A. thaliana Jan. 2004 chr3:7,249,614-7,249,727 (114 bp) Window Position chr3: 7249630 7249640 7249650 7249660 7249670 7249680 7249690 7249700 7249710 7249720 ---> AATATCACACAT TGGAACCGGGTATCT TAATAGAACATCTGAAGCTCCCTGCAAACCACAAAAAGT TCAACTGTAAATATATGTGATGAAATGAATGAT TATGT TGTGT T TGGA Q I S H I G T G Y L N R T S E A P C K P Q K V Q L * I Y V M K * M I M L C L E K Y H T L E P G I L I E H L K L P A N H K K F N C K Y M * * N E * L C C V W S N I T H W N R V S * * N I * S S L Q T T K S S T V N I C D E M N D Y V V F G TAIR7 Annotations (green=protein-coding gene, red=pseudogene/transposon, others=various RNA types) D C M P V P Y R L L V D S A G AT3G20740.1 I 7_ Log_2 Ratio Columbia WT PolII/WTA PM Unique (TAS 1.1.02 bpmapNewer tpmap.mT.3) Lg(PolII/WTA)

0-7 _ 0.219628 _

Mononucleosomes: Ratio Frag. Len. (empir. from paired-ends) Smeared Uniq. Unistrand Dens. to 1x Uniform Theory

0.134829 _ 0.0225 _

Nucleosome Prediction Probabilities via Segal, et al. (based only on genomic sequence)

Nuc. Dens.

NucSegalPreds 4.7e-05 _ H3K4m1:TMapHMM H3K4m2:TMapHMM H3K4m3:TMapHMM H3K9m2MD:ZLrToH3 H3K9m2CL:ZLrToH3

Histone H3K4 Monomethylation to H3 -> TileMap HMM Histone H3K4 Dimethylation to H3 -> TileMap HMM Histone H3K4 Trimethylation to H3 -> TileMap HMM Z-Scores of NimbleGen Log Ratios Histone H3K9 Dimethylation to H3 via MNase Digestion Z-Scores of NimbleGen Log Ratios Histone H3K9 Dimethylation to H3 via Crosslinking Histone H3 Lysine K27 Trimethylation Original Unique HMM BPmap

H3K27-triMeth

LHP1 DamID HMM

LHP1 DamID HMM

LHP1 GATC Merged Low Nucleosome Density HMM

LowNucDensHMM

Methylation in Wild Type (Columbia->mCIP->bkgndCorr->uniqueProbes->TileMap pV)

Col.mCIP:buTMap

Methylation in Triple Mutant (ddc->mCIP->bkgndCorr->uniqueProbes->TileMap pV)

ddc.mCIP:buTMap met1.mCIP:buTMap Col.HMBD:buTMap

Methylation in Single Mutant (met1->mCIP->bkgndCorr->uniqueProbes->TileMap pV) Methylation in Wild Type (Columbia->HMBD->bkgndCorr->uniqueProbes->TileMap pV) Methylation in Wild Type (Columbia->mCIP->bkgndCorr->remapProbes->TileMap pV)

Col.mCIP:brTMap

Methylation in Triple Mutant (ddc->mCIP->bkgndCorr->remapProbes->TileMap pV)

ddc.mCIP:brTMap met1.mCIP:brTMap

Methylation in Single Mutant (met1->mCIP->bkgndCorr->remapProbes->TileMap pV) Methylation in Wild Type (Columbia->HMBD->bkgndCorr->remapProbes->TileMap pV)

Col.HMBD:brTMap

Nature BS-Seq + Strand Cs: 64 Wild Type Bisulfite Lanes (green=CG, blue=CHG, red=CHH; dark=methylated)

Nature BS-Seq - Strand Cs: 64 Wild Type Bisulfite Lanes (green=CG, blue=CHG, red=CHH; dark=methylated)

Simple Tandem Repeats by TRF Tandem Repeats Dispersed Repeats Inverted Repeats Small RNAs: Filtered PMs FLR Wt All 21/22/24-mers (blue/green/red) Small RNAs: Filtered PMs FLR Wt Unique 21/22/24-mers (blue/green/red) Small RNAs: Filtered PMs FLR 1a1b All 21/22/24-mers (blue/green/red) Small RNAs: Filtered PMs FLR 1a1b Unique 21/22/24-mers (blue/green/red) Small RNAs: Filtered PMs FLR Ler AGO1 All 18..24-mers (yellow/light-blue/cyan/blue/green/magenta/red) Small RNAs: Filtered PMs FLR Ler AGO1 Unique 18..24-mers (yellow/light-blue/cyan/blue/green/magenta/red) Small RNAs: Filtered PMs FLR Ler AGO4 All 21/22/24-mers (blue/green/red) Small RNAs: Filtered PMs FLR Ler AGO4 Unique 21/22/24-mers (blue/green/red) Small RNAs: Filtered PMs FLR dcl234 All 21/22/24-mers (blue/green/red) Small RNAs: Filtered PMs FLR MPSS rdr2 Collapsed All 17-mers Small RNAs: Filtered PMs FLR MPSS rdr2 Collapsed Unique 17-mers Small RNAs from MPSS Small RNAs: Bartel Lab (Rajagopalan, et al. 2006) Log_10 Expression as seen by GTAS met1.R:L10expr ddc.R:L10expr Col.R:L10expr Col.F:L10expr ddc.F:L10expr met1.F:L10expr Perfect Matches to Short Sequence (CG) Short Match Restriction Enzymes from REBASE Eco57MI AcuI TspDTI TspDTI NlaIV StyD4I ScrFI NciI HpaII MseI Hpy188I AluI CviJI HpyCH4V HpyCH4III