulation of ETA mRNA but not the hyperplasia of glomus cells by IH. Consistent with earlier reports (16, 13) we found that IH augments HSR in neonatal rat carotid bodies. A previous study reported that IH up-regulates ET-1 and ET-1 receptors mediate IHevoked increase in the HSR of the adult cat carotid body (20). Based on this study, we examined whether IH also up-regulates ET-1 in neonatal carotid bodies. To this end, we employed three approaches including immunocytochemistry, EIA, and real time RT-PCR. Neonatal rat carotid bodies expressed substantial ET-1 and much of the peptide was localized to glomus cells. However, unlike the adult cats, IH had no significant effect either on ET-1 expression or preproET-1 mRNA levels in neonatal carotid bodies. It is likely that the inability of IH to alter ET-1 expression is due to high levels of basal ET-1 expression in neonatal carotid bodies. Although ET-1 expression was unaffected, IH significantly enhanced the basal ET-1 release from neonatal carotid bodies. Studies on the effects of exogenous ET-1 showed that as little as femtomolar concentration augmented HSR in IH treated neonatal carotid bodies; whereas picomolar concentration, which is 1000 times higher, was needed to augment HSR in control carotid bodies. These observations taken together suggest that IH-evoked enhanced basal ET-1 release leads to greater sensitization of HSR in IH compared to control carotid bodies. How

15

might ET-1 leads to greater sensitization of HSR in neonatal carotid bodies? Biological actions of ET-1 are mediated via ETA and ETB receptors (21). IH led to ~3.5fold increase in ETA mRNA in neonatal carotid bodies; whereas it had no effect on ETB receptor mRNA. More importantly, ETA but not ETB receptor antagonist prevented IH-evoked sensitization of the HSR. The effects of ETA blocker were selective to hypoxia because carotid body response to depolarizing stimulus (40mM KCl) was unaffected by ETA antagonist. These observations suggest that up-regulation of ETA receptors contributes to IH-evoked up-regulation of HSR and sensitization of ET-1 response in neonatal carotid bodies. Further studies, however, are required to examine the localization of ETA receptors in the carotid body and the effects of IH on ETA receptor protein and affinity to ET-1. It is interesting to note that higher concentrations of ET-1 lead to marked attenuation of HSR in IH treated carotid bodies. This attenuated HSR might conceivably be due to ETB receptor–dependent activation of nitric oxide (NO) synthesis (6), which is known to inhibit the carotid body sensory activity (23). What signaling mechanism(s) contributes to IH-evoked enhanced ET-1 release and up-regulation of ETA receptor mRNA? The following observations demonstrate a role for ROS as an up-stream signaling molecules(s) mediating the effects of IH. First, IH increased ROS levels in neonatal carotid bodies as evidenced by elevated MDA levels. Second, and perhaps more important evidence was that anti-oxidant treatment prevented IH-evoked increases in ROS and blocked the sensitization of the HSR, enhanced ET-1 release as well as the up-regulation of the ETA receptor mRNA by IH. How might ROS mediate enhanced ET-1 release and increases in ETA receptor mRNA? Recent studies have shown that ROS generated by IH activates intracellular Ca2+ mobilizing pathways, which in turn contribute to IH-evoked transcriptional activation (24, 11). It is likely that ROS-

16

mediated Ca2+-signaling contributes to the up-regulation of ETA receptor mRNA in IH-treated neonatal carotid bodies. Future studies are needed to confirm this possibility. Weak stimulation of neuronal cells tends to promote partial release of the vesicular transmitter content via a kissand-run mechanism, which account for the release of low molecular weight transmitters such as biogenic amines. On the other hand, stronger stimuli elicit either a more complete emptying of the vesicle content or alternatively cause vesicles to undergo full fusion resulting in enhanced secretion including neuropeptides of high molecular weight (4, 5). Our recent study on the effect of IH on hypoxic response of the rat neonatal chromaffin cells showed that IH recruits additional Ca2+ signaling pathways via ROS dependent mechanisms leading to stronger [Ca2+]i responses and enhanced quantal transmitter release (22). We believe that similar ROS-dependent Ca2+ signaling may contribute to the augmented ET-1 release from the carotid body by IH (22). Although our data indicates that ROS is the up-stream signal for ET-1, there are reports suggesting that ET-1 generates ROS by activating NADPH oxidase (3). Further studies are needed to examine whether ET-1 generates ROS and contribute to ROS-induced ROS in IHtreated neonatal carotid body. Consistent with our earlier study (13), IH significantly increased the number of glomus cells in neonatal carotid body. However, unlike its effects on HSR, anti-oxidant treatment was ineffective in preventing IH-elicited hyperplasia of glomus cells. These observations suggest that the heightened HSR by IH was not secondary to increased number of glomus cells. Although these results suggest ROS signaling may not be contributing to IH-evoked morphological changes, ET-1 could still be driving the hyperplasia via non-ROS mechanism(s), a possibility that remains to be further investigated. Perspective and Significance: In summary, the results of the present study demonstrate that

17

ROS-dependent recruitment of ET-1 signaling contributes to IH-induced heightened hypoxic sensitivity but not to the hyperplasia of glomus cells. What might be the significance of altered carotid body sensitivity to hypoxia by IH in neonatal life? It’s been suggested that the enhanced hypoxic sensitivity of the carotid bodies leads to destabilization of breathing making the system prone to apneas (1). Consequently, we proposed that IH-induced heightened HSR of neonatal carotid bodes might perpetuate apneas (13). Indeed, a recent study showed that IH leads to more number of apneas in neonatal rat pups and this effect was associated with augmented hypoxic ventilatory response (8), indicating augmented carotid body reflexes. In future studies it would be interesting to examine whether ET-1 receptor antagonist prevents worsening of apneas in IH treated neonatal rat pups. Such studies might be of considerable significance in providing novel therapeutic strategies for alleviating the physiological consequences of breathing disorders in premature infants.

18

ACKNOWLEDGEMENT This study was supported by grants from the National Institutes of Health, Heart, Lung and Blood Institute, HL-076537, HL-086493, and HL-090554. We thank Dr. Gayatri Raghuraman for her generous assistance with ET-1 release experiments.

19

REFERENCES 1. Al-Matary A, Kutbi I, Qurashi M, Khalil M, Alvaro R, Kwaitkowski K, Cates D, Rigatto H. Increased peripheral chemoreceptor activity may be critical in destabilizing breathing in neonates. Seminars in Perinatology 28: 264-272, 2004. 2. Chen J, He L, Dinger B, Fidone S. Cellular mechanisms involved in rabbit carotid body excitation elicited by endothelin peptides. Respir Physiol 121: 13-23, 2000. 3. Dammanahalli KJ, Sun Z. Endothelins and NADPH oxidases in the cardiovascular system. Clin Exp Pharmacol Physiol 35: 2–6, 2008. 4. Elhamdani A, Palfrey HC, Artalejo CR. Quantal size is dependent on stimulation frequency and calcium entry in calf chromaffin cells. Neuron 31: 819-30, 2001. 5. Elhamdani A, Azizi F, Artalejo CR. Double patch clamp reveals that transient fusion (kissand-run) is a major mechanism of secretion in calf adrenal chromaffin cells: high calcium shifts the mechanism from kiss-and-run to complete fusion. J Neurosci 26: 3030-3036, 2006. 6. Hirata Y, Emori T, Eguchi S, Kanno K, Imai T, Ohta K, Marumo F. Endothelin receptor subtype B mediates synthesis of nitric oxide by cultured bovine endothelial cells. J Clin Invest 91: 1367-1373, 1993. 7. Jacono FJ, Peng YJ, Kumar GK, Prabhakar NR. Modulation of the hypoxic sensory response of the carotid body by 5-hydroxytryptamine: role of the 5-HT2 receptor. Respir Physiol Neurobiol 145: 135-142, 2005. 8. Julien C, Bairam A, Joseph V. Chronic intermittent hypoxia reduces ventilatory long-term facilitation and enhances apnea frequency in newborn rats. Am J Physiol Regul Integr Comp Physiol 294: R1356-R1366, 2008.

20

9. Kline DD, Peng YJ, Manalo DJ, Semenza GL, Prabhakar NR. Defective carotid body function and impaired ventilatory responses to chronic hypoxia in mice partially deficient for hypoxia-inducible factor 1 alpha. Proc Natl Acad Sci USA 99: 821-826, 2002. 10. Major J, Dinger B, Stensaas LJ, Wang ZZ. A quantitative immunocytochemical approach to the analysis of type I cells in the cat carotid body. Biol Signals 8: 375-381, 1999. 11. Nanduri J, Yuan G, Kumar GK, Semenza GL, Prabhakar NR. Transcriptional responses to intermittent hypoxia. Respir Physiol Neurobiol July 23. Epub ahead of print, 2008. 12. Nock ML, Difiore JM, Arko MK, Martin RJ. Relationship of the ventilatory response to hypoxia with neonatal apnea in preterm infants. J Pediatr 144: 291-295, 2004. 13. Pawar A, Peng YJ, Jacono FJ, Prabhakar NR. Comparative analysis of neonatal and adult rat carotid body responses to chronic intermittent hypoxia. J Appl Physiol 104: 1287-1294, 2008. 14. Peng YJ, Overholt JL, Kline D, Kumar GK, Prabhakar NR. Induction of sensory longterm facilitation in the carotid body by intermittent hypoxia: implications for recurrent apneas. Proc Natl Acad Sci USA 100: 10073-10078, 2003. 15. Peng YJ, Prabhakar NR. Effect of two paradigms of chronic intermittent hypoxia on carotid body sensory activity. J Appl Physiol 96: 1236-1242 2004. 16. Peng YJ, Rennison J, Prabhakar NR. Intermittent hypoxia augments carotid body and ventilatory response to hypoxia in neonatal rat pups. J Appl Physiol 97: 2020-2025, 2004. 17. Poets CF, Samuels MP, Southall DP. Epidemiology and pathophysiology of apnoea of prematurity. Biol Neonate 65: 211-219, 1994. 18. Prabhakar NR. O2 sensing at the mammalian carotid body: why multiple O2 sensors and multiple transmitters? Exp Physiol 91: 17-23, 2005.

21

19. Ramanathan L, Gozal D, Siegel JM. Antioxidant responses to chronic hypoxia in the rat cerebellum and pons. J Neurochem 93: 47-52, 2005. 20. Rey S, Rio RD, Iturriaga R. Contribution of endothelin-1 to the enhanced carotid body chemosensory responses induced by chronic intermittent hypoxia. Brain Res 1086: 152-159, 2006. 21. Rubanyi GM, Polokoff MA. Endothelins: molecular biology, biochemistry, pharmacology, physiology, and pathophysiology. Pharmacol Rev 46: 325-415, 1994. 22. Souwannakitti D, Kumar GK, Fox AP and Prabhakar NR. Reactive oxygen species mediate long-lasting up-regulation of hypoxic sensitivity in rat neonatal chromaffin cells by intermittent hypoxia. J Physiol submitted 2008. 23. Wang ZZ, Stensaas LJ, Dinger B, Fidone SJ. Nitric oxide mediates chemoreceptor inhibition in the cat carotid body. Neuroscience 65: 217-229, 1995. 24. Yuan G, Nanduri J, Khan S, Semenza GL, Prabhakar NR. Induction of HIF-1 alpha expression by intermittent hypoxia: involvement of NADPH oxidase, Ca2+ signaling, prolyl hydroxylases, and mTOR. J Cell Physiol 217: 674-685, 2008.

22

LEGENDS Figure 1. IH increases ROS in neonatal carotid bodies Malondialdehyde (MDA) levels were analyzed as an index of ROS in carotid bodies from control (C), intermittent hypoxia (IH) and IH exposed P10 rat pups treated with membrane permeant anti-oxidant MnTMPyP (5mg/kg, IP every day from P0-P10). n = 10 carotid bodies in each group. ** denotes p < 0.005 between control and IH; n.s = not significant (p > 0.05; Control vs IH + MnTMPyP).

Figure 2. Antioxidant (MnTMPyP) treatment prevents IH-evoked augmented hypoxic sensory response (HSR) in neonatal carotid bodies

A, Representative examples of HSR in ex vivo carotid bodies from control, intermittent hypoxia (IH) and IH exposed P10 rat pups treated with MnTMPyP (5 mg/kg, IP every day from P0-P10). Horizontal black bar represents the duration of the hypoxic challenge (Hx; medium PO2 = 30-32 mmHg). Insets represent superimposed action potentials from a single unit from which the data were derived. B, Average data of the carotid body responses to graded isocapnic hypoxia (medium PCO2 ~ 35-36 mmHg) in control (open box), IH (filled box) and IH exposure combined with MnTMPyP treatment (filled triangle). Data presented are means ± S.E.M. from 7 carotid bodies from 7 rat pups in each group. ** denote p < 0.005 (Control vs IH).

Figure 3. Effects of intermittent hypoxia (IH) on ET-1 and pre-pro ET-1mRNA expression in neonatal carotid bodies

A, Examples illustrating the immunocytochemical analysis of ET-1-like immunoreactivity in

23

carotid bodies from control (C; left panel) and IH exposed rat pups (middle panel). The specificity of ET-1 staining was investigated in IH carotid body section by prequenching with ET-1 peptide (right panel). Carotid body sections were double stained with polyclonal ET-1 and monoclonal tyrosine hydroxylase (TH) antibodies, the latter as a marker of glomus cells. ET-1 + TH represent merged images. B, Average data of ET-1 content of the carotid body analyzed by Enzyme based Immunoassay (EIA) from control (C) and intermittent hypoxia (IH) exposed rat pups. C, Average data of pre-pro ET-1 mRNA expression presented as a ratio of pre-pro ET-1 to GAPDH and expressed as a percentage of control. Data presented in B and C are mean ± SEM from n = 10 carotid bodies. n.s. = not significant (p > 0.05; Control vs IH).

Figure 4. Effect of IH on ET-1 release from neonatal carotid bodies

A, Average data of basal ET-1 release during normoxia (medium PO2 = 145 ± 2 mmHg) from carotid bodies harvested from control (C), IH exposed rat pups treated without (IH) and with MnTMPyP. B, Average data of hypoxia evoked ET-1 release from the same preparations. Data presented are mean ± S.E.M. from n = 16 carotid bodies in each group. ** denote p < 0.005 (Control vs IH). n.s = not significant (p > 0.05; Control vs. IH).

Figure 5. IH sensitizes carotid body response to exogenous ET-1

A, Representative examples of the effects of increasing concentrations of exogenous ET-1 on HSR in ex vivo carotid bodies harvested from control and intermittent hypoxia (IH) exposed rat pups. Horizontal black bar represents the duration of the hypoxic challenge (Hx; medium PO2 = ~ 60 mmHg). Insets represent superimposed action potentials from a single unit from which the data were derived. Concentrations of ET-1 are presented as 10- XM. B, Average data of the HSR 24

presented as a percent of baseline response in presence of vehicle in control (left panel) and IH exposed neonatal rat pups (right panel). Data presented are mean ± S.E.M. from n = 6 carotid bodies in each group. *** denote p < 0.001 (for Control vehicle vs 10-12 M ET-1; for IH vehicle vs 10-15 M ET-1).

Figure 6. IH up-regulates ETA receptor mRNA expression in neonatal carotid bodies

A, Representative examples of mRNA expression of ETA and ETB receptors (ETA-R and ETB-R, respectively) and GAPDH in control (C) and IH exposed rat pups with and without (IH) treatment with MnTMPyP. The levels of GAPDH mRNA were monitored as control house keeping gene. B, Average data normalized to GAPDH and expressed as a percentage of control. n = 10 carotid bodies in each group. ** denote p < 0.005 (Control vs IH).

Figure 7. ETA receptor antagonist prevents IH-induced augmentation of HSR in neonatal carotid bodies.

A, Representative examples of HSR in ex vivo carotid bodies from control, intermittent hypoxia (IH) exposed rat pups in presence of vehicle or 1μM of BQ-610, an ETA receptor antagonist. Extreme right panel represents recovery of the HSR response after 20 minutes of washing out BQ-610. Horizontal bars represent the duration of the hypoxic challenge (medium PO2 = 30-32 mmHg). Insets, superimposed action potentials from a “single unit” from which the data were derived.

B, Average data of the carotid body response to graded isocapnic hypoxia (medium

PCO2 =34-35 mmHg) in presence of vehicle (open box) or 1µM BQ-610 (filled box) from control and IH exposed rat pups. Data presented are means ± S.E.M. from 7 carotid bodies from 7 rat pups in each group respectively. *denotes p < 0.05 vehicle vs BQ-610.

25

Table 1. Morphometric analysis of carotid bodies from control and IH-conditioned neonatal rat pups with and without treatment with antioxidant MnTMPyP. Data are mean ± S.E.M. from 3 carotid bodies (n = 4 sections from each carotid body). *** denotes P < 0.001, IH vs control and n.s., not significant p > 0.05 IH vs IH + MnTMPyP.

26