A. thaliana Jan. 2004 chr3:7,249,614-7,249,727 (114 bp) Window Position chr3: 7249630 7249640 7249650 7249660 7249670 7249680 7249690 7249700 7249710 7249720 ---> AATATCACACAT TGGAACCGGGTATCT TAATAGAACATCTGAAGCTCCCTGCAAACCACAAAAAGT TCAACTGTAAATATATGTGATGAAATGAATGAT TATGT TGTGT T TGGA Q I S H I G T G Y L N R T S E A P C K P Q K V Q L * I Y V M K * M I M L C L E K Y H T L E P G I L I E H L K L P A N H K K F N C K Y M * * N E * L C C V W S N I T H W N R V S * * N I * S S L Q T T K S S T V N I C D E M N D Y V V F G TAIR7 Annotations (green=protein-coding gene, red=pseudogene/transposon, others=various RNA types) D C M P V P Y R L L V D S A G AT3G20740.1 I 7_ Log_2 Ratio Columbia WT PolII/WTA PM Unique (TAS 1.1.02 bpmapNewer tpmap.mT.3) Lg(PolII/WTA)
0-7 _ 0.219628 _
Mononucleosomes: Ratio Frag. Len. (empir. from paired-ends) Smeared Uniq. Unistrand Dens. to 1x Uniform Theory
0.134829 _ 0.0225 _
Nucleosome Prediction Probabilities via Segal, et al. (based only on genomic sequence)
Histone H3K4 Monomethylation to H3 -> TileMap HMM Histone H3K4 Dimethylation to H3 -> TileMap HMM Histone H3K4 Trimethylation to H3 -> TileMap HMM Z-Scores of NimbleGen Log Ratios Histone H3K9 Dimethylation to H3 via MNase Digestion Z-Scores of NimbleGen Log Ratios Histone H3K9 Dimethylation to H3 via Crosslinking Histone H3 Lysine K27 Trimethylation Original Unique HMM BPmap
H3K27-triMeth
LHP1 DamID HMM
LHP1 DamID HMM
LHP1 GATC Merged Low Nucleosome Density HMM
LowNucDensHMM
Methylation in Wild Type (Columbia->mCIP->bkgndCorr->uniqueProbes->TileMap pV)
Col.mCIP:buTMap
Methylation in Triple Mutant (ddc->mCIP->bkgndCorr->uniqueProbes->TileMap pV)
ddc.mCIP:buTMap met1.mCIP:buTMap Col.HMBD:buTMap
Methylation in Single Mutant (met1->mCIP->bkgndCorr->uniqueProbes->TileMap pV) Methylation in Wild Type (Columbia->HMBD->bkgndCorr->uniqueProbes->TileMap pV) Methylation in Wild Type (Columbia->mCIP->bkgndCorr->remapProbes->TileMap pV)
Col.mCIP:brTMap
Methylation in Triple Mutant (ddc->mCIP->bkgndCorr->remapProbes->TileMap pV)
ddc.mCIP:brTMap met1.mCIP:brTMap
Methylation in Single Mutant (met1->mCIP->bkgndCorr->remapProbes->TileMap pV) Methylation in Wild Type (Columbia->HMBD->bkgndCorr->remapProbes->TileMap pV)
Austin, Marine Science Institute (Port Aransas, TX). A post-doctoral position is available for interdisciplinary research involving the dispersion of oil spills and the interactions of oil with planktonic marine organisms. This researcher will intera
Jan 31, 2014 - Bachelors degree in Natural. Resources/Environmental Science or other similar field related to hydrology, wetlands, watershed studies, soils ...
Good knowledge in epidemiology, population dynamics and vectorial diseases ... Provide the following documents in an email to the researchers in charge of ...
conceive, design, conduct and analyze the results of laboratory studies that visualize and quantify the kinematics of zooplankton behavior. To Apply: Submit (1) ...
Sign in. Loading⦠Whoops! There was a problem loading more pages. Whoops! There was a problem previewing this document. Retrying... Download. Connect ...
Page 1 of 6. Window Notes. on Spring Weather. Facts about spring weather: What does the idiom: âIn like a lion, out. like a lambâ mean to you? Hurtful Spring Weather: Helpful Spring Weather: Name__________. While reading the article on Spring wea
standards, such as the Inter-Client Communication Conventions Manual and the X Logical Font. Description .... the depth, in which case the least significant bits are used to hold the pixmap data, and the values of the unused ...... True and the bytes
Oct 9, 2014 - Financial and Business Management System [FBMS]). 1. Percentage Of Time ... Ability to use a computer and software applications. KSA. Skills.
Systems knowledge â MS Outlook, MS Word and MS Excel. â¢. Excellent numerical and analytical skill. â¢. Excellent attention to detail and organizational abilities.
We are currently looking to hire students for our spring. Finance Internship. Location: Budapest office. Start date: Spring (February/March). Contract: 20/30/40 hours-a-week contract (flexible). Morgan Stanley is a global financial services firm and
7. 2 Jose Abreu. CWS. 7. 3 Dee Gordon. MIA. 7. 2 Adrian Beltre. TEX. 8. 2 Wil Myers. SD. 8. 3 DJ LeMahieu ... 7 Daniel Vogelbach. SEA ... 13 Max Kepler. MIN. 2.
Jan 31, 2014 - assessment and planning methods, knowledge of wetland science and the ability to develop wetland ... or a Masters Degree in related field. ... Must have proficiency in computer programs, such as Microsoft Word and ... To Apply: 1) requ
Page 1. Whoops! There was a problem loading more pages. secret window HINDI.pdf. secret window HINDI.pdf. Open. Extract. Open with. Sign In. Main menu.
replacing it with another. Doc mcstuffins s03e09.HBO Documentaries susan sontag. ... Oxford english english dictionary pdf.Window8.activator.Ultimatespider man. s03e07. The maze 1999. ... isa network oftubes or. vessels..981188604951135267. https://d
It means if the network has SIS or SUC node, d/w sensor will send to SIS or SUC node; Else, if d/w sensor has Associated Node, it will send to first associated node .If d/w sensor doesn't have Associated Node, it will send these command as broadcast.