Toxicon 41 (2003) 109–113 www.elsevier.com/locate/toxicon

Three polymorphic genes encoding a depressant toxin from the Egyptian scorpion Leiurus quinquestriatus quinquestriatus Tamer I. Zakia,b,1, James E. Maruniaka,c,* a

Department of Microbiology and Cell Science, University of Florida, P.O. Box 110620, Gainesville, FL 32611, USA b Agricultural Genetic Engineering Research Institute (AGERI), Agricultural Research Center (ARC), Giza, Egypt c Department of Entomology and Nematology, University of Florida, P.O. Box 110620, Gainesville, FL 32611, USA Received 24 May 2002; accepted 2 August 2002

Abstract Four clones encoding the insect depressant toxin LqqIT2 have been isolated from the Egyptian scorpion Leiurus quinquestriatus quinquestriatus using RT-PCR. The four clones have been sequenced and their deduced amino acid sequences have been compared with the original amino acid sequence determined from the purified LqqIT2 protein and polymorphisms have been shown. This study succeeded in isolating more than one copy of the LqqIT2 gene, although only one amino acid sequence has been identified from the purified LqqIT2 toxin. q 2002 Elsevier Science Ltd. All rights reserved. Keywords: Scorpion; RT-PCR; Gene polymorphism; Toxin

1. Introduction Of an estimated 1500 distinct species of scorpion found worldwide the venoms of only 30 species of scorpions have been characterized. From about 100,000 different polypeptides estimated to the venoms of all these species, only 0.02% have been defined (Possani et al., 2000). Polymorphism of venoms is a common phenomenon among scorpions, and it can occur due to changes in sex, age, diet, or geographic origin (El Ayeb and Rochat, 1985). Variations have been found in scorpion toxins at an individual level (El Ayeb and Rochat, 1985; Martin et al., 1987; Froy et al., 1999). However, scorpions also display extraordinary Abbreviations: RT-PCR, reverse transcriptase/polymerase chain reaction; LqqIT2, Leiurus quinquestriatus quinquestriatus insect toxin 2. * Corresponding author. Address: Department of Entomology and Nematology, University of Florida, P.O. Box 110620, Gainesville, FL 32611, USA. Tel.: 352-392-1901x148; fax: 352-392-0190. E-mail addresses: [email protected] (J.E. Maruniak), [email protected] (T.I. Zaki). 1 Tel.: 352-392-1901x203.

intraspecific polymorphism in the rDNA regions (Ben Ali et al., 2000). Many toxins of the Egyptian scorpion Leiurus quinquestriatus quinquestriatus (Lqq) have been studied in detail at the amino acid level (Kopeyan et al., 1990, 1993; Miranda et al., 1970; Angelides and Nutter, 1983; Landon et al., 1996, 1997; Cestele et al., 1997; Maertens et al., 2000) but not at the DNA level. In contrast, many toxins of L. q. hebraeus (Lqh) have been studied intensively at the DNA level (Gurevitz et al., 1991; Zilberberg et al., 1992, 1993; Chejanovsky et al., 1995; Gershburg et al., 1998). LqqIT2 and LqhIT2 are two depressant insect toxins derived from the scorpion Lqq (Kopeyan et al., 1990) and Lqh (Zlotkin et al., 1991), respectively. The depressant toxins produce an inhibition of the insect excitability due to depolarization of the nerve axon. The present study reports on the DNA sequence of the LqqIT2 toxin and the polymorphism found at the nucleotide level. The information obtained was compared to the LqhIT2 cDNA published sequence (Zilberberg et al., 1992). The deduced amino acid sequences obtained from four LqqIT2 clones were also compared to the actual amino acid sequences of both LqqIT2 (Kopeyan et al., 1990) and LqhIT2 (Zlotkin et al., 1991) purified toxins.

0041-0101/03/$ - see front matter q 2002 Elsevier Science Ltd. All rights reserved. PII: S 0 0 4 1 - 0 1 0 1 ( 0 2 ) 0 0 2 4 2 - 8

110

T.I. Zaki, J.E. Maruniak / Toxicon 41 (2003) 109–113

2. Materials and methods 2.1. Isolation of total RNA Egyptian scorpions, Lqq, were collected from upper Egypt close to Lake Nasser. Total RNA was extracted from 2 g of telsons (from ,20 scorpions) according to the recommendations from the Total RNA Isolation Kit (Invitrogen, San Diego, USA). 2.2. Primer design The primers were designed using the sequence information from Lqh (Zilberberg et al., 1992). The forward primer was designed to anneal to the first 25 nucleotides of the signal peptide sequence beginning at the ATG start codon. The reverse primer was designed to anneal at the end of the coding region with the exception of the sequence encoding GKK, which are the three amino acids at the C terminus removed prior to maturation of the toxin (since the resulting cDNA will be expressed later on in the baculovirus expression system). The sequence of the forward primer was 5 0 ATGAAACTCTTACTTTTACTCATTG30 and the reverse primer was 5 0 TTAACCGCATGTGTTTGTTT CAC30 . 2.3. RT-PCR The RT-PCR reaction was performed according to Simon et al. (1994). The amplification of the target cDNA (LqqIT2) was done using Elongase enzyme (Life Technologies) with proofreading capability. 2.4. Cloning and sequencing The PCR product was cloned in the PCRII vector (Invitrogen) in Top 10 E. coli strain. Four colonies were selected and their plasmids were isolated, sequenced three times from the 50 direction and three times from the 30 direction.

3. Results and discussion The analysis of the four LqqIT2 clones (clones 6, 7, 8, and 9) showed that there were different nucleotide sequences encoding the LqqIT2 toxin (Fig. 1). Two of the four clones (LqqIT2 clones 8 and 9) had the exact same sequence. The sequences of the LqqIT2 clones were compared to the published nucleotide sequence of the LqhIT2 (Zilberberg et al., 1992). LqqIT2 clone 6 presented seven nucleotide differences, clone 7 showed eight differences, and clones 8 and 9 had five nucleotides different from the published LqhIT2 toxin (Zilberberg et al., 1992). All the four clones had one nucleotide modification (C instead of T)

located in the signal peptide sequence (underlined region in Fig. 1). When the amino acid sequence was deduced from the nucleotide sequence of the clones, the modification found in the signal peptide region did not result in a different amino acid compared with the deduced amino acid sequence of the published LqhIT2 isoleucine (I) (Fig. 1). All the other nucleotide changes resulted in a different deduced amino acid. The deduced amino acid sequences of the four LqqIT2 RT-PCR clones were compared to the amino acid sequences obtained from the actual amino acid sequence of the purified toxins from LqqIT2 (Kopeyan et al., 1990) and LqhIT2 (Zlotkin et al., 1991) (Fig. 2). The deduced amino acid sequence of LqqIT2 clone 7 was most similar to the sequence of the purified LqqIT2 toxin with only one amino acid change: aspartic acid (D) instead of glutamic acid (E) in position 50. Clones 6, 8, and 9 presented more amino acid modifications compared to the LqqIT2 toxin protein sequence. However, when an amino acid was found different from the actual amino acid sequence of the purified LqqIT2 toxin, the new amino acid was the same found in the amino acid sequence of the purified LqhIT2 toxin protein sequence. There are eight amino acid differences between the actual LqqIT2 (Kopeyan et al., 1990) and LqhIT2 (Zlotkin et al., 1991) toxins in amino acid positions 5, 6, 12, 13, 16, 22, 27, and 50 (Fig. 2), and the polymorphism found in the clones studied was restricted to only those same eight amino acids. The amino acids numbers 5 and 6 are lysine (K) and arginine (R) in LqhIT2 and RK in LqqIT2. This change was found conserved in the LqqIT2 clones. Leucine (L) at position 12 in LqqIT2 is a valine (V) in LqhIT2. Valine (V) was found in clones 6, 8, and 9. Serine (S) and phenylalanine (F) at the actual LqqIT2 positions 13 and 16, respectively, were conserved in all the clones (6 – 9), yet different from the alanine (A) and isoleucine (I) found in those same positions of the actual LqhIT2. In position 22 only clone 7 conserved the asparagine (N), while the other three clones (6, 8, and 9) presented aspartic acid (D) as in case of the actual LqhIT2 toxin. A similar change occurred in position 50 where only clone 6 conserved glutamic acid (E) found in the actual amino acid sequence of the purified LqqIT2 toxin. Finally in position 27, serine (S) was found in two clones (6 and 7). The total amino acid homology of the deduced amino acid sequence of clones 6, 7, and 8 was 96, 98 and 93%, respectively, with the amino acid sequence of the purified LqqIT2 protein and 90, 88, and 93% with the actual amino acid sequence of the purified LqhIT2 toxin. The deduced amino acids were conserved in all four clones at positions 5, 6, 13, and 16 and were the same in the amino acid sequence of the purified LqqIT2 toxin. The polymorphisms found among the four clones were in amino acid positions 12, 22, 27, and 50 and the modified amino acids have been always reported in the actual amino acid sequence of the purified LqhIT2 toxin.

T.I. Zaki, J.E. Maruniak / Toxicon 41 (2003) 109–113

111

Fig. 1. Comparison between the nucleotide sequence of the depressant insect toxin cDNA derived from Lqh (LqhIT2) (Zilberberg et al., 1992) and the four clones isolated from the Lqq (LqqIT2 clones 6, 7, 8, and 9). The sequence encoding the mature protein is between nucleotides 64 and 246. The nucleotide sequence from 1 to 63 representing the single peptide sequence is underlined. The identity between the LqhIT2 and the four clones is indicated by dashes. The deduced amino acids of the LqhIT2 are shown in capital letters and the different deduced amino acids among the four LqqIT2 clones are shown in small letters. Arrows designate the additional Gly –Lys–Lys (GKK) at the carboxy terminus and small italic letters indicate a potential polyadenylation site.

The polymorphism in the genes was detected in individual scorpions (Froy et al., 1999) suggesting the existence of more than one copy of some toxin genes, or differential post-translation modification of some genes under different conditions. Since the homology among these genes is high, it will be difficult to determine how many

forms of these genes exist using PCR or hybridization techniques. The variations among the LqqIT2 clones were restricted to four amino acids compared to the sequence of the actual purified LqqIT2 and restricted to the amino acids presented in one of the two purified toxin proteins (LqqIT2 and

112

T.I. Zaki, J.E. Maruniak / Toxicon 41 (2003) 109–113

Fig. 2. Comparison among the amino acid sequences of LqhIT2 and LqqIT2 and the deduced amino acids from the LqqIT2 clones (6–9). The identical amino acids among the sequences are indicated by dashes. The amino acids identical to the LqhIT2 are shown underlined, while those identical to LqqIT2 are represented in bold.

LqhIT2). The existence of these forms may be related to: (1) existence of more than one allele in the genome, (2) the lack of scorpion classification beyond subspecies Lqq, (3) expression of different genes during development. The polymorphism among scorpions may be due to age, season, and geographical distribution (El Ayeb and Rochat, 1985), and this may be due to switching on and off of certain genes in different stages or under certain conditions. Further studies need to be done to determine how many copies of the toxin gene are in the genome of each scorpion, and if the toxin sequence of an individual changes by age, time, season, or geographical distribution.

Acknowledgements This work was supported by Agricultural Genetic Engineering Research Institute (AGERI) in Egypt, the Institute of International Education (IIE) and the Egypt Development Training II Project (DT2). We thank Drs Alejandra Maruniak, James Preston and William B. Gurley for their help with this manuscript. Florida Agricultural Experiment Station Journal Series No. R-08714.

References Angelides, K.J., Nutter, T.J., 1983. Mapping the molecular structure of the voltage-dependent sodium channel. Distances between the tetrodotoxin and Leiurus quinquestriatus quinquestriatus scorpion toxin receptors. J. Biol. Chem. 258 (19), 11958– 11967. Ben Ali, Z., Boursot, P., Said, K., Lagnel, J., Chatti, N., Navajas, M., 2000. Comparison of ribosomal ITS regions among Androctonus spp. sorpions (Scorpionida: Buthidae) from Tunisia. J. Med. Entomol. 37 (6), 787–790. Cestele, S., Gordon, D., Kopeyan, C., Rochat, H., 1997. Toxin III from Leiurus quinquestriatus quinquestriatus: a specific probe for receptor site 3 on insect sodium channels. Insect Biochem. Mol. Biol. 27 (6), 523 –528. Chejanovsky, N., Zilberberg, N., Rivkin, H., Zlotkin, E., Gurevitz, M., 1995. Functional expression of an alpha anti-insect scorpion

neurotoxin in insect cells and lepidopterous larvae. FEBS Lett. 376 (3), 181–184. El Ayeb, M., Rochat, H., 1985. Polymorphism and quantitative variations of toxins in the venom of the scorpion Androctonus australis Hector. Toxicon 23 (5), 755–760. Froy, O., Sagiv, T., Poreh, M., Urbach, D., Zilberberg, N., Gurevitz, M., 1999. Dynamic diversification from a putative common ancestor of scorpion toxins affecting sodium, potassium, and chloride channels. J. Mol. Evol. 48 (2), 187–196. Gershburg, E., Stockholm, D., Froy, O., Rashi, S., Gurevitz, M., Chejanovsky, N., 1998. Baculovirus-mediated expression of a scorpion depressant toxin improves the insecticidal efficacy achieved with excitatory toxins. FEBS Lett. 422 (2), 132–136. Gurevitz, M., Urbach, D., Zlotkin, E., Zilberberg, N., 1991. Nucleotide sequence and structure analysis of a cDNA encoding an alpha insect toxin from the scorpion Leiurus quinquestriatus hebraeus. Toxicon 29 (10), 1270–1272. Kopeyan, C., Mansuelle, P., Sampieri, F., Brando, T., Bahraoui, E.M., Rochat, H., Granier, C., 1990. Primary structure of scorpion anti-insect toxins isolated from the venom of Leiurus quinquestriatus quinquestriatus. FEBS Lett. 261 (2), 423–426. Kopeyan, C., Mansuelle, P., Martin-Eauclaire, M.F., Rochat, H., Miranda, F., 1993. Characterization of toxin III of the scorpion Leiurus quinquestriatus quinquestriatus: a new type of alphatoxin highly toxic both to mammals and insects. Nat. Toxins 1 (5), 308– 312. Landon, C., Cornet, B., Bonmatin, J.M., Kopeyan, C., Rochat, H., Vovelle, F., Ptak, M., 1996. 1H-NMR-derived secondary structure and the overall fold of the potent anti-mammal and anti-insect toxin III from the scorpion Leiurus quinquestriatus quinquestriatus. Eur. J. Biochem. 236 (2), 395–404. Landon, C., Sodano, P., Cornet, B., Bonmatin, J.M., Kopeyan, C., Rochat, H., Vovelle, F., Ptak, M., 1997. Refined solution structure of the anti-mammal and anti-insect LqqIII scorpion toxin: comparison with other scorpion toxins. Proteins 28 (3), 360 –374. Maertens, C., Wei, L., Tytgat, J., Droogmans, G., Nilius, B., 2000. Chlorotoxin does not inhibit volume-regulated, calcium-activated and cyclic AMP-activated chloride channels. Br. J. Pharmacol. 129 (4), 791–801. Martin, M.F., Rochat, H., Marchot, P., Bougis, P.E., 1987. Use of high performance liquid chromatography to demonstrate quantitative variation in components of venom from the scorpion Androctonus australis Hector. Toxicon 25 (5), 569 –573.

T.I. Zaki, J.E. Maruniak / Toxicon 41 (2003) 109–113 Miranda, F., Kupeyan, C., Rochat, H., Rochat, C., Lissitzky, S., 1970. Purification of animal neurotoxins. Isolation and characterization of eleven neurotoxins from the venoms of the scorpions Androctonus australis Hector, Buthus occitanus tunetanus and Leiurus quinquestriatus quinquestriatus. Eur. J. Biochem. 16 (3), 514–523. Possani, L.D., Merino, E., Corona, M., Bolivar, F., Becerril, B., 2000. Peptides and genes coding for scorpion toxins that affect ion-channels. Biochimie 82 (9–10), 861 –868. Simon, M.M., Palmetshofer, A., Schwarz, T., 1994. From RNA to sequenced clones within three days: a complete protocol. Biotechniques 16 (4), 633–636, also p. 638.

113

Zilberberg, N., Gurevitz, M., 1993. Rapid isolation of full length cDNA clones by inverse PCR: purification of a scorpion cDNA family encoding alpha-neurotoxins. Anal. Biochem. 209 (1), 203 –205. Zilberberg, N., Zlotkin, E., Gurevitz, M., 1992. Molecular analysis of cDNA and the transcript encoding the depressant insect selective neurotoxin of the scorpion Leiurus quinquestriatus hebraeus. Insect Biochem. Mol. Biol. 22 (2), 199–203. Zlotkin, E., Eitan, M., Bindokas, V.P., Adams, M.E., Moyer, M., Burkhart, W., Fowler, E., 1991. Functional duality and structural uniqueness of depressant insect-selective neurotoxins. Biochemistry 30 (19), 4814–4821.