This article was published in an Elsevier journal. The attached copy is furnished to the author for non-commercial research and education use, including for instruction at the author’s institution, sharing with colleagues and providing to institution administration. Other uses, including reproduction and distribution, or selling or licensing copies, or posting to personal, institutional or third party websites are prohibited. In most cases authors are permitted to post their version of the article (e.g. in Word or Tex form) to their personal website or institutional repository. Authors requiring further information regarding Elsevier’s archiving and manuscript policies are encouraged to visit: http://www.elsevier.com/copyright

Author's personal copy

Journal of Virological Methods 145 (2007) 1–8

A universal transgene silencing approach in baculovirus–insect cell system Tamer Z. Salem a,b,∗ , James E. Maruniak a,c a

b

Department of Microbiology and Cell Science, University of Florida, P.O. Box 110700, Gainesville, FL 32611, USA Agricultural Genetic Engineering Research Institute (AGERI), Agricultural Research Center (ARC), 9 Gamaa Street, Giza 12619, Egypt c Department of Entomology and Nematology, University of Florida, P.O. Box 110620, Gainesville, FL 32611, USA Received 30 January 2007; received in revised form 18 April 2007; accepted 25 April 2007 Available online 4 June 2007

Abstract Baculovirus–insect cell system (BICS) is considered one of the most efficient eukaryotic gene expression systems. This system has also been used for producing different recombinant baculoviruses with increased insect toxicity as potential biopesticides. Establishing a universal gene silencing (UGS) system is very important due to the increasing number of studies using RNA interference (RNAi) with BICS. In this work, the enhanced green fluorescent protein (EGFP) was used as the RNAi consistent target sequence located downstream of a depressant insect-neurotoxin gene, LqqIT2 used as a model of the gene of interest. Small interfering RNA (siRNA) and inverted repeats of EGFP gene (IR-EG) were examined in targeting the EGFP-LqqIT2 (EL)-fusion mRNA or LqqIT2-EGFP (LE)-bicistronic mRNA for degradation. Suppression efficiencies using these inducers were examined transiently and stably in uninfected and infected insect Sf9 cells. Moreover, RNAi showed persistence for 4 and 8 days in baculovirus-infected as well as uninfected Sf9 cells, respectively. Bicistronic RNA seems an efficient way to lower cost and effort of the gene silencing approach while maintaining the biological activity of the protein of interest when the RNAi is not in use. © 2007 Elsevier B.V. All rights reserved. Keywords: RNAi; siRNA; Baculovirus; Bicistronic; Sf9; LqqIT2; Fusion; EGFP

1. Introduction RNA Interference (RNAi) has been used to knock down genes in many organisms (Fire et al., 1998; Kennerdell and Carthew, 2000; Elbashir et al., 2001; Provost et al., 2002). In some cases, it is considered more efficient in silencing genes than the antisense technology (Fire et al., 1998; Aoki et al., 2003). In eukaryotic cells, the RNAi machinery is triggered by the existence of double stranded RNA (dsRNA) and initiated by digestion with a type III endonuclease enzyme called Dicer into 21–23 bp small interfering RNA (siRNA) (Bernstein et al., 2001). The induction of RNAi machinery has been obtained by different moieties such as siRNA (Elbashir et al., 2001), inverted repeats (IR) (Chuang and Meyerowitz, 2000; Fortier and Belote, 2000; Kennerdell

∗ Corresponding author at: Department of Microbiology, Miami University, 32 Pearson Hall, Oxford, OH 45056, USA. Tel.: +1 513 529 5443; fax: +1 513 529 2431. E-mail address: [email protected] (T.Z. Salem).

0166-0934/$ – see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2007.04.012

and Carthew, 2000; Martinek and Young, 2000; Tavernarakis et al., 2000) dsRNA (Fire et al., 1998), and short hairpin RNA (shRNA) or micro-RNA (miRNA) (Paddison et al., 2002). Stably transformed cells that induce RNAi constitutively have been established in both mammalian cells and insect cells (Miyagishi and Taira, 2002; Paddison et al., 2002; Sui et al., 2002; Hemann et al., 2003; Lin et al., 2006). However, the production of stable dsRNA in differentiated somatic mammalian cells has failed (McManus et al., 2002). RNAi has shown to function efficiently in lepidopteran cells (Bettencourt et al., 2002; Quan et al., 2002). Recent studies have shown that Spodoptera frugiperda Sf9 cells, are efficient in silencing genes by RNAi during baculoviral infection (Means et al., 2003; Valdes et al., 2003). Recombinant baculoviruses have been used as efficient eukaryotic gene expression systems and as potential biopesticides (Maeda et al., 1991; McCutchen et al., 1991; Steward et al., 1991). Many genes in the baculovirus–insect cell line biphasic system were suppressed by RNAi in order to study their role in baculovirus replication (Kramer and Bentley, 2003; Means et al., 2003; Valdes et al., 2003; Agrawal et al., 2004; Flores-Jasso

Author's personal copy

2

T.Z. Salem, J.E. Maruniak / Journal of Virological Methods 145 (2007) 1–8

et al., 2004; Ikeda et al., 2004). In all these studies, specific dsRNA or siRNA sequences had to be designed for each target gene. This process is laborious, time and money consuming. Therefore, adapting the mammalian universal trans-gene silencing (UTGS) system (Mangeot et al., 2004) during baculovirus replication could have a positive impact on facilitating research in this area. A universal transgene silencing method based on RNA interference was tested first on mammalian cells. The second cistron of an internal ribosomal entry site (IRES) bicistronic lentiviral vector was targeted by a specific siRNA which resulted in silencing both transgenes (Mangeot et al., 2004). Unlike capdependent translation, some IRESs recruit ribosomes directly without the need of ribosomes to scan the untranslated region of mRNA. Although IRESs are abundantly found in different viral and cellular mRNAs (Jang et al., 1990; Carter et al., 1999; Hellen and Sarnow, 2001), the Encephalomyocarditis virus (ECMV) IRES functions poorly in insect cells (Finkelstein et al., 1999). Establishing a UTGS in insect cells was not applicable until the IRES from Rhopalosiphum padi virus was isolated (Domier et al., 2000), which functioned efficiently in mammalian, insect, and plant cells (Woolaway et al., 2001). Moreover, it functions well during baculovirus infection in both Sf9 and Sf21 insect cell lines (Domier and McCoppin, 2003; Royall et al., 2004). Universal gene silencing can be used to improve recombinant baculovirus yield. Recombinant baculoviruses expressing insect-specific toxins are effective at accelerating the speed of killing insect pests (Maeda et al., 1991; McCutchen et al., 1991; Steward et al., 1991). However, this improvement has not been sufficient to compete with chemical pesticides. One reason is that the use of insect-toxin genes (such as AaHIT from the Algerian scorpion, Androctonus australis Hector) and juvenile hormone esterase gene to genetically enhance baculoviruses causes a dramatic decrease in virus yield during their production in larvae (Hernandez-Crespo et al., 2001; McCutchen, 2001; Kunimi et al., 1996). This could be solved by temporarily blocking during the viral replication phase the expression of the genes causing the yield decrease. Triggering RNAi in those recombinantbaculovirus-infected insect cells is a potential approach that would reduce the cytotoxic effect of recombinant baculoviruses during replication without permanently changing their potencies toward the insect hosts. In this study, we tried the UTGS method based on RNAi technology in insects. We focused here on the use of the enhanced green fluorescent protein (EGFP) as a consistent target sequence for RNAi located downstream of the scorpion insect-neurotoxin LqqIT2 gene (Zaki and Maruniak, 2003) in order to be transcribed either as a fusion or as a bicistronic RNA. This could be a potential solution to increase the yield of the recombinant baculoviruses expressing toxins without exhibiting dramatic yield reduction. 2. Materials and methods 2.1. Plasmid constructs Plasmids pEG, pIR-EG, pAnti-EG, pLE and pLE-IRES (Fig. 1A) were derived from the pIB/V5-His vector (Invitrogen) which contains a constitutive OpIE2 promoter (Theilmann

Fig. 1. Schematic representations of plasmid constructs. (A) Plasmids derived from the pIB/V5-His plasmids expressing EGFP (pEG), inverted repeats of EGFP (pIR-EG), antisense EGFP (pAnti-EG), LqqIT2-EGFP fusion (pLE) and LqqIT2-EGFP bicistronic (pLE-IRES) RNAs, respectively. (B) Plasmids derived from the pBlueBac4.5 vector expressing EGFP (pBB-EG), LqqIT2 (pBB-L) and EGFP-LqqIT2 as a fusion protein (pBB-EL) respectively. The signal sequence of the LqqIT2 was abbreviated as s.s.

and Stewart, 1992). Plasmids pBB-EG, pBB-L and pBB-EL (Fig. 1B) were derived from the pBlueBac4.5 vector (Invitrogen), which contains the very strong polyhedrin promoter. All primers used in constructing the plasmids are shown in Table 1. Plasmid pEG had the EGFP gene cloned between BamHI and SpeI sites after PCR amplifying it from the pIRES2-EGFP vector (Clontech) using primers 1 and 2. Plasmid pIR-EG contained inverted repeats of the EGFP gene separated by a DNA spacer of 200 bp. The spacer was part of the IRES of the Encephalomyocarditis virus (ECMV) cloned in the pEG plasmid between SpeI and EcoRI sites after amplification from the pIRES2-EGFP vector using primers 3 and 4. The inverted EGFP was PCR amplified using primers 5 and 6, then cloned downstream of the DNA spacer between EcoRI and XbaI sites. To reduce the 3 untranslated region, an additional SV40 termination sequence isolated from the pBlueBac4.5 transfer vector (Invitrogen) was amplified using primers 7 and 8 and cloned between XbaI and SacII sites. Plasmid pAnti-EG containing the inverted EGFP sequence was cloned between BamHI and XbaI after being amplified with primers 6 and 9. Plasmid pLE containing the LqqIT2 gene fused to the N-terminus of an EGFP gene was constructed by first PCR amplifying the LqqIT2 gene from clone 7 (accession number AF474984, Zaki and Maruniak, 2003) with primers 10 and 11 and cloning this product between BamHI and XbaI. The EGFP

Author's personal copy

T.Z. Salem, J.E. Maruniak / Journal of Virological Methods 145 (2007) 1–8 Table 1 Primer sequences used during plasmid construction # Primers 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

Nucleotide sequences (5 –3 )

REN

GAGGATCCACAACCATGGTGAGCAG GACTAGTCTTGTACAGCTCGTCCATG GACTAGTCTTGAAGACAAACAACGTC GGAATTCTTCTGGGCATCCTTCAGCC GGAATTCCTTGTACAGCTCGTCCATG GCTCTAGAACAACCATGGTGAGCAAG GCTCTAGAAACTTGTTTATTGCAGCT TCCCCGCGGAGATGATAAGATACATTG GAGGATCCTTACTTGTACAGCTCGTCC GAGGATCCATGAAACTGTTTCTTTTACTAATTATC GCTCTAGAACCGCATGTGTTTGTTTCAC TCCCCGCGGTTACTTGTACAGCTCGTCCATG GGAATTCTTAACCGCATGTGTTTGTTTCAC GGAATTCGATAAAAGAACCTATAATCCC GCTCTAGATATAAATAGATAAAGCTAATG CTGTCTGCAGTTACTTGTACAGCTCGTCC CTGTGGAGCTCAGCATTAACTAAGCTTTCG CTGTGCTCGAGGACGGATATATAAGA AAACG CTGTGGAGCTCACAACCATGGTGAGCAAG CTGTGCTCGAGCTTGTACAGCTCGTCCATGCC

BamHI SpeI SpeI EcoRI EcoRI XbaI XbaI SacII BamHI BamHI XbaI SacII EcoRI EcoRI XbaI PstI SacI XhoI SacI XhoI

Restriction endonuclease (REN) sites added are indicated in bold and on the right column.

gene for that same construction was amplified using primers 6 and 12 and cloned between XbaI and SacII. Plasmid pLE-IRES contained the LqqIT2 gene upstream of EGFP and was separated by an IRES isolated from the 5 untranslated region of the Rhopalosiphum padi virus genome (Rh5 -IRES). For pLE-IRES a very similar strategy to the one used to make the pLE fusion primer was used, but primer 11 was replaced with primer 13 to add a stop codon to LqqIT2 and to replace the XbaI site with an EcoRI site. The Rh5’-IRES was cloned between EcoRI and XbaI sites after being amplified from the 5 RLIGEL vector (provided by Dr. Leslie Domier from University of Illinois at UrbanaChampaign, USA) with primers 14 and 15. Plasmid pBB-EG had the EGFP gene that was amplified with the primers 1 and 16 and cloned between BamHI and PstI sites. pBB-EL contained the EGFP gene downstream of the LqqIT2 leader sequence and upstream of the LqqIT2 gene. Initially, the LqqIT2 gene containing its leader sequence, that encodes the signal peptide or signal sequence (s.s.), was amplified with primers 10 and 16 and cloned in pBB between BamHI and PstI sites. Then an inverse PCR was performed with the primers 17 and 18 to split the cloned LqqIT2 gene from its s.s. and its coding region while adding SacI and XhoI sites. EGFP gene was amplified with primers 19 and 20 and cloned to the inverse PCR product to obtain pBB-EL. 2.2. Generation of recombinant baculoviruses The Sf9 insect cells and the MaxBac 2.0 expression system (Invitrogen, Carlsbad, CA) were used to produce three recombinant viruses. The transfer vector pBlueBac4.5 was used to clone the genes of interest, EGFP and EGFP-LqqIT2 fusion genes, under the polyhedrin promoter. Four micrograms of each of the three transfer vectors, pBB-EG, pBB-EL and pBB (with no exogenous gene) were cotransfected separately with 0.5 ␮g

3

of the linearized AcMNPV genome into Sf9 cells using 10 ␮l of Cellfectin (Invitrogen) in 0.5 ml of TC-100 serum-free medium. After 15 min incubation at room temperature, the transfection mixture was added to 0.9 × 106 Sf9 cells seeded in 35 mm cell culture dish (Corning). The cells were incubated at 26 ◦ C, the transfection mixture was removed and 2 ml of complete TC100 medium with 10% fetal bovine serum was added. The medium was collected after 72 h and the recombinant baculoviruses Ac-EG, Ac-EL and Ac-BB were purified by plaque assay in 35 mm cell culture dish. Blue plaques were individually grown in 96 cluster well tissue plates seeded with 1 × 104 Sf9 cells/well. After 72 h, the DNA of the infected cells was isolated as described by Maruniak et al. (1999). The isolated DNA was PCR-amplified using primers specific to the inserted DNA previously used in constructing the recombinant viruses. The yields of the positive recombinant viruses were increased by further infecting 3 × 105 Sf9 cells in 24-well tissue culture plates, followed by 6-well tissue culture plates with 1.5 × 106 cells, and finally 25 cm2 tissue culture flasks with 3 × 106 cells to obtain a final volume of 5 ml of each virus. The mean tissue culture infective dose (TCID50 ) of the viral stocks was calculated using the end-point dilution method (O’Reilly et al., 1994). The viral stocks were used to infect the Sf9 cells at a multiplicity of infection (MOI) equal to 1 in 25 cm2 flasks. The virus collected three days post infection (p.i.) was titered three times and a new TCID50 was calculated for every recombinant viral stock. 2.3. Polymerase chain reaction (PCR) The PCR reactions were performed in total volumes of 25 ␮l with 200 ␮M dNTPs, 50 ng of each individual vector containing the gene of interest, 10 pmoles of each of the forward and reverse primers (Table 1), 2.5 ␮l 10× PCR reaction buffer (10 mM KCl, 10 mM (NH4 )2 SO4 , 20 mM Tris–HCl, 2 mM MgSO4 , 0.1% Triton X-100, 0.1 mg/ml BSA) and 0.6 units of Pfu Turbo DNA Polymerase (Stratagene). The PCR cycle was: initial denaturation for 3 min at 94 ◦ C, followed by 25 cycles of 1 min at 94 ◦ C, 1 min at 55 ◦ C and 2 min at 72 ◦ C, and a final extension of 72 ◦ C for 7 min. 2.4. Production of stably transformed Sf9IR-EG cells Stably transformed Sf9 cells capable of constitutively producing the long hairpin of EGFP were obtained by transfecting Sf9 cells with the pIR-EG as recommended for the InsectSelectTM BSD System (Invitrogen). The cells containing the plasmid were selected using the antibiotic blasticidin (80 ␮g/ml). The stably transformed cells called Sf9IR-EG were obtained after approximately 2 weeks. The stable cells were maintained using a lower dosage of blasticidin (10 ␮g/ml). 2.5. Suppression of EGFP expression in uninfected and infected cells In 24-well plates, Sf9 cells were seeded at 1.5 × 105 cells per well in 0.5 ml TC-100 complete medium (50 ␮g/ml Gentamicin) supplemented with 10% FBS 15 h prior to transfection.

Author's personal copy

4

T.Z. Salem, J.E. Maruniak / Journal of Virological Methods 145 (2007) 1–8

Then 1 ␮g of plasmid and 2 ␮l of Cellfectin (Invitrogen) were mixed in a final volume of 250 ␮l of TC-100 serum free medium and incubated at room temperature for 15 min. The transfection mixture (250 ␮l) replaced the complete medium and the plate was incubated at room temperature for 4 h on a rocker platform (2 cycles/min). After the incubation period, 0.5 ml of complete medium was added to the 250 ␮l transfection mix, and the cells were incubated at 27 ◦ C for 48 h. The ratio 1:2 (concentration of siRNA in ␮g to volume of Cellfectin in ␮l) was applied for the small interfering RNA (siRNA), consisting of 22 bp of the 122–143 of the GFP coding region (GFP-22 siRNA) (Qiagen Inc.). In some experiments, cells were transfected for 4 h followed by a 1 h viral inoculation. These two procedures were done either immediately, one after the other, or 18 h apart. For the transfection, the pIR-EG and the siRNA were used as RNAi inducers. Viral infection was done at different multiplicity of infections (1, 5, 10 and 100). 2.6. Detection and assessment of EGFP expression The EGFP expression in the Sf9 cells was measured by quantitative assessment of the cell fluorescence. The fluorescent cells were detected using an Axioplan 2 morphometric microscope with MICD Software made by Imaging Research Inc., and a Sony DXC-970MD camera (Brain Institute, University of Florida core facility). The mean fluorescence value (MFV) representing the average fluorescence intensity that was used to compare the cellular EGFP expression was computed using the Fluorescent-Activated Cell Sorter (FACS) (Flow Cytometry Core Laboratory at the University of Florida Interdisciplinary Center for Biotechnology Research (ICBR), core facility). Every treatment was done in triplicate and the mean value is presented. Flow cytometry was performed using a “FACScan” instrument (BD-Biosciences, San Jose, CA). Light scatter was produced and fluorescence was excited using an argon-ion laser emitting 15 milliwatts of 488 nm light. Data were collected and analyzed using “Cell Quest Version 3.3” (BD-Biosciences) running on a Macintosh G3 computer (Apple Computer, Cupertino, CA). For each sample, 10,000 cells were analyzed and the forward light scatter, side light scatter and green fluorescence (530 ± 15 nm) from the expressed EGFP were measured. All samples were repeated three times and standard deviations were calculated.

rabbit polyclonal GFP antiserum (Invitrogen) was used to detect EGFP protein on a nylon membrane (Bio-Rad). 3. Results 3.1. Transgene silencing stably and transiently in uninfected cells We examined the modified uninfected insect cells constitutively expressing dsRNA EGFP as a long hairpin (Sf9IR-EG), for their EGFP-transgene silencing efficiency. The mean fluorescence value (MFV) measured by the FACS was used to determine the level of EGFP expression. In order to eliminate the fluorescence background the MFV of Sf9IR-EG cells (Fig. 2, lane 1) was subtracted from the MFV of Sf9IR-EG transfected with pEG, the source of EGFP transgene (Fig. 2, lane 2). Moreover, the MFV of Sf9 cells transfected with pAnti-EG (Fig. 2, lane 3) was subtracted from Sf9 cells transfected with pEG (Fig. 2, lanes 4, 5, 6 and 7). The MFV indicated that the stable suppression of EGFP expression in Sf9IR-EG was 53% (Fig. 2, lane 2), while the transient suppression of siRNA or pIR-EG was 99.7% and 97%, respectively (Fig. 2, lane 5 and 6). The simultaneous transfection of pEG and pIR-EG showed more suppression efficiency in comparison to the results obtained when pIR-EG was transfected 18 h prior to the transfection with pEG (Fig. 2, lane 7). The western blot showed that the EGFP protein was detected in strong amounts in cells transfected with pEG (Fig. 3, lane 1) but not detected in cells cotransfected with pEG and siRNA or pIR-EG (Fig. 3, lanes 2 and 3, respectively), while low detection was noticed when pAnti-EG was used (Fig. 3, lane 4). Cells transfected with pLE-IRES showed lower expression of EGFP than pEG, however EGFP was detected by western blot (Fig. 3, lane 5) and readily detected by FACS (data not shown). No detection was noticed when pLE-IRES was cotransfected with siRNA (Fig. 3, lane 6). The LE-fusion protein was hardly detected, which indicates that EGFP may not fold properly when fused to

2.7. Western blot analysis Western blotting was performed according to the Immun-Blot Assay Kit manual (Bio Rad). Total proteins were extracted from 1.5 × 105 cells 48 h after Sf9 cell transfection or infection. The cell pellets were lysed using 100 ␮l of lysis buffer (0.1% Triton X-100 in PBS) according to the Detergent Lysis Protocol from the Bac-N-Blue Transfection and Expression Kit Manual (Invitrogen). All samples were incubated on ice for 30–45 min and vortexed at 10 min intervals. Samples were centrifuged at 1000 g for 10 min at 4 ◦ C. Ten microliters from the supernatant were boiled with 2× sample buffer for 3 min and ran on a 12% polyacrylamide SDS pre-cast gel (Bio-Rad). A dilution of 1:5000 of

Fig. 2. EGFP mean fluorescence values (MFV). Expression of EGFP was measured in stable Sf9 cell line constitutively expressing the inverted repeat of EGFP (Sf9IR-EG) (lane 1), Sf9IR-EG cells transfected with pEG (lane 2), non-stable Sf9 cells transfected with pAnti-EG (lane 3), Sf9 cells transfected with pEG (lane 4), Sf9 cells cotransfected with pEG and siRNA, pIR-EG or pIR-EG 18 h prior to transfection (lanes 5, 6 and 7, respectively).

Author's personal copy

T.Z. Salem, J.E. Maruniak / Journal of Virological Methods 145 (2007) 1–8

5

Fig. 3. Immunoblot analysis of Sf9 cells suppressing transient EGFP expression. Lanes 1–7 show the total cellular lysates extracted from cells transfected or cotransfected with pEG (lane 1); pEG and siRNA (lane 2); pEG and pIR-EG (lane 3); pEG and pAnti-EG (lane 4). The EGFP expression by IRES is also shown: pLE-IRES (lane5); pLE-IRES and siRNA (lane 6); pLE-fusion (pLE-fu, lane 7).

the N terminus of LqqIT2 (Fig. 3, lane 7). The western blot has shown to be sufficient to detect EGFP expression as a second cistron. 3.2. Transgene silencing in recombinant baculovirus infected cells The efficiency of transient gene suppression of EGFP and EL (EGFP fused to the N terminal of the scorpion toxin LqqIT2) was examined in cells infected with Ac-EG and Ac-EL recombinant baculoviruses, respectively. Both EGFP and EL constructions were under the very strong polyhedrin promoter so the level of EGFP expression in infected cells was much higher than the transient expression of EGFP in uninfected cells. In order to eliminate fluorescence background, cells infected with recombinant baculovirus constructed by using pBluebac4.5 with no insert (Ac-BB) at an MOI of 5 were used as a negative control (Fig. 4, lane 1). The level of EGFP expression was measured in Ac-EG infected Sf9 cells (Fig. 4, lane 2). Transfection with 10 ␮g of siRNA 18 h prior to infection with Ac-EG resulted in ∼100% EGFP suppression (Fig. 4, lane 3). A lower concentration of siRNA (2.5 ␮g) transfected the same 18 h prior to Ac-EG infection resulted in only ∼71% EGFP suppression (Fig. 4, lane 4). The transfection of cells with 5 ␮g pIR-EG 18 h prior to AcEG infection showed ∼61% EGFP suppression (Fig. 4, lane 5). Transfection of siRNA or pIR-EG 4 h prior to Ac-EG infection was more efficient than 18 h for EGFP suppression (data not shown). A significant drop in the fluorescence between cells infected with Ac-EG at an MOI of 5 (Fig. 5A) and cells transfected with 2.5 ␮g siRNA (Fig. 5B) and 5 ␮g pIR-EG 18 h prior to Ac-EG infection (Fig. 5C) was observed under a morphometric microscope. The influence of using Ac-EG and Ac-EL recombinant baculoviruses at different MOIs (1, 10 and 100) on the efficiency of EGFP suppression was examined (Table 2).

Fig. 4. Suppression of EGFP expression in Ac-EG infected Sf9 cells at MOI of 5. Infection with a recombinant baculovirus not expressing EGFP (Ac-BB) was used as negative control or base line (lane 1) and compared to the EGFP mean fluorescence value (MFV) obtained when Ac-EG was used to infect Sf9 cells (lane 2). Initial transfection with siRNA (lanes 3 and 4) or pIR-EG (lane 5) was done 18 h prior to infection with Ac-EG. Table 2 Mean fluorescence values (MFV) of Sf9 cells infected with Ac-EG at MOIs of 1, 10 and 100 Treatments

Mean fluorescence (MFV)

Reduction percentages

MOIs concentrations

SF9/Ac-EG SF9/siRNA/Ac-EG SF9/R-EG/Ac-EG SF9/Ac-EL SF9/siRNA/Ac-EL SF9/R-EG/Ac-EL

1

10

100

1

10

100

195.36 063.63 092.66 027.88 020.26 019.39

447.97 185.82 357.74 092.16 060.15 063.85

268.21 097.87 161.39 140.60 081.66 083.89

00.0 67.4 52.5 00.0 27.3 30.5

00.0 58.5 20.1 00.0 34.7 30.7

00.0 63.5 39.8 00.0 41.9 40.3

The percentage of fluorescence reduction in Sf9 cells transfected with 1 ␮g of siRNA 18 h prior to viral infection, as well as in the stable Sf9IR-EG cells is shown.

Data showed that the siRNA was successful in knocking down the EGFP expression in cells infected at different MOIs. Compared to cells infected with Ac-EG, the reduction percentage of EGFP expression ranged from 58.5 to 67.4% when Sf9 cells were transfected with 1 ␮g siRNA 18 h prior to infection. When Sf9IR-EG stable cells were examined, the percentage reduction ranged from 20.1 to 52.5%. The EGFP expression was less intense when EGFP was fused to the LqqIT2 toxin. However, its percentage reduction ranged from 27.3 to 41.9% when Ac-EL infected Sf9 cells were transfected with siRNA. The range of

Fig. 5. Morphometric microscope view of Sf9 cells infected with Ac-EG recombinant baculoviruses (A) and transfected with 10 ␮g siRNA (B) or 1 ␮g pIR-EG (C).

Author's personal copy

6

T.Z. Salem, J.E. Maruniak / Journal of Virological Methods 145 (2007) 1–8

Fig. 6. Immunoblot analysis of Ac-EG and Ac-EL infected Sf9 cells showing transient EGFP suppression. The total cellular lysates were extracted from cells infected with recombinant baculoviruses at MOI of 5 expressing EGFP independently (Ac-EG) or fused to the scorpion insect toxin LqqIT2 (Ac-EL). The higher molecular weight of the Ac-EL band is due to the fusion. The siRNA (1 ␮g) was transfected into cells 18 h prior to infection.

reduction was 30.5–40.3% when Sf9IR-EG cells were infected with Ac-EL virus (Table 2). The EGFP gene suppression during baculovirus infection was also confirmed by a western blot (Fig. 6). A dramatic suppression was detected in Sf9 cells transfected with 1 ␮g siRNA 18 h prior to infection with Ac-EG at an MOI of 5 (Fig. 6A) while, a complete suppression of EGFPLqqIT2 fusion was noticed when Ac-EL was used (Fig. 6B). 3.3. Persistence of gene suppression in uninfected and recombinant baculovirus infected cells Gene suppression persisted in uninfected cells for more than one cell generation (Fig. 7A). Initially, EGFP expression in Sf9 cells cotransfected with 1 ␮g pEG and 0.5 ␮g siRNA was suppressed by 99.3% (Fig. 7A, lane 3) when compared to cells transfected with pEG alone (Fig. 7A, lane 2) and after subtracting the fluorescence background obtained from cells transfected with 1 ␮g pAnti-EG that do not express EGFP (Fig. 7A, lane 1). After 6 days, a second transfection with 1 ␮g pEG was done to the previously cotransfected cells and the EGFP expression continued to be reduced by 84% (Fig. 7A, lane 4). Cells transfected with siRNA were able to maintain the reduction of EGFP expression for more than two generations. The persistence of gene suppression during baculovirus infection was also obtained (Fig. 7B). The EGFP suppression by 2.5 ␮g siRNA was measured in Sf9 cells infected with Ac-EG at an MOI of 5 every two days. The EGFP expression was suppressed by 51, 81 and 11% at 2, 4 and 6 days post-infection (p.i.), respectively. The infected cells were extensively lysed by day 6. Although the EGFP expression (under the very strong polyhedrin promoter) was at its highest level after 4 days p.i., the silencing capability was at its optimal efficiency at that time and reduced the EGFP fluorescent intensity by 81% (Fig. 7B, lane 2). The RNAi showed persistency either in transient assays when cells can divide or in baculovirus infection when infected cells stopped dividing due to infection. 4. Discussion We are reporting here the establishment of a universal transgene silencing mechanism in the baculovirus–insect cells system. Three criteria needed to be taken into consideration in

Fig. 7. (A) RNAi persistence in Sf9 cells during transient assays. Lane 1, Sf9 cells transfected with 1 ␮g of pAnti-EG; lane 2, Sf9 cells transfected with 1 ␮g of pEG; lane 3, Sf9 cells transfected with 1 ␮g of pEG + 0.5 ␮g siRNA; lane 4, Sf9 cells co-transfected with 1 ␮g of pEG and 0.5 ␮g siRNA 6 days prior to a second transfection with another 1 ␮g of pEG. (B) RNAi persistence in Sf9 cells during viral infection with Ac-EG virus at an MOI of 5. Some Sf9 cells were transfected with 2.5 ␮g siRNA prior to infection (Ac-EG/SiRNA) and some were not. The expression of EGFP was measured in the infected cells at 2 and 4 days post-infection (lanes 1 and 2, respectively).

order to knock down the expression of any gene of interest by targeting its 3 end: (1) to have a consistent RNA interference target sequence downstream of the gene of interest mRNA, (2) to ensure independent translation of the gene of interest to maintain its biological activity and (3) to keep an optimal level of expression of the gene of interest. All criteria were accomplished by producing a bicistronic RNA in Sf9 cells, where the first cistron would be the gene of interest. For this study, the LqqIT2 (capdependent translation) was chosen, and the second cistron was the EGFP (IRES-dependent translation). In order to target the EGFP for degradation by triggering the RNAi machinery two molecules were used, the siRNA and inverted repeats of EGFP separated by a DNA spacer of 200 bp from the IRES fragment from ECMV. The same length of DNA spacers has been successfully used before, from the lacZ and Zeocin genes (Giordano et al., 2002; Paddison et al., 2002). The length of the DNA spacer seems to be critical, since the use of a 330 bp fragment of GFP was functional while the reduction of the fragment size to 150 bp was not (Piccin et al., 2001). In this study, stable gene suppression showed low efficiency in uninfected as well as baculovirus infected Sf9IR-EG cells. This could be related to the type of promoter that controlled the IR-EG expression. Similar results have been described when Drosophila transgenes, transcribing either the sense or the antisense strand of the white gene, showed no significant reduction of the gene expression or no triggering of RNAi (Giordano et

Author's personal copy

T.Z. Salem, J.E. Maruniak / Journal of Virological Methods 145 (2007) 1–8

al., 2002). However, the stable silencing efficiency is improved when inducible promoters are used such as GALA-UAS in Drosophila (Piccin et al., 2001) or heat shock promoter (hsp 16-2) in nematodes (Tavernarakis et al., 2000). On the contrary stable gene silencing using siRNA in mammalian cells shows up to 86% suppression of luciferase activity (Miyagishi and Taira, 2002). The concentration of RNAi inducers used was very important for EGFP suppression in Sf9 cells as well as in insects whether infected or uninfected (Kramer and Bentley, 2003; Flores-Jasso et al., 2004). The viral inoculation right after transfection by the siRNA was easier to handle and was more efficient in gene silencing during viral infection. In this study, the EGFP was suppressed efficiently during baculovirus infection at MOIs of 1, 5, 10 and 100, higher than MOIs than those used in other studies (Flores-Jasso et al., 2004; Valdes et al., 2003). The use of bicistronic mRNA is very important in overcoming the protein misfolding and the biological inactivation that could result from protein fusion. Recently, this became possible in insects after the discovery of different insect viruses using IRESs in translation (Woolaway et al., 2001; Domier and McCoppin, 2003; Masoumi et al., 2003; Royall et al., 2004). The Sf9 cells transfected with pLE to produce the fused LqqIT2EGFP mRNA showed low levels of EGFP expression despite it being based on cap-dependent translation, while Ac-EL (with the EGFP positioned first in the fusion protein) showed proper EGFP expression. RhPV 5 -IRES was the most efficient IRES tested for internal translation in Sf9 cells. The RhPV 5 -IRES and RhPV IG-IRES have been successful for internal translation of the firefly luciferase (F-luciferase) gene as a second cistron during viral infection with baculovirus (Domier and McCoppin, 2003). Sf9 cells transfected with pLE-IRES showed less internal translation of EGFP when compared to cap-dependent translation. However, bicistronic RNAs express each protein separately and are subject to degradation when its 3 end is targeted by siRNA (Mangeot et al., 2004). The advantage of using bicistronic RNA resides in keeping the efficient expression level of the gene of interest, expressed by a cap-dependent translation, while the level of the internal translation of the marker gene was sufficient to be detected by western blot. The use of bicistronic RNA as an alternative to fusion could facilitate the generalization of gene silencing in uninfected and baculovirus infected Sf9 cells without losing the biological activity or the level of expression of any gene of interest. Similar results have been obtained in mammalian cells where the IRES bicistronic lentiviral vector had both transgenes silenced by a specific siRNA targeting the second cistron (Mangeot et al., 2004). Moreover, recombinant baculoviruses producing bicistronic RNAs of several toxins can be used to improve baculoviruses as biopesticides. The persistence of RNAi in Sf9 cells was addressed in this study. Uninfected Sf9 cells maintained their gene silencing capability for up to 8 days after the initial triggering of RNAi. This persistence was maintained even after the cells had divided at least two times since the cells were split twice upon cell confluence. The fact that daughter cells triggered RNAi could be explained either by the existence of a cellular signal capable of moving from old cells to newly generated cells or

7

by inheriting RNAi. This result was similar to a study done in Sf21 cells, a parental insect cell line of Sf9, showing that siRNA was stable in those cells for 9 days (Flores-Jasso et al., 2004). Although Drosophila is believed not to conserve the systemic aspects of RNAi (Roignant et al., 2003), it is postulated that Drosophila can inherit RNAi to the next generation (Kennerdell and Carthew, 2000). RNAi persistence was also obtained in Sf9 cells infected with baculovirus. In this case, the infected cells stopped dividing due to viral infection, but the silencing effect was observed until the fourth day of infection. More studies need to be done to understand the actual mechanism of gene suppression persistence. Acknowledgements We express our appreciation to Dr. Leslie Domier from University of Illinois at Urbana-Champaign, USA for providing the 5 RLIGEL plasmid. We kindly thank Dr. Alejandra GarciaMaruniak for her help in reviewing this manuscript. This work was supported by Agricultural Genetic Engineering Research Institute (AGERI) in Egypt, the Institute of International Education (IIE) and the Egypt Development Training II Project (DT2). References Agrawal, N., Malhotra, P., Bhatnagar, R.K., 2004. siRNA-directed silencing of transgene expressed in cultured insect cells. Biochem. Biophys. Res. Commun. 320, 428–434. Aoki, Y., Cioca, D., Oidaira, H., Kamiya, J., Kiyosawa, K., 2003. RNA interference may be more potent than antisense RNA in human cancer cell lines. Clin. Exp. Pharmacol. Physiol. 30, 96–102. Bernstein, E., Caudy, A.A., Hammond, S.M., Hannon, G.J., 2001. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 409, 363–366. Bettencourt, R., Terenius, O., Faye, I., 2002. Hemolin gene silencing by ds-RNA injected into Cecropia pupae is lethal to next generation embryos. Insect Mol. Biol. 11, 267–271. Carter, P.S., Jarquin-Pardo, M., De Benedetti, A., 1999. Differential expression of Myc1 and Myc2 isoforms in cells transformed by eIF4E: evidence for internal ribosome repositioning in the human c-myc 5 UTR. Oncogene 18, 4326–4335. Chuang, C.-F., Meyerowitz, E.M., 2000. Specific and heritable genetic interference by doublestranded RNA in Arabidopsis thaliana. Proc. Natl. Acad. Sci. 97, 4985–4990. Domier, L.L., McCoppin, N.K., 2003. In vivo activity of Rhopalosiphum padi virus internal ribosome entry sites. J. Gen. Virol. 84, 415–419. Domier, L.L., McCoppin, N.K., D’Arcy, C.J., 2000. Sequence Requirements for Translation Initiation of Rhopalosiphum padi Virus ORF2. Virology 268, 264–271. Elbashir, S.M., Lendeckel, W., Tuschl, T., 2001. RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev. 15, 188–200. Finkelstein, Y., Faktor, O., Elroy-Stein, O., Levi, B.Z., 1999. The use of bi-cistronic transfer vectors for the baculovirus expression system. J. Biotechnol. 75, 33–44. Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E., Mello, C.C., 1998. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391, 806–811. Flores-Jasso, C.F., Valdes, V.J., Sampieri, A., Valadez-Graham, V., RecillasTarga, F., Vaca, L., 2004. Silencing structural and nonstructural genes in baculovirus by RNA interference. Virus Res. 102, 75–84. Fortier, E., Belote, J.M., 2000. Temperature-dependent gene silencing by an expressed inverted repeat in Drosophila. Genesis 26, 240–244.

Author's personal copy

8

T.Z. Salem, J.E. Maruniak / Journal of Virological Methods 145 (2007) 1–8

Giordano, E., Rendina, R., Peluso, I., Furia, M., 2002. RNAi triggered by symmetrically transcribed transgenes in Drosophila melanogaster. Genetics 160, 637–648. Hellen, C.U., Sarnow, P., 2001. Internal ribosome entry sites in eukaryotic mRNA molecules. Genes Dev. 15, 1593–1612. Hemann, M.T., Fridman, J.S., Zilfou, J.T., Hernando, E., Paddison, P.J., CordonCardo, C., Hannon, G.J., Lowe, S.W., 2003. An epi-allelic series of p53 hypomorphs created by stable RNAi produces distinct tumor phenotypes in vivo. Nat. Genet. 33, 396–400. Hernandez-Crespo, P., Sait, S.M., Hails, R.S., Cory, J.S., 2001. Behavior of a recombinant baculovirus in lepidopteran hosts with different susceptibilities. Appl. Environ. Microbiol. 67, 1140–1146. Ikeda, M., Yanagimoto, K., Kobayashi, M., 2004. Identification and functional analysis of Hyphantria cunea nucleopolyhedrovirus iap genes. Virology 321, 359–371. Jang, S.K., Pestova, T.V., Hellen, C.U., Witherell, G.W., Wimmer, E., 1990. Cap-independent translation of picornavirus RNAs: structure and function of the internal ribosomal entry site. Enzyme 44, 292–309. Kennerdell, J.R., Carthew, R.W., 2000. Heritable gene silencing in Drosophila using doublestranded RNA. Nat. Biotechnol. 18, 896–898. Kramer, S.F., Bentley, W.E., 2003. RNA interference as a metabolic engineering tool: potential for in vivo control of protein expression in an insect larval model. Metab. Eng. 5, 183–190. Kunimi, Y., Fuxa, J.R., Hammock, B.D., 1996. Comparison of wild type and genetically modified nuclear polyhedrosis viruses of Autographa californica for mortality, virus replication and polyhedra production in Trichoplusia ni larvae. Entomol. Exp. Appl. 81, 251–257. Lin, C.C., Hsu, J.T., Huang, K.L., Tang, H.K., Lai, Y.K., 2006. Stable RNA interference in Spodoptera frugiperda cells by a DNA vector-based method. Biotechnol. Lett. 28, 271–277. Maeda, S., Volrath, S.L., Hanzlik, T.N., Harper, S.A., Majima, K., Maddox, D.W., Hammock, B.D., Fowler, E., 1991. Insecticidal effects of an insectspecific neurotoxin expressed by a recombinant baculovirus. Virology 184, 777–780. Mangeot, P.E., Cosset, F.L., Colas, P., Mikaelian, I., 2004. A universal transgene silencing method based on RNA interference. Nucleic Acids Res. 32, e102. Martinek, S., Young, M.W., 2000. Specific genetic interference with behavioral rhythms in Drosophila by expression of inverted repeats. Genetics 156, 1717–1725. Maruniak, J.E., Garcia-Maruniak, A., Souza, M.L., Zanotto, P.M., Moscardi, F., 1999. Physical maps and virulence of Anticarsia gemmatalis nucleopolyhedrovirus genomic variants. Arch. Virol. 144, 1991–2006. Masoumi, A., Hanzlik, T.N., Christain, P.D., 2003. Functionality of the 5 - and intergenic IRES elements of cricket paralysis virus in a range of insect cell lines, and its relationship with viral activities. Virus Res. 2, 113–120. McCutchen, B.F., 2001. Production of recombinant baculoviruses. US Patent 6,322,781 B1. McCutchen, B.F., Choudary, P.V., Crenshaw, R., Maddox, D., Kamita, S.G., Palekar, N., Volrath, S., Fowler, E., Hammock, B.D., Maeda, S., 1991. Development of a recombinant baculovirus expressing an insect-selective neurotoxin: potential for pest control. Biotechnology 9, 848–852. McManus, M.T., Haines, B.B., Dillon, C.P., Whitehurst, C.E., Van Parijs, L., Chen, J., Sharp, P.A., 2002. Small interfering RNA-mediated gene silencing in T lymphocytes. J. Immunol. 169, 5754–5760.

Means, J.C., Muro, I., Clem, R.J., 2003. Silencing of the baculovirus Op-iap3 gene by RNA interference reveals that it is required for prevention of apoptosis during Orgyia pseudotsugata M. nucleopolyhedrovirus infection of Ld652Y cells. J. Virol. 77, 4481–4488. Miyagishi, M., Taira, K., 2002. U6 promoter-driven siRNAs with four uridine 3 overhangs efficiently suppress targeted gene expression in mammalian cells. Nat. Biotechnol. 20, 497–500. O’Reilly, D.R., Miller, L.K., Luckow, V.A., 1994. Baculovirus Expression Vectors: A Laboratory Manual, 2 ed. Oxford University Press, New York, NY. Paddison, P.J., Caudy, A.A., Bernstein, E., Hannon, G.J., Conklin, D.S., 2002. Short hairpin RNAs (shRNAs) induce sequence-specific silencing in mammalian cells. Genes Dev. 16, 948–958. Piccin, A., Salameh, A., Benna, C., Sandrelli, F., Mazzotta, G., Zordan, M., Rosato, E., Kyriacou, C.P., Costa, R., 2001. Efficient and heritable functional knock-out of an adult phenotype in Drosphila using a GAL4-driven hairpin RNA incorporating a heterologous spacer. Nucleic Acids Res. 29, E55–E65. Provost, P., Dishart, D., Doucet, J., Frendewey, D., Samuelsson, B., R˚admark, O., 2002. Ribonuclease activity and RNA binding of recombinant human Dicer. EMBO J. 21, 5864–5874. Quan, G.X., Kanda, T., Tamura, T., 2002. Induction of the white egg3 mutant phenotype by injection of the double-stranded RNA of the silkworm white gene. Insect Mol. Biol. 11, 217–222. Roignant, J.Y., Carre, C., Mugat, B., Szymczak, D., Lepesant, J.A., Antoniewski, C., 2003. Absence of transitive and systemic pathways allows cell-specific and isoform-specific RNAi in Drosophila. RNA 9, 299–308. Royall, E., Woolaway, K.E., Schacherl, J., Kubick, S., Belsham, G.J., Roberts, L.O., 2004. The Rhopalosiphum padi virus 5 internal ribosome entry site is functional in Spodoptera frugiperda 21 cells and in their cell-free lysates: implications for the baculovirus expression system. J. Gen. Virol. 85, 1565–1569. Steward, L.M.D., Hirst, M., Ferber, M.L., Merryweather, A.T., Cayley, P.J., Possee, R.D., 1991. Construction of an improved baculovirus insecticide containing an insect-specific toxin gene. Nature 352, 85–88. Sui, G., Soohoo, C., Affar, E.B., Gay, F., Shi, Y., Forrester, W.C., Shi, Y., 2002. A DNA vector based RNAi technology to suppress gene expression in mammalian cells. Proc Natl. Acad. Sci. 99, 5515–5520. Tavernarakis, N., Wang, S.L., Dorovkov, M., Ryazanov, A., Driscoll, M., 2000. Heritable and inducible genetic interference by double-stranded RNA encoded by transgenes. Nat. Genet. 24, 180–183. Theilmann, D.A., Stewart, S., 1992. Molecular analysis of the trans-activating IE-2 gene of Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus. Virology 187, 84–96. Valdes, V.J., Sampieri, A., Sepulveda, J., Vaca, L., 2003. Using dsRNA to prevent viral infections in vitro and in vivo by recombinant baculoviruses. J. Biol. Chem. 278, 19317–19324. Woolaway, K.E., Lazaridis, K., Belsham, G.J., Carter, M.J., Roberts, L.O., 2001. The 5 untranslated region of Rhopalosiphum padi virus contains an internal ribosome entry site which functions efficiently in mammalian, plant, and insect translation systems. J. Virol. 75, 10244–10249. Zaki, T.I., Maruniak, J.E., 2003. Three polymorphic genes encoding a depressant toxin from the Egyptian scorpion Leiurus quinquestriatus quinquestriatus. Toxicon 41, 109–113.