NEW INSIGHT INTO THE ROLE OF tmRNA IN SUPPORTING PHAGE GROWTH
A THESIS SUBMITTED TO THE COUNCIL OF COLLEGE OF SCIENCE, UNIVERSITY OF SULAIMANI IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE IN MOLECULAR BIOLOGY
BY
NYAN H. SALIH ABDULQADIR B.SC. IN BIOLOGY – 2003 UNIVERSITY OF SULAIMANI
SUPERVISED BY
DR. FARHAD M. ABDULKARIM ASSISTANT PROFESSOR
JANUARY
RÉBANDAN
2011
2710
âïy‹Üa@漋Üa@a@âi
<Ğ]çŁiæ₣_<ÿà莄Ö]ÿæ<łÜÓ₣ ߎÚ<Ğ]çŁßÚÿ a<ÿà莄Ö]<Łä× Ö]<ÄÊş †ł èÿ fi fŽ}ÿ <ÿáç₣×Ûÿ Ãł iÿ<^ÿÛeŽ<Łä× Ö]ÿæ<žl^ÿq…ÿ ÿ <ÿÜ×Ğ ÃŽ ÖĞ] @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@âïÅÉÜa@a@ׇ–@ @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@H11I@óîÿa@ó܆ba@òŠí@@@@
@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
“Allah will raise those who have believed among you and those who were given knowledge, by degrees. And Allah is acquainted with what you do”.
Certification of the Supervisor I certify that this thesis was prepared under my supervision at the University of Sulaimani/ College of Science-Department of Biology and do hereby recommend to be accepted as a partial fulfillment of the requirements for the degree of Master of Science (M.Sc.) in Molecular Biology.
Signature: Supervisor: Dr. Farhad M. Abdulkarim Scientific Grade: Assistant professor Date:
/
/2010
In view of the available recommendations I forward the thesis for debate by the examining committee.
Signature: Name: Dr. Raza Hassan Hussain Chairman of Biology Dept. Date:
/
/2010
Linguistic Evaluation Certification
I hereby certify that this thesis has been checked by me and after indicating all the grammatical and spelling mistakes; the thesis was given again to the candidate to make the adequate corrections. After the second reading, I found that the candidate corrected the indicated mistakes. Therefore, I certify that this thesis is free from mistakes.
Signature: Name: Date: University of Sulaimani College of Languages English Department
Examining Committee Certification We certify that we have read this thesis entitled “New Insight into the Role of tmRNA in Supporting Phage Growth” by Nyan H. Salih Abdulqadir and as an Examining Committee we examined the student in its contents and that in our opinion it is adequate as a thesis for the degree of Master of Science (M.Sc.) in “Molecular Biology”.
Signature:
Signature: Name: Dr.
Aumaid U. Uthman
Name: Dr. Beston F. Nore
Scientific degree: professor
Scientific degree: Assistant professor
Date:
Date:
February 2011 (Chairman)
Signature: Name:
Shwan K. Rachid
February 2011 (Member)
Signature: Name: Dr.
Farhad M. Abdulkarim
Scientific degree: Assistant professor
Scientific degree: Assistant Professor
Date:
Date:
February 2011 (Member)
February 2011
(Member and Supervisor)
Approved by the Council of the College of Science
Signature: Name: Dr. Salahalddin S. Ali Dean of the College of Science Date:
February 2011
This work is dedicated to:
¾ The soul of my beloved brother ¾ All members of my beautiful family
Acknowledgements “All praises to Allah the almighty, the most merciful, and the most gracious” I wish to express my sincere appreciation to my supervisor, Dr. Farhad M. Abdulkarim, for his guidance and support during the course of this research work. His assistance and suggestions were crucial in the realization of this work. I would like to especially thank Dr. Pola and Dr. Aumaid U. Uthman, in Kurdistan Institution for Strategic Studies and Scientific Research in Sulaimani, for giving me the opportunity to use their molecular biology laboratory. I would also like to thank all the staff members of the laboratory, for their assistance and patience during the work. I would like to offer my thanks to the Deanery of College of Science and Biology Department for giving me admission into higher education and giving me an opportunity to study. My thanks go to Mr. Ahmad Nizamaddin /College of Education in Kalar for his infinite support in providing the materials required. I am also grateful for a lot of help from Dr. Shwan K Rachid in Pharmaceutical Biotechnology Department/ Saarland University-Germany for his appreciated cooperation in providing me bacteriophages. I would like to acknowledge individuals who have helped me make my thesis undertaking much easier and more importantly, successfully completed, I owe thanks to Mr. Rzgar, Mr. Dile, Mr. Blend, Mr. Rebin and Mr. Bahez. Special thanks to all members of the Veterinary Central Laboratory in Hawler/Ministry of Agriculture, especially the Director, Dr. Ilham, and Dr. Bejan. Thanks to all my colleagues in Hawler Medical Research Center and Kurdistan Institution for Strategic Studies and Scientific Research in Sulaimani, who created a nice working environment, helped me, supported me and shared their ideas, components and results with me. Special and great appreciation is due to my family and my friends for their supports and patience throughout the study.
Nyan
Abstract The trans-translation is a ubiquitous bacterial multiple quality control mechanism that ensures proteins to be synthesized with high fidelity in spite of challenges such as transcription errors, mRNA damage, and translational frameshifting. The trans-translation is performed by a ribonucleoprotein complex composed of transfer-messenger (RNA) tmRNA and the small protein B (SmpB). The current study addresses the question of whether the trans-translation model for tmRNA function can explain the requirement for tmRNA in the phage growth, particularly lambda and helper phages because they were not used before. To achieve the main goals, tmRNA region which includes ssrA gene (363bp), smpB gene (483pb) and their flanking regions, was cloned by inserting blunt-ended fragment of 1928 bp into the SmaI site of the pTZ57R plasmid. To study the role of each part of tmRNA in supporting phage growth, several structural mutations have been made using polymerase chain reaction (PCR)-based deletion. Each deleted part of tmRNA region was replaced by a DNA fragment encoding protein A (domain one) gene containing either UAA or UGA termination codons which were successfully introduced by site directed mutagenesis. Thirteen specific primers were designed to delete pseudoknot 1 (PK1), mRNA-like domain (MLD), PK2-PK4 and (MLD, PK2-PK4) separately. To produce chimeric molecules, the deleted parts were replaced by one domain protein A employing cassette mutagenesis or PCR ligation technique and ten constructs were obtained, NF1, NF2, NF3, NF4, NF5, NF7, NF8, NF9, NF10, and NF11. To ensure the presence of only the mutated copy of tmRNA region in the cell for subsequent protein and genetic analysis and to avoid the activity of wild-type tmRNA on the bacterial chromosome, endogenous studied genes were deleted using replacement technique. Thus, intermediate strains of Escherichia coli were constructed and each strain contained a recombinant temperature-sensitive pKO3 - I-
plasmid harboring in vitro altered cassette of either deleted tmRNA (pKON6), deleted smpB (pKON7) or both together (pKON8). In order to confirm the replacement of deleted part of tmRNA gene by the desired gene, protein A, nested PCR strategy and reverse transcriptase-PCR (RTPCR) were performed for all constructs in parallel with MG1655 as a control. For further confirmation, the constructs have been sequenced and the results revealed that the constructs contain right recombinant sequences. Subsequently, the obtained constructs were subjected to infection by lambda and helper phage to analyze the role of each part of tmRNA region depending on the phage assay. The results showed that all constructs supported the phage growth except for the construct NF8 in which the last three amino acids of MLD and PK2PK4 were completely deleted and they were replaced with one domain protein A gene containing UAA stop codon and the 6th and 7th codons were changed to encode serine and glycine respectively. Interestingly, the constructs, NF1, NF3, NF10, NF11, in which only tRNA-like domain (TLD) were remained, have supported the phage growth suggesting a new insight to the ribosomal transtranslation. Depending on the current results, constructs of tmRNAs with UGA stop codon supported phage growth more efficiently than those with UAA. Furthermore, it was found that the deletion of PK1, PK2-PK4, and MLD did not impair transtranslation. Thus, the constructs supported the phage growth revealing that they are not essential, instead, they play an important role in the stability of tmRNA. This work raises new questions concerning the translation machinery in E coli and the mode of action of ssrA gene. How does the ribosome choose the proper codon to resume translation on tmRNA in the absence of PK1, -1 triplet, and MLD, PK2-PK4 all together? And, what are the precise molecular mechanisms behind their supporting of phage growth regarding identification of the phage genes and protein on which ssrA gene may act on? - II-
List of Contents
LIST OF CONTENTS Subject Titles
Page
Summary …………………………………………………………………... List of Contents ………………………………………………………........ 1. List of Tables …………………………………………………………... 2. List of Figures ………………………………………………………….. List of Abbreviations ……………………………………………………... CHAPTER ONE: INTRODUCTION …………………………………. CHAPTER TWO: LITERATURES REVIEW 2.1. Ribosome structure and the mechanism of translation ………………. 2.1.1. Bacterial ribosome subunits ………………………………………… 2.1. 2. Translation ………………………………………………………… 2.1.2.1. Initiation ………………………………………………………….. 2.1.2.2. Elongation ………………………………………………………... 2.1.2.3. Termination ………………………………………………………. 2.1.2.4. Ribosome recycling ……………………………………………… 2.2. Discovery of tmRNA ………………………………………………… 2.3. The tmRNA synthesis, processing and stability ……………………... 2.4. The trans-translation …………………………………………………. 2.4.1. Molecular mechanism of trans-translation ………………………… 2.4.2 Ribosome rescue ……………………………………………………. 2.4.3. Biological roles of tmRNA ………………………………………… 2.4.4. The proteolysis of SsrA tagged polypeptides ……………………… 2.5. Phylogeny of tmRNA ………………………………………………... 2.6. The structure of tmRNA ……………………………………………... 2.6. 1. The tRNA-mimic domain …………………………………………. 2.6. 2. The Pseudoknots of tmRNA ………………………………………. 2.6. 3. The open reading frame (ORF) of tmRNA ………………………... 2.7. Protein partners of tmRNA …………………………………………… 2.7.1. SmpB, an essential partner in tagging and rescue …………………. 2.7.2. Does SmpB recognize stalled ribosomes? …………………………. 2.7.3. The elongation factor Tu (EF-Tu), the G Protein ………………….. 2.7.4. Ribosomal protein S1 ……………………………………………… 2.8. Bacteriophage ……………………………………………………….. 2.8.1. Lambda phage ……………………………………………………..
I III VIII IX XI 1
- III-
4 4 5 5 7 8 9 10 11 13 14 18 18 20 22 24 24 25 27 29 29 31 32 33 34 35
List of Contents
Subject Titles
Page
2.8.1.1. The lytic life cycle ……………………………………………….. 2.8.1.2. The temperate life cycle ………………………………………….. 2.8.1.3. The lytic and lysogenic decision …………………………………. 2.8.2. ExAssist helper phage ……………………………………………… 2.8.3. M13 phage …………………………………………………………. 2.9. Phage physiology and trans-translation ……………………………… CHAPTER THREE: MATERIALS AND METHODS 3.1. Materials …………………………………………………………….. 3.1.1. Tools and Apparatus ……………………………………………….. 3.1.2. Chemicals and Buffers ……………………………………………... 3.1.3. Enzymes and Enzyme Buffers ……………………………………... 3.1.4. Preparation of Solutions and Buffers ………………………………. 3.1.4.1. IPTG (100mM) …………………………………………………... 3.1.4.2. X-gal (20 mg/ml) ………………………………………………… 3.1.4.3. Ampicillin solution ………………………………………………. 3.1.4.4. Chloramphenicol solution ………………………………………... 3.1.5. Electrophoresis buffers and solutions ……………………………… 3.1.5.1. Ethidium bromide dye …………………………………………… 3.1.5.2. EDTA Solution (1M) ……………………………………………. 3.1.5.3. Tris-Boric acid-EDTA (TBE) buffer (5X) ………………………………….. 3.1.5.4. Loading buffer (6X) …………………………………………………………. 3.1.5.5. Rapid-screen resuspension buffer ……………………………….. 3.1.5.6. Rapid-screen lysis buffer ….……………………………………... 3.1.6. Culture Media ……………………………………………………… 3.1.6.1. Luria – Bertani broth (LB) ……………………………………….. 3.1.6.2. Terrific broth ……………………………………………………... 3.1.6.3. R top agar ………………………………………………………… 3.1.6.4. R plate .…………………………………………………………… 3.1.6.5. SM medium ……………………………………………………… 3.2. Methods ……………………………………………………………… 3.2.1. Sterilization …………………………………………………………
- IV-
36 38 39 41 41 44 46 46 46 46 46 46 47 48 48 48 48 48 48 48 49 49 49 49 50 50 51 51 51 51
List of Contents
Subject Titles
Page
3.2.2. The pH Adjustment ………………………………………………... 3.2.3. Plasmids and standard bacterial strains ……………………………. 3.2.4. Cloning vector plasmid …………………………………………….. 3.2.5. Maintenance and storage of bacterial cultures ……………………... 3.3. Primer Design ………………………………………………………... 3.4. Colony PCR protocol for tmRNA region amplification ……….…….. 3.5. Agarose gel electrophoresis protocol ………………………………… 3.6. Recovery of DNA from agarose gel …………………………………. 3.7. Digestion of PCR product ……………………………………………. 3.8. Dpn I digestion ………………………………………………………. 3.9. DNA clean up ………………………………………………………... 3.10. Exonuclease I ……………………………………………………….. 3.11. Cloning of PCR Product to ptz57R ...………………………………. 3.11.1. Plasmid preparation of ptz57R …………………………………… 3.11.2. Linearization of ptz57R ………………………………………….. 3.11.3. Vector Dephosphorylation ……………………………………….. 3.11.4. Phosphorylation of PCR product …………………………………. 3.11.5. Ligation of purified tmRNA region in to linearized pTZ57R vector 3.12. Preparation of Competent Cells and Transformation ………………. 3.12.1. Preparation of competent cell using CaCl2 ..………… …………… 3.12.2. Transformation …………………………………………………… 3.13. Confirmation of cloning ……………………………………………. 3.13.1. Blue-white selection ..……………………………………………. 3.13.2. Rapid Screening by Direct Electrophoresis ………………………. 3.13.3. Polymerase chain reaction (PCR) ………………………………… 3.13.4. Restriction digestion of recombinant plasmid ……………………. 3.14. One domain protein A ……………………………………………... 3.14.1. One domain protein A amplification …………………………….. 3.14.2. DNA clean up …………………………………………………….. 3.14.3. Dpn I digestion …………………………………………………… 3.14.4. Cloning of purified one domain protein A to pTZ57R/T ………… 3.14.5. Confirmation of cloning of one domain protein A ………………. 3.15. Creation of chimeric junctions, deletion, and insertion using PCR ….
- V-
51 51 52 52 54 62 63 64 65 66 66 68 68 68 71 71 72 72 73 73 74 75 75 75 76 77 78 78 79 79 79 80 80
List of Contents
Subject Titles
Page
3.16. Deletion of (PK1, MLD. PK2-PK4) and (MLD, PK2-PK4) ………. 3.17. One domain amplification by phusion high fidelity PCR kit ……... 3.18. PCR ligation technique …………………………………………….. 3.19. Self circulization of chimeric genes ……………………………….. 3.20. Screening of chimeric gene ………………………………………... 3.21. Cassette Mutagenesis ……………………………………………… 3.22. Deletion mutation of MLD ………………………………………… 3.23. Domain One amplification …………………………………………. 3.24. DNA extraction from agarose gel …………………………………. 3.25. Dpn I digestion …………………………………………………….. 3.26. DNA clean up ……………………………………………………… 3.27. Double digestion with Xhol I and BspEI enzymes .………………... 3.28. DNA clean up ……………………………………………………… 3.29. Sticky end ligation …………………………………………………. 3.30. Confirmation of cloning …………………………………………… 3.31. Chromosomal mutagenesis and gene replacement ………………... 3.31.1. Deletion mutation by long PCR …………………………………. 3.31.2. DNA recovery from agarose gel …………………………………. 3.31.3. DpnI digestion …………………………………………………… 3.31.4. Exonuclease I …………………………………………………….. 3.31.5. Self circularization or religation …………………………………. 3.31.6. Transformation …………………………………………………... 3.31.7. Screening of transformants ………………………………………. 3.31.8. Subcloning to pKO3 plasmid ……………………………………. 3.31.8.1. Double digestion of the parent vector ………………………….. 3.31.8.2. Double digestion of destination vector ………………………… 3.31.8.3. Cloning ………………………………………………………… 3.31.8.4. Confirmation of cloning ……………………………………….. 3.31.8.5.Competent cell preparation from E. coli MG1655 and W311 strains 3.31.8.6. First protocol for gene replacement ……………………………. 3.31.8.7. Screening for gene replacements. ………………………………. 3.31.8.8. Second protocol for gene replacement …………………………. 3.32. smpB deletion on ∆ tmRNA/ pKO3 plasmid ……………………...
- VI-
81 82 82 84 84 85 86 86 87 87 87 87 88 88 89 89 89 90 90 90 91 91 91 91 91 92 92 93 94 94 95 95 96
List of Contents
Subject Titles
Page
3.33. Plaque assay …………………………………………………. 3.34. Purification of λ bacteriophage ……………………………………… 3.35. Purification of λ bacteriophage by plate lysis and elution …………... 3.36. Isolation of bacteriophage from sewage water ……………………… 3.37. Total RNA isolation …………………………………………………. 3.38. Reverse transcription (RT) reaction …………………………………. 3.39. Amplification of cDNA by PCR …………………………………….. 3.40. Cloning of three domain protein A to pTZ57R/T …………………… 3.41. Screening of transformant …………………………………………… 3.42. Chopping of one domain protein A ………………………………….. 3.43. Statistical analysis …………………………………………………… 3.44. Sequencing …………………………………………………………... 3.45. Alignment of sequences ……………………………………………... CHAPTER FOUR: RESULTS AND DISCUSSION 4.1. Cloning of tmRNA …………………………………………………… 4.2. Cloning of one domain protein A ……………………………………. 4.3. Creation of chimeric junctions, deletion and insertion using PCR ……. 4.4. Cassette mutagenesis …………………………………………………. 4.5. Chromosomal mutagenesis and gene replacement …………………… 4.6. smpB deletion on ∆ tmRNA/pKO3 plasmid …………………………. 4.7. Bacteriophage assay …………………………………………………... 4.8. Total RNA isolation and reverse transcription ……………………….. 4.9. Chopping of protein A gene ………………………………………….. CONCLUSIONS AND RECOMMENDATIONS ……………………… REFERENCES …………………….……………………………………. APPENDICES …………………………………………………………… SUMMARY IN KURDISH …….……………………………………………… SUMMARY IN ARABIC …………………….………………………………
96 98 98 99 100 102 102 103 103 104 105 105 105
- VII-
106 111 112 115 119 128 130 146 147 152 154 i A C
List of Tables
LIST OF TABLES Titles
Page
Table (3.1): Enzymes and Enzyme Buffer ……………………………….. Table (3.2): Standard bacterial strains and plasmid vectors ……………… Table (3.3): PCR Amplification Primers …………………………………. Table (3.4): Primers for deletions ………………………………………… Table (3.5): Protein A tailed-Primers for deletions ……………………….. Table (3.6): PCR Deletion Primers (Chopping of protein A) …………….. Table (4.1): The phage assay (PFU*10 7/mL) of different constructs ……
47 56 58 59 60 61 133
- VIII-
List of Figures
LIST OF FIGURES Titles
Page
Figure (2.1): A scheme showing the formation of translation initiation complex ……………………………………………………... Figure (2.2): A scheme showing the process of elongation ……………… Figure (2.3): A scheme showing the process of termination …………….. Figure (2.4): The model of trans-translation ……………………………. Figure (2.5): The structure of tmRNA of Caulobacter crescentus ………. Figure (2.6): The TLD of tmRNA ……………………………………….. Figure (2.7): Secondary structure of E. coli tmRNA …………………….. Figure (2.8): Lytic transcription program ………………………………... Figure (2.9): Phage λ life cycle …………………………………………... Figure (2.10): The genome of M13 ……………………………………… Figure (3.1): Restriction map of vector pTZ57R/T ……………………… Figure (3.2): Restriction map of pKO3 ………………………………….. Figure (4.1): Cloning of tmRNA region to pTZ57R plasmid vector …….. Figure (4.2): Blue white colonies of cloning tmRNA region to pTZ57R plasmid …………………………………………………….. Figure (4.3): One domain protein A amplification by gradient PCR ……. Figure (4.4): Schematic illustration of the cloning of one domain of protein A gene ……...……………………………………….. Figure (4.5): Amplification of one domain protein A …………………… Figure (4.6): Chimeric genes ……………………………………………. Figure (4.7): PCR based deletion ………………………………………… Figure (4.8): PCR amplification confirming the ligation of protein A by chimeric junction and cassette mutagenesis ……………….. Figure (4.9): PCR based deletion ………………………………………... Figure (4.10): Genetic map of pTZN3 construction …………….………... Figure (4.11): Genetic map of pTZN4 construction ……………………... Figure (4.12): Genetic map of pTZN5 construction ……………………… Figure (4.13): Colony PCR using primers flanking pKO3 inserts …...….. Figure (4.14): Single cross over of pKON7, pKON6, and pKON8 into the E. coli MG1655 genome ……………………..……………… Figure (4.15): PCR amplifications of E. coli MG1655 and E. coli MG1655/∆ssrA ………………………..…………………….
- IX-
6 8 9 17 23 25 28 37 41 43 53 53 110 111 112 113 114 116 118 118 120 120 122 122 124 125 128
List of Figures
Titles
Page
Figure (4.16): Construction of pKON9 vector ……………..…………….. Figure (4.17): PCR screen of pKON9 construct …………………….…. Figure (4.18): Phage assay (PFU * 107/mL) of different constructs …….. Figure (4.19): Plaque assay for λ phage using MG1655 ………………... Figure (4.20): Plaque assay for helper phage using MG1655 …………... Figure (4.21): Plaque assay for coliphages using MG1655 …………….. Figure (4.22): Total RNA isolation …………….. ………………….……. Figure (4.23): cDNA PCR amplification of the tmRNA transcripts from the strains using primer pair (OP-1F, OP-1R). ……………... Figure (2.24): Colony PCR for chopping of a fragment encoding domain one of the protein A in constructs (NF8, NF9, NF10, NF11) by using primers with either UAA or UGA stop codon ……. Figure (4.25): Colony PCR amplification of protein A (domain one) after chopping ……………………………………………………
129 129 134 135 135 146 148
- X-
148 150 151
List of Abbreviations
LIST OF ABBREVIATIONS aa-tRNA
aminoacyl-transfer ribonucleic acid
A site
aminoacyl or acceptor site
AANDENYALA
Ala Ala Asn Asp Glu Asn Tyr Ala Leu Ala
AlaRs
alanyl transfer ribonucleic acid synthetase
NEB
New England bio lab
DC
decoding center
dNTP
deoxy nucleotide triphosphate
E site
exit site
EDTA
ethylene diamine tetra acetic acid
EF-Ts
elongation factor Ts
EF-Tu
elongation factor Tu
Ff
F-specific filamentous phage
fMet
formyle methionine
GDP
guanosine Di-phosphate
GTP
guanosine tri-phosphate
HfI
Higher multiplicity of infection
IF
initiation factor
IL-6
interleukine -6
IPTG
isopropyl Thio-β-D-Galactoside
LacI
lactose repressor
MLD
mRNA-like domain
mRNA
messenger ribonucleic acid
OL
Leftward operator
OR
Rightward operator
ORF
open reading frame
P site
peptidyl site
pI
Int protein promotor
- XI-
List of Abbreviations
LIST OF ABBREVIATIONS PK
Pseudoknot
pL
Leftward promotor
pR
Rightward promotor
pR′
Late promotor
pRE
Establishment promotor
pRM
Maintenance promotor
PspA
Bacterial stress protein
PTC
peptidyle transferase center
RF
release factor
Rf
Replicative form
Rpm
round per minute
RRF
Ribosome recycling factor
S1
ribosomal protein S1
SD
shine and Dalgarno
SmpB
small protein B
SSpB
Stringent starvation protein
ssrA
small stable ribonucleic acid
tL1
Leftward transcription termination
TLD
tRNA-like domain
tmRNA
transfer-messenger ribonucleic acid
tmRNP
transfer-messenger ribonucleic acid-protein
TolA
Integral membrane protein
tR1
Rightward transcription termination
tRNA
transfer ribonucleic acid
tRNAfMet
transfer RNA formyl methionine
X-gal
5-bromo-4-chloro-3-indolyl-beta-D- Galactopyranoside
∆
Delta (deletion)
- XII-
Chapter One
Introduction
1. INTRODUCTION Defects in protein synthesis threaten cell viability in eubacteria. The mRNA transcripts lacking stop codons arise from premature termination of transcription and from mRNA decay by 3'-5' exonucleases. Since release factors cannot be recruited to nonstop mRNAs, ribosomes stall at the 3' end and trap additional ribosomes (Crandall et al., 2010). A general mechanism in bacteria to rescue stalled ribosomes and to clear the cell of incomplete polypeptides involves an RNA species, tmRNA (ssrA), and a small protein called SmpB which are essential components of a bacterial protein quality control mechanism called transtranslation (Keiler et al., 2000; Choy et al., 2007). Thus, the trans-translation mechanism is a key component of multiple quality control pathways in bacteria that ensure proteins are synthesized with high fidelity. In addition to quality control pathways, some genetic regulatory circuits use trans-translation to control gene expression. Diverse bacteria require trans-translation when they execute large changes in their genetic programs, including responding to stress, pathogenesis, and differentiation (Keiler, 2008). The tmRNA is encoded by ssrA gene and it has both transfer and messenger RNA activities. The termini of tmRNA adopt a cloverleaf-like secondary structure similar to canonical tRNAs, whereas the mRNA-like domain, which encodes a ten amino acid proteolysis tag and two stop codons, is separated from the tRNA-like domain (TLD) by four pseudoknots (Gutmann, 2004). The tmRNA system orchestrates three key biological functions involving the recognition and rescue of ribosomes stalled on aberrant mRNAs, disposal of the causative defective mRNAs, and addition of a degradation tag to ribosome-
- 1-
Chapter One
Introduction
associated protein fragments for directed proteolysis (Singh and Varshney, 2004; Li et al., 2006; Dulebohn et al., 2007). Bacteriophages are viruses that infect bacterial hosts and are estimated to be the most numerous biological entities in the biosphere. Phages, like other viruses, rely on a variety of host macromolecules to support their programmed development. In many cases interactions between phage- and bacterium-encoded proteins catalyze processes essential for phage development; some of these appropriated host functions may also be essential to the host. Therefore, mutations resulting in failure of the host to support phage development have served to identify a number of genes encoding functions important to the host (Retallack et al., 1994; Hatfull et al., 2006). In addition to the growth of fundamental knowledge, the replication of bacteriophage integrative mechanisms has aroused some interest as a tool for gene replacement technology and mutational studies (Murphy, 1998). Therefore, the current study aims to: ¾ address the question of whether the trans-translation model for tmRNA and SmpB function can explain the requirement for tmRNA in the growth of Lambda and helper phages. Furthermore, it aims to study the structural basis of tmRNA in supporting phage growth through constructing several vectors with different deletions. ¾ make an overlap extension for production of chimeric genes through combining two different DNA fragments using PCR ligation technique without the need of restriction sites. ¾ study the role of different stop codons in the efficiency of tagging. ¾ delete endogenous copy of smpB and tmRNA by gene replacement technique through homologous recombination for subsequent studies.
- 2-
Chapter One
Introduction
¾ inactivate tmRNA as a useful therapeutic target to increase the sensitivity of pathogenic bacteria against antibiotics. ¾ construct vectors as a proteomics tool to isolate and investigate the chromosomal and phage genes on which tmRNA acts.
- 3-
Chapter Two
Literature Review
2. LITERATURE RVIEW
2.1. Ribosome structure and the mechanism of translation 2.1.1. Bacterial ribosome subunits The ribosome is a large ribonucleoprotein particle that catalyzes mRNAdirected protein synthesis in all organisms. It mediates the interactions between mRNAs and tRNAs on which the fidelity of translation depends and it contains the activity that catalyzes peptide bond formation (Ramakrishnan & Moore, 2001). In bacteria, ribosomes consist of two subunits, 30S and 50S, and together they make up the 70S ribosome (Ramakrishnan, 2002). The small subunit contains a single RNA roughly 1500 nucleotides in length, 16S rRNA, and single copies of each of about 20 different proteins. The large subunit contains a 2900-nucleotide RNA, 23S rRNA, an RNA of about 120 nucleotides, 5S rRNA (Mathews et al., 1999) and it contains 30–40 different proteins, depending on species (Ramakrishnan & Moore, 2001). The ribosome has three binding sites: the A (aminoacyle or acceptor) site which accepts the incoming aminoacylated tRNA in complex with EF-Tu.GTP; the P (peptidyl) site where the tRNA carrying the nascent peptide chain is bound; the E (exit) site where the deacylated tRNA transiently moves before it leaves the ribosome (Ivanova, 2005). The 30S subunit binds mRNA and the anticodon stem-loops of tRNA, and contributes to the fidelity of translation by monitoring base pairing between codon and anticodon in the decoding process whereas the 50S subunit binds the acceptor arms of tRNA and catalyzes peptide bond formation between the incoming amino acid on A-site tRNA and the nascent peptide chain attached to the P-site tRNA; - 4-
Chapter Two
Literature Review
both subunits are involved in translocation, in which the tRNAs and mRNA move precisely through the ribosome, one codon at a time (Ramakrishnan, 2002; Selmer et al., 2006). In addition to the ribosome, the translation process requires around 45 tRNA molecules, 20 aminoacyl-tRNA synthetases that acylate specifically tRNAs with particular amino acids and a number of translation factors participating at different steps of the translation cycle (Ivanova, 2005). 2.1. 2. Translation Efficient protein synthesis is essential to the cell growth. In translation, the sequence of codons on mRNA directs the synthesis of a polypeptide chain. This process takes place on the ribosome, and the movement of tRNA and mRNA through the ribosome is a complicated process that combines high speed with high accuracy (Green & Noller, 1997). The translational process consists of four phases: initiation, elongation, termination, and ribosome recycling. 2.1.2.1. Initiation Initiation in bacteria involves the interaction of the 30S subunit with the Shine-Dalgarno sequence on mRNA that is complementary to the 3′ end of 16S rRNA (Ramakrishnan, 2002). The process also involves three initiation factors, IF1, IF2, and IF3 (Figure 2.1) (Gualerzi & Pon, 1990). The IF3 is known to bind strongly to the 30S subunit and prevent its association with the 50S subunit. It also helps in the selection of initiator tRNA (fMet-tRNAfMet) by destabilizing the binding of other tRNAs in the P site of the ribosome whereas IF1 binds to the A site of the 30S ribosomal subunit preventing the tRNA binding in the A site but also it induces a conformational change that may represent the transition state in the equilibrium between subunit association - 5-
Chapter Two
Literature Review
and dissociation (Ramakrishnan, 2002). A third initiation factor, IF2, is one of a class of G proteins because it carries a molecule of GTP. The charged initiator tRNA binds to a free 30S subunit, after these have all bound, the 30S initiation complex is complete (Mathews et al., 1999). In prokaryotes, the starter tRNA carries the substituted amino acid N-formylmethionine (fMet) (Koolman et al., 2005). Only tRNAfMet is accepted to form the initiation complex all further charged tRNAs require fully assembled ribosomes (Mathews et al., 1999). The 50S subunit binds to the 30S initiation complex. It contains three sites for tRNA binding. When the two ribosomal subunits join, the AUG initiator codon with its bound tRNAfMet aligns with the P site and then the GTP carried by IF2 is hydrolyzed, and IF2-GDP, Pi, and IF1 are all released. The 70S initiation complex is ready to accept a second charged tRNA and begin elongation, the next phase of translation (Koolman et al., 2005; Mathews et al., 1999). The end of the initiation process leaves an aminoacylated initiator tRNA in the P site of the ribosome and an empty A site, which serves to start the elongation cycle (Ramakrishnan, 2002).
Figure 2.1: A scheme showing the formation of translation initiation complex (Watts, 2008).
- 6-
Chapter Two
Literature Review
2.1.2.2. Elongation The peptidyl (P) site of the ribosome is occupied by a tRNA that carries at its 3′ end the nascent peptide chain. A second tRNA, charged with the next amino acid, binds via its complementary anticodon to the mRNA codon exposed at the acceptor site (Koolman et al., 2005). A charged tRNA is escorted to the A site in a complex with the protein elongation factor (EF-Tu) which also carries a molecule of GTP (Ogle & Ramakrishnan, 2005). When the appropriate charged tRNA is deposited into the A site, the GTP is hydrolyzed and the EF-Tu-GDP is released (Figure 2.2). The charged tRNA is checked both before and after the GTP hydrolysis and is rejected if incorrect, thus a proofreading occurs at this step (Mathews et al., 1999). A further protein, the elongation factor Ts (EF-Ts), later catalyzes the exchange of GDP for GTP and in this way regenerates the EF–Tu-GTP complex (Koolman et al., 2005). The polypeptide chain that was attached to the tRNA in the P-site is transferred to the amino group of the amino acid carried by the A-site tRNA. This step is called peptidyl transfer and is catalyzed by an enzyme complex called peptidyltransferase, which is an integral part of the 50S subunit (Mathews et al., 1999). Following peptidyl transfer, the ribosome has a deacylated tRNA in the P site and peptidyl tRNA in the A site (Ramakrishnan, 2002). After the transfer of the growing peptide to the A site, the free tRNA at the P site dissociates and another GTP–containing elongation factor (EF-G GTP) binds to the ribosome. Hydrolysis of the GTP in this factor provides the energy for translocation of the ribosome (Koolman et al., 2005). Translocation of tRNAs is accompanied by translocation of mRNA, enabling the ribosome to slide along the mRNA to the next codon (Ivanova, 2005). During this process, the ribosome moves three bases along the mRNA in the direction of - 7-
Chapter Two
Literature Review
the 3′ end. The tRNA carrying the peptide chain is stationary relative to the mRNA and reaches the ribosome’s P site during translocation, while the next mRNA codon appears at the A site. The uncharged tRNA then dissociates from the E site (Koolman et al., 2005).
Figure 2.2: A scheme showing the process of elongation (Watts, 2008). 2.1.2.3. Termination Termination of translation occurs when one of the stop codons (UAA, UAG, or UGA) appears in the A site of the ribosome (Mathews et al., 1999). It requires two codon-specific protein-release factors in prokaryotes (Nakamura & Ito, 1998). The UAA is recognized by both RF1 and RF2, while UAG is recognized by RF1 and UGA is recognized by RF2 (Figure 2.3) (Ramakrishnan, 2002). Upon stop-codon recognition, class I RFs promote hydrolysis of the ester bond that links the nascent polypeptide chain with the tRNA in the P site, leading to release of the polypeptide chain from the ribosome (Weixlbaumer et al., 2008). Subsequently, the release of the bound class I RF from the ribosome is facilitated - 8-
Chapter Two
Literature Review
by RF3, a class II release factor, which is a GTPase like many of the other protein factors involved in translation (Berg et al., 2002). It has been proposed that the ribosome-class I RF complex promotes GDP-to-GTP exchange in RF3 only after polypeptide release. Finally, GTP hydrolysis by RF3 results in its own release (Petrey et al., 2005).
Figure 2.3: A scheme showing the process of termination (Watts, 2008). 2.1.2.4. Ribosome recycling The fourth step of translation requires binding of a dedicated protein factor, the ribosome-recycling factor (RRF), which in conjunction with elongation factor G (EF-G) helps removing the mRNA and last deacylated tRNA from the ribosome (Agrawal et al., 2004). Ribosome releasing factor, product of the frr gene in Escherichia coli, is responsible for dissociation of ribosomes from mRNA after the termination of translation; it is involved in ribosome re-utilization in prokaryotes (Janosi et al., 1994; Pavlov & Freistroffer, 1997). The two initiation factors, IF1 and IF3, bind to a 70S ribosome. They appear to promote the dissociation of 70S ribosomes into free 30S and 50S subunits (Mathews et al., 1999). Ribosome splitting by IF1 with IF3 and by RRF with EF-G occurs according to different mechanistic principles; ribosomes containing a messenger RNA (mRNA) with a strong Shine–Dalgarno sequence are rapidly split - 9-
Chapter Two
Literature Review
into subunits by IF1 and IF3, but slowly split by RRF and EF-G. Post-terminationlike (PTL) ribosomes containing mRNA and a P-site-bound deacylated transfer RNA (tRNA) are split very rapidly by RRF and EF-G, but extremely slowly by IF1 and IF3. Vacant ribosomes are split by RRF/EF-G much more slowly than PTL ribosomes and by IF1/IF3 much more slowly than mRNA-containing ribosomes (Pavlov et al., 2008).
2.2. Discovery of tmRNA The l0Sa RNA gene, also called ssrA for small stable RNA (Lin-Chao et al., 1999), is a unique gene in the chromosome of E. coli located between 2,760 and 2,761 kilobases (Oh et al, 1990). More than 30 years ago Ray & Apirion isolated a previously unknown RNA molecule from E. coli (Ray & Apirion, 1979). The10Sa RNA is encoded by the small, stable RNA A (ssrA) gene and its maturation involves RNases E, P, and T. Thus, 10Sa RNA has also been named ssrA, a term that is now widely used in conjunction with the conserved decapeptide it encodes: the SsrAtag (Komine & Inokuchi, 1991). In E. coli, there are about 1,000 copies per cell (Kaplinski et al., 2010). Disruption of ssrA affects cell growth (Oh & Apirion, 1991; Komine et al., 1994). In the mid nineties (1990s), the discovery that the 3′ and 5′ termini of 10Sa RNA form a clover leaf-like structure and that its 3′ end is charged by alanyl tRNA synthetase suggesting an involvement of 10Sa RNA in translation (Ushida et al., 1994; Komine et al., 1996). In addition, Ushida and coworkers showed that 10Sa RNA binds 70S ribosomes but not the individual subunits (50S or 30S) in vivo. Shortly following these findings, Tu et al., (1995) obtained results that changed the established view of 10Sa RNA being a noncoding RNA. When interleukin 6 (IL6) was overexpressed in E. coli, a small population of different truncated IL6 forms contained a previously unidentified modification at the C-terminus. Further - 10-
Chapter Two
Literature Review
investigations revealed that the C-terminal extension consisted of the eleven amino acid sequence AANDENYALAA. Ten amino acids out of this sequence turned out to be coded by 10Sa RNA. A control 3 experiment then showed that truncated IL6 molecules bearing the C-terminal marker could not be isolated from cells with disrupted 10Sa RNA gene (ssrA) (Felden et al., 1997). Although these results indicated an involvement of 10Sa RNA in translation, very little was known about its mechanism of action until Keiler et al., (1996) and presented their peptide-tagging model. In their work, they described how variants of lambda repressor and cytochrome b562 when translated from mRNA without stop codon are marked at their C-terminus with the peptide sequence encoded by the ssrA gene. The tagged aberrant protein is recognized by cellular proteases and degraded. A mechanism, known as the trans-translation model was proposed, in which the C-terminal degradation tag is added to the nascent polypeptide chain by cotranslational switching of the ribosome from aberrant mRNA to an open reading frame encoded by 10S RNA (Keiler et al., 1996). Transfer-messenger RNAs (tmRNAs) are named for their dual tRNA-like and mRNA-like functions. The role of tmRNAs is to liberate the mRNA from stalled ribosomes (Gutmann, 2004; Singh and Varshney, 2004). This is accomplished by using part of the tmRNA as a reading frame that ends with one or more translation termination signals. The tmRNA codes for a hydrophobic peptide, the proteolysis tag, which is attached to the C-terminus of the incomplete protein enabling recognition by a protease (Laslett et al., 2002; Takada et al., 2005).
2.3. The tmRNA synthesis, processing and stability Generally, the tmRNAs are synthesized as precursors which need to be processed by RNases BN, D, E, III, P, PH, and T (Wower et al., 2005) before it becomes functional. Ray and Apirion has documented that in E. coli, mature - 11-
Chapter Two
Literature Review
tmRNA, 363 nt, is formed from a larger precursor RNA, 457 nt, called p10Sa (Subbarao & Apirion, 1989; Withey & Friedman, 2003). Endonucleolytic and/or exonucleolytic removal of 5′ and 3′ nucleotides is necessary to create a tmRNA acceptor arm that can be charged with alanine. As is the case with tRNAs, the 5′ terminus of mature tmRNA is generated by the activity of RNase P. This nuclease activity removes the terminal seven nucleotides of ptmRNA (Komine et al., 1994). The site of tmRNA charging, as in tRNA, is the 3′-hydroxyl group of the terminal 5′-CCA-3′trinucleotide sequence. Some tmRNA genes are circularly permuted, and an additional excision event during processing results in a two-piece tmRNA. In both one piece and two-piece tmRNAs, however, the mature molecule consists of a tRNA-mimic domain, an ORF encoding the SsrA tag, and three or four pseudoknots (Moore & Sauer, 2007). The RNase E, an enzyme already known to have a central role in RNA processing and decay in E. coli, cuts the SsrA RNA precursor site specifically at three locations near its CCA-3′ end, generating both mature 363-nt SsrA RNA and slightly longer intermediates and the interference with this cleavage in vivo leads to the accumulation of the precursor and blockage of SsrA-mediated proteolysis (LinChao et al., 1999; Carpousis, 2002). Therefore, RNase E is required to produce mature SsrA RNA for normal SsrA RNA peptide-tagging activity. In some tmRNA genes, for instance in Bacillus subtilis, the 3′ CCA tail is not encoded within the gene, but is only present on the mature tmRNA molecule, possibly added by a nucleotidyltransferase (Laslett et al., 2002).
- 12-
Chapter Two
Literature Review
2.4. The trans-translation Cells have evolved multiple mechanisms to prevent or correct errors in macromolecular synthesis (Roche & Sauer, 2001). The trans-translation is a bacteria-specific translational quality control mechanism that rescues ribosomes stalled on defective mRNAs, directs the degradation of aberrant protein products, and facilitates the decay of incomplete or damaged mRNAs (Hayes et al., 2002; Sundermeier & Karzai, 2007; Hong et al., 2007). Therefore, trans-translation may represent a major mechanism to recycle both the stalled ribosomes and the tRNAs and to prevent accumulation of abortively synthesized polypeptides, providing some advantage to the cell for survival (Takahashi et al., 2003: Singh and Varshney, 2004; Wower et al., 2004). The two unique components of this system are tmRNA and it is required protein partner SmpB which plays a crucial role. It seems that SmpB is important for the stimulation of tmRNA aminoacylation, an essential prerequisite for ribosome binding and it has also been proposed that it takes an active role during the accommodation step of tmRNA into the ribosomal A-site (Gutmann, 2004). Bacterial tmRNA contains of a single polyribonucleotide chain that sustains two main functions in protein synthesis. It acts as an adapter between the genetically encoded message and the newly synthesized polypeptide (tRNA function) and in its 3′-end it has sequences and an internal reading frame encoding a ‘tag’ peptide (Gillet and Felden, 2001; Kelley et al., 2001; Fujihara et al., 2002). Thus, it performs two general functions. First, ribosomes that are stalled at truncated mRNAs lacking a termination codon are released. Second, the prematurely truncated proteins are rapidly degraded, avoiding accumulation. Both functions have been separated genetically by engineering cells that carry a ssrA gene coding for an altered tag that is resistant to proteases, or alternatively, that - 13-
Chapter Two
Literature Review
cannot be aminoacylated (Keiler et al., 1996; Withey & Friedman, 1999; Huang et al., 2000; de la Cruz & Vioque, 2001). 2.4.1. Molecular mechanism of trans-translation In principle, there are two different mechanisms by which trans-translation occurs at a stop codon. Certain nascent peptides may cause ribosome stalling by partially preventing the action of release factors (RFs) without damaging mRNA itself. In this case, tmRNA may enter the A-site by competing with RFs or nearcognate aminoacyl-tRNAs (Asano et al., 2005). An alternative possibility is that the ribosome stalling somehow induces endonucleolytic cleavage of the mRNA at or prior to the stop codon, resulting in “nonstop” mRNAs. In the latter case, there is no competition between tmRNA and RFs because the A-site is empty. Other findings showed that ribosome stalling may cause mRNA cleavages either in vivo (Loomis et al., 2001; Drider et al., 2002) or in vitro (Pedersen et al., 2003; Sunohara et al., 2004). The mechanism by which tmRNA resumes translation from the first GCA codon for a tag-peptide might be determined by the interaction between tmRNA and ribosome either directly or via a specific factor. It has been shown that the sequence at –5 to –2 upstream of the translation resuming point on E. coli tmRNA as well as the start nucleotide serve as a cis-element to determine the initiation point (Takahashi et al., 2003). On the basis of the present results, models of trans-translation have been proposed mentioning the same main steps. In these models, upon entrance of tmRNA to the stalled ribosome, whether it enters in complex with SmpB or independently. In either case, the C-terminal tail of SmpB may recognize the vacant A-site free of mRNA to trigger trans-translation (Kurita et al., 2007a).
- 14-
Chapter Two
Literature Review
A prerequisite for trans-translation is the charging of tmRNA with alanine by alanyltRNA synthetase (AlaRS) (Komine et al., 1994; Barends et al., 2000). Unlike most other tRNA synthetases that interact with anticodons of their specific substrate tRNAs, AlaRS recognizes a unique GU base pair in the acceptor stem (Gutmann, 2004; Wower et al., 2008). Alanyl-tRNA synthetase charges tmRNA already bound to SmpB with an alanine. The EF-Tu-GTP binds to the tRNA-like domain of Ala-tmRNA and delivers it to the ribosome, just as it delivers canonical tRNAs. The Ala-tmRNA–SmpB-EF-Tu-GTP complex enters the A-site of the stalled ribosome and is accommodated, independent of any codon: anticodon interaction. The SmpB tail appears to be the key player in stimulating ribosomedependent GTPase activity of EF-Tu (Watts, 2008). It is clear that recognition of stalled ribosomes requires alanyl-tmRNA in a quaternary complex with SmpB, EFTu, and GTP. SmpB protein function is essential for the recognition process. In the absence of SmpB, ala-tmRNA bound to EF-Tu and GTP is unable to stably associate with stalled ribosomes (Tanner et al., 2006; Dulebohn et al., 2007; Sundermeier & Karzai, 2007). Once SmpB triggers GTPase activity and the EF-Tu bound GTP is hydrolyzed, the nascent peptide in the P-site is transferred to the Ala-tmRNA in the A-site. As long as the nascent peptide is attached to the P-site tRNA, the original mRNA template remains stably bound to the ribosome. Once transpeptidation occurs, EF-G catalyzed translocation moves the peptidyl-tmRNA into the P-site and the original mRNA quickly dissociates (Watts, 2008). Then, the noncoded alanine is incorporated to the nascent polypeptide chain through a cycle of translation elongation, before the mRNA-like domain of tmRNA replaces the truncated mRNA on the ribosome (Keiler et al., 1996; Muto et al., 1998). A conformational change then occurs that allows translation to shift from the original mRNA to the ANDENYALAA reading frame within SsrA (Nameki et - 15-
Chapter Two
Literature Review
al., 1999a; Hayes et al., 2002; Ivanova, 2005; Ranquet & Gottesman, 2007). This domain is used as a template to add a short peptide to the nascent polypeptide before translation terminates and a tagged protein is released. The short peptide acts as a recognition sequence that directs the protein to quick degradation by specific proteases (Figure 2.4) (Gottesman et al., 1998; Levchenko et al., 2000; Withey and Freidman, 2003). This tagging process requires functional SsrA RNA, which encodes the last 10 residues of the peptide and results in rapid degradation of the tagged protein by carboxy-terminal-specific proteases (Tu et al., 1995). Additionally, Sunohara et al., (2004) have established that tmRNA-mediated protein tagging occurs at stop codons depending on the C-terminal amino acid sequence of the nascent polypeptide immediately adjacent to those codons (Keiler et al., 1996; Gottesman et al., 1998; Roche & Sauer, 2001). Mehta et al., (2006) have presented evidence to demonstrate that tmRNA performs a third function, namely, facilitating the degradation of the causative defective mRNA and their investigations have revealed the identity of key sequence determinants that promote the degradation of the nonstop mRNA. Studies have suggested that SsrA tagging could occur in cases other than truncated mRNAs (Gillet and Felden, 2001). It has been shown that a run of rare codons on an mRNA induce the SsrA tagging presumably (Roche & Sauer 1999), and it could occur at rare codons such as AUA (isoleucine), CUA (leucine), CCC (proline), and GGA (glycine) (Li et al., 2006). Furthermore, ribosomes may stall in the case of read through due to nonsense suppressors or missing drugs or when ribosomes reach a stable secondary structure on the translated mRNA (Ivanova, 2005).
- 16-
Chapter Two
Literature Review
Ueda et al., (2002) found that SsrA tagging of bulk cellular proteins was significantly enhanced by an ochre or an amber suppressor tRNA suggesting that the SsrA system contributes to scavenge errors and/or problems caused by translational readthrough that occurs typically in the presence of a suppressor tRNA. In Bacillus subtilis, trans-translation occurs more frequently at high temperature than at low temperature, and different proteins are tagged at different temperatures (Fujihara et al., 2002).
Figure 2.4: The model of trans-translation (Watts, 2008). It was shown that some toxins encoded by different genes in Escherichia coli can inhibit translation by causing mRNA cleavage (Ranquet & Gottesman, 2007). A bacterial toxin RelE was found to induce endonucleolytic cleavage of mRNAs - 17-
Chapter Two
Literature Review
bound to ribosomes in vitro at specific sites including stop codons in response to a stalled ribosome (Pedersen et al., 2003). Furthermore, Li et al., (2006) using northern and S1 analyses concluded that a ribosome stalled by the rare codon induces mRNA cleavage. 2.4.2. Ribosome rescue One of the cellular strategies to process stalled ribosomes involves peptidyltRNA drop-off. While the mechanisms responsible for the drop-off of peptidyltRNAs from the ribosomes are not very well understood, genetic and biochemical evidence suggests that in E.coli, ribosome recycling factor (RRF) and EF.G, as well as other factors such as RF3, IF1, IF2 and RelA contribute to this phenomenon. The peptidyl-tRNAs are recycled by peptidyl-tRNA hydrolase (Pth), which hydrolyzes the ester link between the tRNA and the peptide (Singh and Varshney, 2004). One speculative possibility is that translation by lagging ribosomes provides the force to push the stalled ribosome off of the 3′ end of the mRNA, with subsequent disassembly of this ribosome and hydrolysis of the linkage between tRNA and the nascent chain by peptidyl-tRNA hydrolase. At present, it is not known if alternative rescue and peptidyl-tRNA drop-off represent distinct mechanisms or the same process (Moore & Sauer, 2007). 2.4.3. Biological roles of tmRNA Another way in which trans-translation is important biologically is through its effect upon gene expression. SmpB-tmRNA system plays a regulatory role in modulating
gene
expression
by
maintaining
the
requisite
intracellular
concentrations of some regulatory factors. These factors might include transcriptional activators and repressors (Dulebohn et al., 2007).
- 18-
Chapter Two
Literature Review
It has been documented that tmRNA-directed proteolysis is important for proper regulation of the lac operon by controlling levels of LacI. Additionally, using thermo inducible mutants of phage Mu, which require tmRNA for induction, it was found that Mu uses trans-translation as a regulator of gene expression. In E. coli, trans-translation is required for growth at 42 ⁰C of strains having mutations in the thyA, hisS, htrA, rho, and prs genes. The results of further experiments with the thyA mutant suggested that the release of stalled ribosomes, and not tmRNAdirected proteolysis, is the critical role of trans-translation in allowing survival of the thyA mutant at high temperature (Abo et al., 2000; Withey & Friedman, 2003; Gutmann, 2004). In many species, mutations that disrupt tmRNA activity cause defects in growth or development. In Caulobacter crescentus and Bradyrhizobium japonicum cells lacking tmRNA activity there is a delay in the initiation of DNA replication, which disrupts the cell cycle. It has been documented that tmRNA activity is essential for the growth of Neisseria gonorrhoeae, Haemophilus influenzae, and species of Mycoplasma. The tmRNA mutants in Salmonella enterica and Yersinia pseudotuberculosis have decreased virulence, and mutants of Caulobacter crescentus lacking tmRNA activity have developmental defects (Okan et al., 2006; Hong et al., 2007). Generally, cells devoid of SsrA RNA grow more slowly and show a certain degree of temperature sensitivity. In Escherichia coli, tmRNA is required for optimal growth under a variety of stress conditions regulating an alternative protease activity, modulating DNA binding protein activity, and contributing to the growth of λP22 hybrid phage (Julio et al., 2000). Despite the abundance of recognized phenotypes associated with tmRNA activity, the reasons tmRNA is required for these processes are not clear. In some - 19-
Chapter Two
Literature Review
cases, it has been proposed that failure to release stalled ribosomes may result in titration of active translational complexes, thereby reducing the ability of the cell to produce new proteins or triggering a stress response that leads to the observed phenotypes. Another possibility is that phenotypes are generated because proteins that are normally tagged by tmRNA are misregulated in the absence of tmRNA activity. In addition to the cell cycle phenotype, cells lacking tmRNA activity will not maintain some families of multicopy number plasmids (Oh and Apirion 1991; Komine et al., 1994; Gottesman et al., 1998). For many bacteria, including Bucillus subtilis and Escherichia coli , tmRNAdeficient cells are viable under the usual culture conditions, but exhibit various phenotypes, such as slower growth rate under stress conditions ; reduced motility ; inhibition of λ imm P22 phage growth and induction of temperature-sensitive lysogens of phage Mu; induction of Alp protease activity, reduced pathogenesis (Julio et al., 2000), and increased levels of LacI, λcI, and LexA repression. It has also been shown that several temperature-sensitive phenotypes in a tmRNAdeficient E. coli strain are suppressed by the introduction of the tmRNA gene (Fujihara et al., 2002; Roche & Sauer, 2001). Furthermore, deletion of the ssrA gene is sufficient to impair global protein synthesis when chloramphenicol is added at sublethal concentrations for the wild-type strain (de la Cruz & Vioque, 2001; Luidalepp et al., 2005). 2.4.4. The proteolysis of SsrA tagged polypeptides Incomplete protein fragments have the potential to harm cells by misfolding, aggregating, or expressing unregulated activities. Ribosomes can also stall during translation of proteins destined for the cytoplasm, inner or outer membranes, periplasm, or extracellular space. Thus, it is not surprising that bacteria contain many proteases that degrade SsrA tagged proteins (Moore & Sauer, 2007). - 20-
Chapter Two
Literature Review
Generally, three proteases specifically degrade SsrA-tagged substrates in the cytoplasm of E. coli. ClpXP and ClpAP are soluble enzymes consisting of the ClpP14 peptidase and hexamers of ClpX or ClpA that are ATP-fueled machines recognizing SsrA-tagged substrates (Farrell et al., 2007; Gur & Sauer, 2008), unfolding them if necessary, and translocating the denatured polypeptide into chamber of ClpP, a double-ring tetradecamer with broad peptide-bond cleavage activity for degradation (Burton et al., 2003). The FtsH also uses the energy of ATP hydrolysis to feed target proteins into a proteolytic chamber, but this enzyme is unable to unfold and degrade highly stable SsrA-tagged proteins. FtsH degrades misassembled integral membrane proteins and probably also plays a role in the degradation of some SsrA-tagged proteins in the inner membrane (Levchenko et al., 2000; Moore & Sauer, 2007). The ATP-dependent protein degradation helps to maintain protein quality control, repair DNA damage, regulate stress responses and gene expression, and control cell-cycle progression in prokaryotes and eukaryotes (Gottesman et al., 1998; Karzai et al., 2000; Bohn et al., 2002; Burton et al., 2003). The stringent starvation protein B (SspB) and its bound substrate form a delivery complex in which SspB through direct interactions of its conserved Cterminus with ClpX enhances the affinity of the substrate for the unfoldase (Dougan et al., 2003). It has been proposed that a stimulatory factor enhancing the activity of ClpX might be present in the cytosol. SspB expression is induced by glucose, nitrogen, phosphate and amino acid starvation (Williams et al., 1994) and it is likely that nutritional stress is enhancing ribosome stalling. Thus, by stimulating SspB expression cells could specifically regulate the breakdown of incomplete polypeptides and make use of the released amino acids for productive protein synthesis (Gutmann, 2004). - 21-
Chapter Two
Literature Review
Adaptor proteins help proteases modulate substrate choice, ensuring that appropriate proteins are degraded at the proper time and place. SspB and ClpS are the only adaptor proteins known to considerably influence the proteolysis of tmRNA-tagged peptides. Collectively, the two adaptors directly regulate the activities of ClpXP and ClpAP (Flynn et al., 2004; Choy et al., 2007).
2.5. Phylogeny of tmRNA The smpB and ssrA genes are present in all bacteria examined (Dulebohn et al., 2007) and they have been found in bacteriophage genomes but have not been identified in the nuclear genomes of most Archaea and Eukarya (Ivanova, 2005). Several publications mentioned that ssrA genes have also been found in algae chloroplasts, the cyanelle of Cyanophora paradoxa and the mitochondrion of the flagellate Reclinomonas Americana lacking peptide tag reading frame (Schönhuber et al., 2001; Lee et al., 2001; Laslett et al., 2002; Barends et al., 2002; Jacob et al., 2004; Wower et al., 2005). The most striking differences are seen in bacterial species, such as Caulobacter crescentus and some species of Synechococcus, that have forms of tmRNA that are composed of two different RNA molecules (Figure 2.5) (Keiler et al., 2000; Gaudin et al., 2002; Sharkady & Williams, 2004; Lessner et al, 2007). Initially transcribed as a single molecule, the precursor tmRNA is processed to remove an intervening loop between the 5′ and 3′ ends of the mature tmRNA. The two-piece tmRNAs from different bacteria are similar to each other in that they are composed of one large and one small RNA molecule. The large RNA molecule contains the 5′end of the tRNA-like domain, the D-arm, the extended anticodon stem, and the tag encoding sequence, along with other structural features such as pseudoknots. The small RNA molecule contains the 3′ end of the tRNA-like domain, the T-arm, and the extended anticodon stem. Together, the two molecules - 22-
Chapter Two
Literature Review
resemble a one-piece tmRNA that has been snipped in two on one side of the bottom of the elongated anticodon stem (Withey & Friedman, 2003). The tmRNA is totally conserved in eubacteria, present even in species with limited genomes such as Mycoplasma genitalium (482 genes), and is found in both Gram-negative and Gram-positive species (Watts, 2008).
Figure 2.5: The structure of tmRNA of Caulobacter crescentus (Keiler et al., 2000).
- 23-
Chapter Two
Literature Review
2.6. The structure of tmRNA 2.6. 1. The tRNA-mimic domain In 1994, it was discovered that the 5′ and 3′ ends of tmRNA fold into a structure similar to the structure of tRNA, especially that of E. coli tRNA-Ala (Watts, 2008). The tRNA mimicry of the upper-half structure of tmRNA molecule has been shown by comparative studies, chemical and enzymatic probing studies. The presence of tRNA-specific modified nucleosides in the putative TΨC-loop at positions similar to those found in the T-loop of tRNAs and the capacity to accept alanine (Felden et al., 1998). The two pseudouridines and one 5-methyluridine within the T-loop are the only modified nucleosides found in E. coli tmRNA (Felden et al., 2001). The 3′- and 5′- termini form the tRNA-like domain (TLD) (Figure 2. 6) with a significantly reduced D arm (Nameki et al., 1999a; Keiler et al., 2000; Takahashi et al., 2003). The three-dimensional model of E. coli tmRNA suggests a structure in which the TLD is connected to the circularly arranged MLD and pseudoknots through coaxially stacked helices. The entry of tmRNA into a stalled E. coli ribosome has been visualized by cryo-electron microscopy. At this particular step of transtranslation, the TLD, PK1, and the MLD contact the ribosome, whereas the PK2 to PK4 segment forms an arc that remains outside the ribosome (Wower et al., 2004). The tRNA-like part of the E. coli tmRNA is formed by a long-distance interaction between its 5′ and 3′ ends which show sequence homology with E. coli tRNAAla. This part folds into a near-perfect acceptor stem and T-hairpin, as supported by phylogenetic comparisons combined with chemical and enzymatic probing data (Barends et al., 2002; Konno et al., 2004). The TLD encompasses acceptor stem, Darm, and helix 2a (H2a), which is connected to the TΨC arm with a small connector loop. The acceptor arms of - 24-
Chapter Two
Literature Review
tRNAAla and tmRNA share similarities, i.e. both molecules encompass a GU wobble base pair (G3U70 in case of tRNAAla and G3U341 in case of tmRNA) being a major determinant of the molecule’s acceptor identity for aminoacylation (Gutmann, 2004; Hanawa-Suetsugu et al., 2001). The E. coli tmRNA contains a 7bp acceptor stem followed by a 5-bp T-stem, a 7-nt T-loop, and a classical XCCA single-stranded 3′ end, as in canonical elongator tRNAs. A sequence comparison between E. coli tmRNA and tRNAAla acceptor branches indicates that 6 out of the first 10 bp of tmRNA are identical to that of tRNAAla. This suggests that alanylated tmRNA could be recognized by activated EF-Tu (Rudinger-thirion et al., 1999).
Figure 2.6: The TLD of tmRNA (Gutmann, 2004), 2.6. 2. The Pseudoknots of tmRNA The role of pseudoknots in tmRNA function is currently controversial. On the one hand, the fact that all tmRNAs seem to contain these structures supports the idea that they play a role in biological fitness. All sequenced pseudoknots in tmRNA followed the same general design. Most sequences contained helices 3 and - 25-
Chapter Two
Literature Review
4, with the exception of the tmRNA from Oenococcusoeni and the partial sequence from the chloroplast of Pavlova lutheri, both of which lacked helix 4 and thus did not form a pseudoknot. Helix 3 usually contained five basepairs. However, a sixth pair was possible in some bacteria (Burks et al., 2005). Although pseudoknots are predominant tmRNA features, little is known about their contributions to tmRNA structure and function. Previous in vitro experiments suggested that PK1 is essential for tmRNA folding and protein tagging, whereas the three remaining pseudoknots, (PK2-PK4), are interchangeable and replaceable with stretches of single-stranded RNA (Wower et al., 2004). The first pseudoknot (PK1), 12 nucleotides upstream of the tag-initiation point, but not the other three pseudoknots (PK2-PK4) downstream of the tagencoding region, has been shown to be important for efficient tag-translation and it is functional pseudoknot (Nameki et al., 1999a; Nameki et al., 1999b; Nameki et al.,2000). It has also been shown both in vivo and in vitro that several nucleotides upstream of the tag-encoding region are involved in efficient tag-translation (Takahashi et al., 2003) and it is considered essential for tmRNA function based on the analysis of PK1 mutants in vitro. The PK1 binds near the ribosomal decoding site and may make base-specific contacts with tmRNA ligands (Tanner et al., 2006). Indeed, experimental modifications of the E. coli tmRNA (Figure 2.6) have shown that three of the pseudoknots (PK2, PK3, and PK4) are completely interchangeable and can even be replaced by unstructured regions with no significant loss of function (Kelley et al., 2001) but only PK1, which flanks the resume codon, is essential for trans-translation and is conserved in all the known tmRNA gene sequences (Nonin-Lecomte et al., 2006). Replacement of PK1 with a single-stranded RNA yields PK1L, a mutant tmRNA that tags truncated proteins very poorly in vitro but very efficiently in vivo. - 26-
Chapter Two
Literature Review
However, deletion of the whole PK1 is deleterious for protein tagging. In contrast, deletion of helix 4 yields ∆h4, a fully functional tmRNA derivative containing a single hairpin instead of PK1. Further deletions in the PK1 segment yield two subclasses of mutant tmRNAs that are unable to tag truncated proteins, but some of them bind to stalled ribosomes (Wower et al., 2009). Tanner et al., (2006) identified 6–8 base-pair (bp) hairpin structures that could functionally replace PK1. The investigators suggested that the increased stability of the hairpin replacing PK1 plays a key role in the function of tmRNA mutants, whereas the specific nucleotide sequence of the hairpin is not important. 2.6. 3. The open reading frame (ORF) of tmRNA In 1989, an internal open reading frame (ORF) was identified in the ssrA gene but evidence that it was actively translated was not found until 1995 (Watts, 2008). The tag-peptide was first found at the C-terminus of a fraction of mouse interleukin-6 expressed in Escherichia coli. Later, it was also found on other polypeptides when they were translated from artificial mRNAs lacking a termination codon or possessing a cluster of rare codons and from endogenous mRNAs in E. coli and Bacillus subtilis (Takahashi et al., 2003). The mRNA domain, encoding the last ten amino acids of the 11-amino-acid tag-peptide AANDENYALAA, is surrounded by four pseudoknot structures in the middle of this molecule (Figure 2.7). The resume codon and stop codon(s) demarcate the open reading frame in the mRNA-like domain (MLD) (Tu et al., 1995; Takada et al., 2002; Wower et al., 2004). At the nucleotide and amino acid levels neither the ORF nucleotide sequence nor the tag-peptide amino acid sequence is absolutely conserved in all known tmRNA sequences (Mehta et al., 2006).
- 27-
Chapter Two
Literature Review
Figure 2.7: Secondary structure of E. coli tmRNA (Tanner et al., 2006) All known tmRNAs of bacterial and plastid origin contain short open reading frames that begin with the "resume" codon. They are terminated with two stop codons and encode peptides ranging in size from 10 to 27 amino acids. The Ctermini of these peptides contain nonpolar (Y/A)A(L/V)AA sequences which constitute relatively promiscuous signals recognized by periplasmic protease Tsp, cytosolic protease complexes ClpXP and ClpAP, and membrane-anchored protease HflB (Wower et al., 2001). The reading frame of tmRNA is determined differently from all other known reading frames in that the first translated codon is not specified by a particular - 28-
Chapter Two
Literature Review
tRNA anticodon (Williams et al., 1999). It is unknown how the ribosome correctly chooses the position on tmRNA to resume translation. Previous studies implicate the sequence UAGUC found immediately upstream of the first codon in the tmRNA open reading frame. These nucleotides are highly conserved in natural tmRNA sequences. Mutations in this area cause loss of tmRNA function and improper frame choice (Watts, 2008).
2.7. Protein partners of tmRNA All molecules needed for protein synthesis, for tmRNA synthesis and processing, and for degradation of SsrA-tagged proteins could be considered as a part of the tmRNA system. However, three proteins facilitate binding of tmRNA to the ribosome. Elongation factor Tu forms a ternary complex with GTP and aminoacyl-tmRNA, as in regular protein synthesis. Protein SmpB binds to the ternary complex in vitro as well as to stalled ribosomes in vivo. Ribosomal protein S1 contacts the MLD and the pseudoknot-rich domain both on and off the ribosome (Wower et al., 2004; Moore & Sauer, 2007). 2.7.1. SmpB, an essential partner in tagging and rescue The group of Sauer reported on the function of a small protein called SmpB. It is encoded by the smpB gene located just upstream of the ssrA gene for tmRNA (Barends et al., 2000). However, this linkage is not observed in all bacteria. For example, in N. gonorrhoeae, smpB and ssrA are on opposite sides of the chromosome (Withey & Friedman, 2003). It was found that the deletion of smpB in E. coli results in the same phenotype as observed in ssrA-defective cells. From these results it was concluded that SmpB neither is required for nor significantly affects tmRNA alanylation. In addition, this 160-amino-acid basic protein binds specifically and with high affinity to tmRNA (Barends et al., 2000; Gutmann, 2004). Moreover, SmpB was found to - 29-
Chapter Two
Literature Review
be unnecessary for charging of tmRNA. Another group reported that tRNA and 5S RNA compete with tmRNA for binding to SmpB (both from E. coli and Aquifex aeolicus) (Withey & Friedman, 2003). The SmpB protein is conserved throughout the bacterial kingdom and contains several conserved amino acid sequence motifs. All known biological activities of SsrA RNA require SmpB (Dulebohn et al., 2006). This protein is essential for trans-translation and it is a likely candidate as a trans-acting factor to determine the tag-initiation point. It has been shown that the depletion of SmpB results in an unsuccessful binding of tmRNA to ribosome (Lee et al., 2001). Optical biosensor and melting curve analysis combined with mutational studies suggests that one copy of SmpB binds to a single binding site on the D-arm of tmRNA in Thermus thermophilus. These models depict a single SmpB binding site on the D-arm of the tmRNA TLD. In contrast, footprinting studies predict multiple SmpB binding sites on tmRNA, with up to three SmpB molecules binding per tmRNA. Additionally, two molecules of free SmpB are suggested to bind 70S ribosomes (both, normal and stalled), two SmpB molecules in the same preaccommodated complex) (Sundermeier & Karzai, 2007). Furthermore, SmpB is reported to protect tmRNA from degradation by RNase R. This study also demonstrates that SmpB binds with high affinity to tmRNA and that this direct binding is responsible for its protection from degradation by RNase R (Sundermeier et al., 2005; Kurita et al., 2007a; Sundermeier & Karzai, 2007). Although the C-terminal tail of SmpB has been suggested to have a crucial role in the ribosomal processes of trans-translation, its position, structure and behavior in the ribosome remain unknown (Kurita et al., 2007a). It has been shown that in Salmonella typhimurium, insertion mutations in smpB prevent plating of bacteriophage P22 but not c1– mutants of P22. This - 30-
Chapter Two
Literature Review
phenotype is the same as that originally reported by Retallack et al., (1994) for plating of λimmP22 hybrid phage on SsrA-defective E.coli. Another possible role for SmpB would be to serve as a protein mimic of the anticodon helix and loop of a normal tRNA, in a manner analogous to domain 4 of elongation factor G (Karzai et al., 1999). The 70S ribosomes contain two binding sites for SmpB, one close to the Psite of the small subunit and one near the factor-binding site of the large subunit. This observation suggests that two different SmpB molecules participate in transtranslation (Ivanova et al., 2005). Additionally, SmpB binds to the elbow region of tmRNA and also interacts with several helices of 23S RNA in the 50S subunit (Metzinger et al., 2005; Moore & Sauer, 2007; Kurita et al., 2007b). 2.7.2. Does SmpB recognize stalled ribosomes? The specific roles of SmpB protein in the trans-translation process remain a matter of some debate. It is clear that SmpB is required for promoting association of tmRNA with stalled ribosomes and it has been demonstrated that the unstructured C-terminal tail of SmpB plays a key role in promoting the initial peptide bond formation event in trans-translation whereas the SmpB does not prebind stalled ribosome and that functional SmpB-stalled ribosome interactions require tmRNA (Sundermeier et al., 2005). Therefore, two competing models have emerged in recent years. The first model suggests that a preformed 1:1:1 complex of SmpB-tmRNA-EF-Tu (GTP) recognizes and binds a stalled ribosome to initiate trans-translation. The second model suggests that SmpB might pre-bind stalled ribosome to recruit tmRNA and initiate trans-translation (Metzinger et al., 2005; Moore & Sauer, 2007; Sundermeier & Karzai, 2007). In the cell, SmpB is predominantly ribosome-bound, independently of the presence of tmRNA, suggesting that SmpB could be associated with ribosomes at - 31-
Chapter Two
Literature Review
other times than during trans-translation. Existing data indicate that SmpB may be in complex with tmRNA during the entire trans-translation cycle on the ribosome (Ivanova et al., 2005). It was found that under certain non-physiological conditions free SmpB can interact with ribosomes, however, this interaction is labile and salt sensitive (Sundermeier & Karzai, 2007). A very surprising observation of another recent study, however, is that SmpB protein has higher apparent binding affinity for the 70S ribosome, and its subunits, than for tmRNA (Dulebohn et al., 2007). 2.7.3. The elongation factor Tu (EF-Tu), the G Protein The similarity between canonical tRNAs and TLD of tmRNA led to the assumption that EF-Tu might interact with the TLD as it does with tRNAs. Biochemical and structural studies showed that EF-Tu interacts with the 3′ end of tRNAs which is smilar to the one of tmRNA. Thus, in addition to SmpB, two other proteins, EF-Tu and alanyl-tRNA synthetase can also bind to the TLD. The EF-Tu is required for proper delivery of tmRNA to the stalled ribosome. In the absence of EF-Tu the plateau level of alanine incorporation into the stalled peptide chain is significantly reduced, possibly because EF-Tu stablizes the acyl-ester bond of alanyl-tmRNAAla, thus, increasing the amount of available aminoacylated tmRNA (Rudinger-thirion et al., 1999; Valle et al., 2003; Ivanova et al., 2005). Because tmRNA does not have an anticodon, GTP hydrolysis and subsequent A-site accommodation must be controlled by a different mechanism than the one used by conventional tRNAs. The tmRNA-mediated addition of alanine to a stalled peptide or protein can occur in the absence of EF-Tu in vitro, but the rate is very slow. Hence, EF-Tu is almost certainly required for normal tmRNA-mediated tagging in vivo. Interestingly, EF-Tu·GDP binds regions of tmRNA outside the tRNA-mimic domain (Moore & Sauer, 2007). - 32-
Chapter Two
Literature Review
The tmRNA has been shown to bind to 70S ribosomes but not to ribosomal subunits apparently in an aminoacylation-dependent manner. All aminoacylated tRNAs enter the elongation cycle as ternary complexes with elongation factor Tu and GTP (EF-Tu: GTP) (Wower et al., 2001). 2.7.4. Ribosomal protein S1 Another candidate is the ribosomal protein S1, the largest ribosomal protein that binds weakly and reversibly to the head of the 30S ribosomal subunit and it can cross-link with a relatively wide area of the lower half of tmRNA, including PK2, PK3, PK4, and U85 (Wower et al., 2000). It has been shown that SmpB and S1 together with several other protein factors form a complex with tmRNA in E. coli cell (Lee et al., 2001; McGinness & Sauer, 2004). Ribosomal protein S1, however, is not found in all bacterial lineages, specifically the low G+C group of Gram-positive bacteria. Thus, at least in this group of bacteria, tmRNA must find an alternative binding site (Kelley et al, 2001; Skorski et al., 2007). The S1 copurifies with tmRNA–SmpB complexes, cross-links to tmRNA both in the presence and absence of ribosomes in vitro, and binds to tmRNA in vitro, but its role in tmRNA function is not quite clear. Several roles for S1 in tmRNA function have been postulated, including assisting in determination of the tmRNA reading frame, delivery of tmRNA to stalled ribosomes, and protection of tmRNA from ribonuclease degradation (Wower et al., 2000). Saguy et al., (2007) demonstrated that, in vitro, S1 is dispensable for the tRNA-like role of tmRNA but is essential for its mRNA function. Increasing or decreasing the amount of protein S1 in vivo reduces the overall amount of transtranslated proteins. Conceivably, S1 could prevent degradation of the tmRNA in the cytoplasm before it is loaded onto the ribosome and/or it could be involved in translation resumption onto tmRNA internal ORF, especially since the latter lacks a - 33-
Chapter Two
Literature Review
Shine Dalgarno element (SD) or an initiation codon (in most species, translation resumes onto an alanine codon). Binding of S1 to tmRNA occurs regardless of whether the tmRNA is aminoacylated. Binding studies using tmRNA variants deleted for various regions suggest that PK2, PK3, and PK4 are involved in S1 binding. A cross-linking study identified PK2 and PK4 and a site upstream of the resume codon as likely S1 binding sites. Results of a study probing tmRNA structure showed that binding of S1 results in a significant conformational change and also provided evidence that S1 binds PK2. Results from these studies led to the suggestion that S1 may facilitate the transition of tmRNA from tRNA activity to mRNA activity through its unwinding activity. Alternatively, because binding of S1 alters tmRNA structure, it could act to relieve strains that might develop in the loop regions (Withey & Friedman, 2003).
2.8. Bacteriophage Twort and Felix d’Herelle were the first who recognized viruses that infect bacteria and the name bacteriophage is credited to d’Herelle and means “eaters of bacteria”. In the 1930s and subsequent decades virologists used these viruses as model systems to investigate many aspects of virology, including virus structure, genetics, and replication (Guttman & Kutter, 2002; Cann, 2005). Phages are tailed, cubic, filamentous, or pleomorphic and contain singlestranded or double-stranded DNA or RNA. They are classified into 13 families. Tailed phages are far more numerous than other types, are enormously diversified, and seem to be the oldest of all phage groups (Schaechter, 2004). They are almost incomprehensibly abundant in the environment. There are about 10 million bacteriophage particles in atypical milliliter of coastal seawater (Hendrix, 2002).
- 34-
Chapter Two
Literature Review
It is now realized that phages play an important role in ecology, influence the evolution of bacterial genomes, and may provide potential tools to face the antibiotic resistance crisis in medicine and therapeutic use of phages against pathogenic bacteria (Chibani-Chennoufi et al., 2004). Furthermore, phages serve as a driving force in bacterial pathogenesis, acting not only in the evolution of bacterial pathogens through gene transfer, but also contributing directly to bacterial pathogenesis at the time of infection (Wagner & Waldor, 2002). 2.8.1. Lambda phage Bacteriophage lambda (λ) has been studied for over 50 years and has served as a model for understanding genetic networks, control and development (Osterhout et al., 2007). As a temperate phage, λ is able to enter either of two alternative modes of development upon infection of E coli: the lytic and lysogenic pathways (Herskowitz & Hagen, 1980; Becker & Murialdo, 1990; Gabig et al., 1998). Lytic development is lethal to host Escherichia coli, resulting in amplification and release of progeny phage. In the lysogenic state the phage integrates into the host chromosome, where it can silence lytic promoters and replicate quiescently as a prophage (Osterhout et al., 2007). Temperate bacteriophages are characterized by their ability to maintain their genome into the host, a process called lysogeny. Most temperate phages integrate their genome into the host’s chromosome, becoming prophages (Panis et al., 2010). In the lysogenic pathway, two separate events occur: the phage genome recombines with the bacterial chromosome to integrate the phage DNA into the host chromosome, and the phage produces a repressor that binds to phage DNA to shut off synthesis of most phage-encoded products (Schindler & Echols, 1981).
- 35-
Chapter Two
Literature Review
The integrated phage is called a prophage and the bacterium harboring it is a lysogen. The prophage is maintained by the bacterium in the quiescent state until an inducing event such as DNA damage occurs. Upon induction, repression is removed, the prophage is excised from the bacterial chromosome, and phage particles are produced as in a lytic infection (Friedman et al., 1984). These systems of lytic growth, lysogenic growth, and lysogenic induction from the prophage state are excellent model systems for understanding developmental pathways and the switches between these pathways (Oppenheim et al., 2005). Recently, it has been shown that bacteriophage λ has an archetypal immunity system, which prevents the superinfection of its Escherichia coli lysogens and it is now known that superinfection can occur with toxigenic lambda-like phages at a high frequency (Fogg et al., 2010). 2.8.1.1. The lytic life cycle The lytic cycle can start either with prophage induction or with infection. The initial interaction between virion and host cell is carried out by the side tail fibers, which interact with an abundant component of the cell surface, probably the outer membrane porin (OmpC) (Hendrix & Duda, 1992). Subsequently the central (gpJ) tail fiber binds to the LamB protein (maltoporin) which is physiologically significant only in maltose and maltosaccharide permeation across the outer membrane (Death et al., 1993). Successful adsorption triggers injection of the DNA which exits the phage head through the tail and enters the bacterial cytoplasm after traversing the outer membrane, periplasm, and inner membrane. Immediately upon DNA entry into the cytoplasm, the single-stranded extensions of the DNA pair with one another, and
- 36-
Chapter Two
Literature Review
the DNA is converted to a covalently closed circle though the action of host cell DNA ligase (Hendrix, 2002). The host RNA polymerase, unaided by other factors, recognizes three promoters within λ DNA, designated pL (leftward), pR (rightward), and pR′ (the socalled late promoter) (Rosenberg et al, 1978; Rosenberg & Court, 1979; Mason et al., 1991). In the absence of phage-encoded antitermination factors, the pL transcript terminates after gene N. About half the pR transcripts terminate after gene cro, the remainder after gene P. The pR′ transcripts terminate almost immediately to produce a short (194 nucleotide, or 6S) RNA that does not encode any protein. Thus the early proteins synthesized by λ are N and cro and comparatively lesser amounts of cII, O, and P (Figure 2.8) (Dodson et al., 1986; Roberts, 1993; Glinkowska et al., 1999; Datta et al., 2005; Birge, 2006).
Figure 2.8: Lytic transcription program (Calendar, 2006). Following assembly of the progeny virions, the host cell is lysed by the products of the R and S genes, where R protein is an endolysin that attacks peptidoglycan glycosidic linkages and S protein is a holin. Holin forms lethal lesions, or holes, in the phage lambda the holes have been shown to be large enough to allow release of prefolded active endolysin from the cytoplasm, which results in destruction of the cell wall, followed by lysis within seconds (Dewey et al., 2010). - 37-
Chapter Two
Literature Review
2.8.1.2. The temperate life cycle The first stages of a λ phage infection that ultimately results in a temperate response are the same as those that initiate the lytic cycle. However, when a temperate response occurs, the bulk of the phage-specific RNA synthesis gradually slows to a halt at a somewhat indeterminate time after delayed early mRNA synthesis has begun. Concomitantly with the reduced mRNA synthesis, the phage DNA physically inserts itself into the bacterial DNA and becomes a prophage. The prophage behaves like any E. coli genetic element (Ball and Johnson, 1991; Griffiths et al., 2000; Hendrix, 2002). Normally the following two requirements for integration must be fulfilled: (1) adequate pairing between specific attachment regions on the DNA of phage and host and (2) an integration-specific protein specified by a viral gene (Gottesman and Yarmonlisky, 1968; Landy & Ross, 1977). Two phage proteins, Int and CI, are required to form stable lysogens (Kobiler et al., 2005). Int allows the integration of the phage genome into the bacterial chromosome, and CI represses the two early phage promoters to prevent any lytic phage gene expression. When λ first infects, Int and CI are not initially made, and the phage initiates gene expression along a set of events that are common to both the lytic and lysogenic pathways (Figure 2.13). If conditions are favorable during this initial phase, Int and CI synthesis can be switched on to enable lysogenic development. This activation depends primarily upon the phage CII function (Court et al., 2007). Among the genes contained within the L2 and R1 transcripts are cII and cIII, which have an important role in any temperate response. Their gene products not only act as regulators of λ repressor expression but also stimulate int transcription from pI and their effect is exerted via the cII protein. The cII gene is located - 38-
Chapter Two
Literature Review
between the tR1 terminator and the replication genes and, thus, is transcribed with the early lytic genes (Birge, 2006). Lambda CII is the key protein that influences the lysis/lysogeny decision of lambda by activating several phage promoters and it is modulated by a number of phage and host genes (Bandyopadhyay et al., 2010). Another gene required for lysogenic development is cIII, located beyond tL1 in the pL operon. Mutations in these genes as well as in the cI gene encoding the repressor function cause λ plaques to be clear unlike the normal turbid plaques where the turbidity indicates growth of lysogenic cells. Whereas the CI repressor is required to maintain the repressed lysogenic state, the CII and CIII proteins are only required to initially activate CI synthesis Once CI has been made, the CII and CIII functions are no longer required because CI can maintain its own synthesis (Court et al., 2007). 2.8.1.3. The lytic and lysogenic decision The determinants of lytic versus lysogenic growth (Figure 2.9) appear to depend on several factors, such as multiplicity of infection, temperature, and host cell physiology (e.g., nutrient state and size) (Maynard et al., 2010). The phage switches into the "lytic state" when the repressor protein is cleaved in half by the recA protein, an action initiated by DNA damage. As repressor is destroyed, the cro gene is derepressed, the cro protein is made occupies site OR3, turning off transcription of the cl gene, yet allowing its own synthesis. In this fashion, the phage can switch from one state (lysogeny) to another (lytic growth) in response to an external signal (Ackers et al., 1982; Banuett et al., 1986). The cro gene, the first gene expressed from the pR operon, is required for lytic development. Cro is a weak repressor that binds the same OL and OR sites as CI but with different relative affinities. Cro binds best to OR3, by which it blocks CI synthesis from pRM (Johnson et al., 1980; Dodd et al.,2004). Presumably, Cro - 39-
Chapter Two
Literature Review
mediated repression of early lytic transcription is also required for completion of the lytic program after prophage induction, but this has not been demonstrated directly (Hochschild & Lewis, 2009). Other known important influences on the lytic/lysogenic decision are nutritional conditions, particularly starvation of the cells before infection, the multiplicity of infection that is, the number of phages infecting a single cell simultaneously. Higher multiplicity of infection strongly favors the lysogenic cycle, probably because the concentration of CII and CIII proteins in the cell increase (Tomoyasu et al., 1993) as the number of copies of the cII and cIII genes being expressed in the cell increases, but the HfI activity remains constant (Schmeissner et al., 1981; Hoyt et al., 1982; Friedman et al., 1984; Hendrix, 2002; Court et al., 2007). The lysogenic state of λ phage is exceptionally stable yet the prophage is readily induced in response to DNA damage. This delicate epigenetic switch is believed to be regulated by two proteins; the lysogenic maintenance promoting protein CI and the early lytic protein Cro. The presence of the cro gene might be unimportant for the lysogenic to lytic switch during induction of the λ prophage indicationg the cro's primary role in induction is instead to mediate weak repression of the early lytic promoters (Svenningsen et al., 2005). Furthermore, once CI repressor is made from pRE, the repressor shuts off the early promoters pL and pR by binding at operators OL and OR (Ptashne, 2004). This shuts off all λ functions in the pL and pR operons including CII and CIII, thereby precluding continued CI expression from the CII-activated pRE promoter. CI repressor continues to be made, however, by the enhancement of a weak promoter, pRM, located downstream of pRE (Hoopes & McClure, 1985). CI itself
- 40-
Chapter Two
Literature Review
activates the pRM promoter. Thus, CI acts both as a repressor and an activator (Dodd et al., 2001; Court et al., 2007; Hochschild & Lewis, 2009).
Figure 2.9: Phage λ life cycle (Little, 2006) 2.8.2. ExAssist helper phage Exassist helper phage is M13 virus containing amber codon in gene I and II and α complementing β galactosidase sequence. This sequence may interfere with sequencing or site directed mutagenesis where oligonucleotide primers hybridize to β galactosidase sequence (Cowell & Austin, 1997). 2.8.3. M13 phage Among the simplest helical capsids are those of the well-known bacteriophages of the family Inoviridae, such as M13 and fd. These phages are about 900 nm long and 9 nm in diameter, and the particles contain five proteins. The major coat protein is the product of phage gene 8 (g8p) and there are 2700 to - 41-
Chapter Two
Literature Review
3000 copies of this protein per particle, together with approximately five copies each of four minor capsid proteins (g3p, g6p, g7p, and g9p) located at the ends of the filamentous particle (Cann, 2005). Bacteriophage M13 is an F-specific filamentous coliphage (Ff) closely related to the phages fl, fd and ZJ/2 (Rivera et al, 1978) and is one of the most studied filamentous phages. This filamentous phage is a flexible long thin rod of almost 0.9 mm length and about 7 nm in diameter (Tey et al., 2009). The inner diameter of the protein capsid is 2.5 nm. This encloses a single-strand loop of DNA that extends the entire length of the filament. Stretched out, the viral genome would be nearly 2 µm in length. The capsid coat consists of about 2,700 individual protein subunits that overlap one another. At one end of the virion are four pilot proteins that guide the virus into and out of the host (Staley et al., 2007). The M13 phage has several unique and significant characteristics that made it a preferable tool over other phages for many biological applications and studies. One of the applications of M13 phage is phage display (Tey et al., 2009). The genome of this phage consists of 6.4 kb of single-stranded, (+) sense, circular DNA and encodes ten genes (Figure 2.10) that are transcribed in the same direction with the same polarity as that of the DNA in the virion (Zinder & Horiuchi, 1985). Unlike most icosahedral virions, the filamentous M13 capsid is encased in a long tube composed of thousands of copies of a single major coat protein, with four additional minor capsid proteins at the tips (Cann, 2005). The major coat proteins (gpVIII) along the long side are all identical and present in many copies (about 2700 subunits). On either end of the filamentous rod is capped with two different minor coat proteins; gpVII and IX on one side and VI and III on the other side (Tey et al., 2009). Hence, the genome size can also be increased by the addition of extra sequences in the nonessential intergenic region - 42-
Chapter Two
Literature Review
without becoming incapable of being packaged into the capsid (Mullen et al., 2006; Staley et al., 2007). The DNA of M13 is not injected into the host cell, as occurs with most bacterial viruses. The virion attaches at or near the F pilus of E. coli. Two theories have been advanced for viral penetration: (a) the virion follows a groove in the F pilus to a receptor site on the cell surface where it enters or (b) the virion stimulates a progressive depolymerization of the pilus that retracts the tip and brings the M13 to the surface (Staley et al., 2007). Entry of the intact virion is evident, and decapsidation occurs within the cell cytoplasm. Replication of the (+) single strand of viral DNA occurs simultaneously with coat removal. The enzymes involved in initial replication are provided by the host and are normally associated with synthesis of extrachromosomal elements in the bacterium. M13 does not take over the genetic apparatus of the host. The growth rate of E. coli producing M13 virions is reduced by about one-third (Rivera
Morphogenesis
et al., 1978; Staley et al., 2007).
Figure 2.10: The genome of M13 (Staley et al., 2007). - 43-
Chapter Two
Literature Review
Infection of male Escherichia coli cells by filamentous bacteriophages M13 involves interaction of the phage minor coat gene 3 protein (g3p) with the bacterial F pilus, and subsequently with the integral membrane protein TolA. G3p consists of three domains (N1, N2, and CT). The N2 domain interacts with the F pilus, whereas the N1 domain, connected to N2 by a flexible glycine-rich linker and tightly interacting with it on the phage, forms a complex with the C-terminal domain of TolA at later stages of the infection process (Stengele et al., 1990; Webster, 1991; Lubkowski et al., 1999). It is also known that in the phage life cycle different host proteins are engaged, as exemplified by the bacterial TolQRA proteins involved in the infection process, the bacterial stress protein PspA induced by the phage gene IV protein during assembly and release of new phage particles, and the host endonuclease RNase E involved in processing phage mRNA (Karlsson et al., 2005).
2.9. Phage physiology and trans-translation Julio and his colleagues, (2000) found that ssrA plays a role in the pathogenesis of Salmonella and serves as an attachment site for Salmonellaspecific sequences, and is required for the growth of phage P22 indicationg that tmRNA
directly
or
indirectly
affects
the
expression
of
C1-controlled
genes/functions required for phage growth. One notable phenotypic characteristic of E. coli mutants lacking tmRNA activity, discovered early on, is the failure of these mutants to support growth of hybrid phages constructed between coliphage¸ and Salmonella phage P22, λimmP22. The effects of tmRNA variants upon bacteriophage growth require functional tmRNA for growth in E. coli.
Withey & Friedman, (2003) have
constructed two classes of tmRNA mutants that were defective either in their ability to be charged with alanine or in their ability to direct proteolysis by - 44-
Chapter Two
Literature Review
encoding a tag sequence not recognized by proteases and they found that charging of tmRNA with alanine is essential for phage growth but that degradation of tmRNA-tagged proteins is not essential for phage growth. Furthermore, experiments with thermoinducible mutants of phage Mu (Ranquet et al, 2001), which require tmRNA for induction, provided evidence suggesting that Mu uses trans-translation as a regulator of gene expression and ssrA dependent tagging of the C-terminus of truncated forms of Mu phage repressor was shown to be the mechanism that controls the stability of Mu lysogens (Ivanova, 2005). Both λ-P22 growth and Mu induction can be supported by tmRNA variants that fail to target tagged proteins for degradation. In these cases, rescue of a single stalled ribosome has been proposed to allow the ribosomes queued behind it to complete normal translation without further need for tmRNA (Moore & Sauer, 2007). The E. coli LacI and LexA repressors, as well as the phage λ cI repressor are targets of SsrA, suggesting that SsrA could be part of a general sensing mechanism (Ranquet et al.,2001; Marshall-Batty & Nakai, 2003).
- 45-
Materials & Methods
Chapter Three
3. MATERIALS AND METHODS 3.1. Materials 3.1.1. Tools and Apparatus The current study was carried out in the Medical Research Center (MRC) Hawler Medical University (HMU)-Hawler and a part of this work was carried out also in the laboratory of Molecular Biology in Kurdistan Institution for Strategic Studies and Scientific Research in Sulaimani. All used equipments in both centers are tabulated in the appendix 1. 3.1.2. Chemicals and Buffers All chemicals, buffers, were of high purity and have been purchased from SIGMA, Fermentas, and NEB and they are tabulated in the appendix 2. 3.1.3. Enzymes and Enzyme Buffers Protocols of molecular biology are highly dependent on the quality of enzymes and their buffers, therefore, the enzymes were ordered from well-known companies (Table 3.1). 3.1.4. Preparation of Solutions and Buffers 3.1.4.1. IPTG (100mM) The solution of IPTG (100 mM) was prepared by dissolving 1.19gm of isopropyl β – D- thiogalactopyranoside (MW=238.3) in 40 ml H2O; adjusting the volume to 50 ml with H2O then dividing in 5ml aliquots to be sterilized by filtration. This solution is stable for 2-4 months when it is stored at -20ºC (Agrawal 2008).
- 46-
Materials & Methods
Chapter Three
Table (3.1): Enzymes and Enzyme Buffer Enzymes
Company
Restriction Enzymes: EcoRI , BamH I , SalI , SmaI , XbaI , XhoI , BspE I , AccI , HindIII , PstI , EcoRV , Pvu II ,Dpn I , Other Enzymes and Kits
NEB , Fermentas
T4 Ligase
Fermentas
T4 polynucleotide kinase (PNK)
NEB
Alkaline phosphatase (CIP )
NEB
M-MuLV Reverse Transcriptase
Fermentas
Ribonuclease inhibitor
Fermentas
Taq Polymerase and Buffer
Fermentas
Long PCR enzyme mix
Fermentas
Taq DNA polymerase with standard taq buffer
NEB
Long Amp.tag PCR kit
NEB
Pfu DNA polymerase
Fermentas
Phusion High-Fidelity PCR kit
NEB
InsTAclone™ PCR Cloning Kit
Fermentas
GeneJET™ Gel Extraction Kit
Fermentas
GenElute™ Plasmid Miniprep Kit
Sigma
QIAquick PCR purification kit
Qiagene
E.Z.N.A.™ Viral RNA kit.
BioRad
3.1.4.2. X-gal (20 mg/ml) The solution of X-gal (20 mg/ml) was prepared by dissolving 400 mg of 5bromo-4-chloro-3-Indolyl-β-D-galactoside (X-gal) in 20 ml of N, N´-di-methyl formamide then the solution was divided into 500µL aliquots in a glass or polypropylene tube, protected from light and stored at -20ºC. This stock solution is stable for 2-4 months (Agrawal, 2008).
- 47-
Materials & Methods
Chapter Three
3.1.4.3. Ampicillin solution It was purchased from SIGMA as a powder and prepared as stock solution in water at concentration of 100mg/ml, then working solution were 100µg/ml. 3.1.4.4. Chloramphenicol solution It was purchased from SIGMA as a powder and the stock solutions were prepared in ethanol at concentration of 20mg/ml, then working concentrations were 20µg/ml. 3.1.5. Electrophoresis buffers and solutions 3.1.5.1. Ethidium bromide dye It was purchased from SIGMA as a solution and used as 1 µg/ml in dark bottle. 3.1.5.2. EDTA Solution (1M): The solution was prepared by dissolving 404.46g of EDTA in 800ml distilled water. It was stirred vigorously on a magnetic stirrer; the pH was adjusted to 8.0 by 1N NaOH and the solution was completed to 1L with ddH2O (Sambrook et al., 1989). 3.1.5.3. Tris-Boric acid-EDTA (TBE) buffer (5X) It was prepared by dissolving 54 g of Tris–base, and 27.5g of boric acid in 800ml ddH2O. , and then 20ml of 0.5M EDTA pH 8.0 was added, the volume was adjusted to 1L by adding ddH2O (Sambrook et al., 1989). 3.1.5.4. Loading buffer (6X) Loading buffer was purchased from Fermantas and in certain cases it was prepared by dissolving 0.03g of Bromophenol blue, 0.03g of xylene cyanol, 10mM Tris-HCl (PH 7.6), 60mM EDTA with 60 ml of glycerol completed to 80ml of - 48-
Materials & Methods
Chapter Three
dH2O. The pH was adjusted to 8.0 by using 10N NaOH; the volume was made up to 100ml by dH2O and kept in 4Cº (Fermentas). 3.1.5.5. Rapid-screen resuspension buffer The buffer is prepared from the following components: • 30 mM Tris-HCl (pH 8.0), • 5 mM EDTA, • 50 mM NaCl, • 20% (w/v) sucrose, • 50 µg/mL RNase A and 50 µg/mL lysozyme. 3.1.5.6. Rapid-screen lysis buffer The rapid-screen lysis buffer is prepared from the following components (Casali and Preston, 2003): • 89 mM Tris-HCl (pH 8.0) • 89 mM boric acid • 2.5 mM EDTA, • 2% (w/v) sodium dodecyl sulfate (SDS) • 5% (w/v) sucrose • 0.04% (w/v) bromophenol blue. 3.1.6. Culture Media During the current study the following culture media were used. 3.1.6.1. Luria – Bertani broth (LB) The following components were dissolved in 950 ml ddH2O; the pH adjusted to 7 and the volume was completed to a liter with ddH2O then autoclaved (Sambrook et al., 1989). - 49-
Materials & Methods
Chapter Three
Trypton ............................................................................ 10 g Yeast extract....................................................................... 5 g Sodium chloride ............................................................... 10 g 3.1.6.2. Terrific broth Trypton ............................................................................ 12 g Yeast extract...................................................................... 24 g Glycerol ............................................................................ 4ml Shaking until the solvent dissolve and sterilizing it by autoclave for 20min at 15 psi then cooling to 60ºC or less. Addition of 100 ml of sterile solution:
KH2PO4……………………….. 0.17M K2HPO4………………………..0.72 M This solution was prepared by dissolving of 2.31g of KH2PO4, 12.54g of K2HPO4 in 80ml ddH2O after the salt had been dissolved. The pH was adjusted to 7 and the volume was completed to 100ml with ddH2O (Miller, 1992). 3.1.6.3. R top agar Trypton ............................................................................ 10 g Yeast extract....................................................................... 1 g Sodium chloride ............................................................... 8 g Agar..................................................................................... 8 g They were dissolved in 950 ml ddH2O. The pH was adjusted to 7 and the volume was completed to a liter with ddH2O then autoclaved. After autoclaving, 2 ml of 1M CaCl2 and 5ml 20% glucose were added. R top agar should be supplemented with 0.01M MgS04 (Miller, 1992). - 50-
Materials & Methods
Chapter Three
3.1.6.4. R plate The components of this media are the same as R-top agar except that each liter contains 12 g instead of 8 g of agar (Miller, 1992). 3.1.6.5. SM medium NaCl ………………………………… 5.8g MgSO4 7H2O………………………. 2.0g 1M Tris HCl PH 7.4………………... 50ml 2% gelatin…………………………... 5ml The components were dissolved in 950 ml ddH2O. The pH was adjusted to 7 and the volume was completed to a liter with ddH2O then autoclaved. 3.2. Methods 3.2.1. Sterilization All media and solutions were autoclaved at 121°C p/inch2 for 15 min while dry sterilization at 180˚C for two hours was used for glasswares. 3.2.2. The pH Adjustment The pH was adjusted according to the pH of the solutions and media using Dual Channel pH/Ion/Conductivity Meter (XL50 accumet). 3.2.3. Plasmids and standard bacterial strains All laboratory standard strains and plasmids used in this study listed in (Table 3.2) are derived from Escherichia coli (K12), and they were kindly provided by Dr. Farhad Abdulkarim in Medical Research Center (MRC)-Hawler Medical University (HMU). Regarding the phage strains, λ and helper phages were kindly
- 51-
Materials & Methods
Chapter Three
provided by Dr. Shwan Kamal Rachid in Pharmaceutical Biotechnology department/ Saarland University-Germany. 3.2.4. Cloning vector plasmid The pTZ57R/T, pTZ57R, and pKO3 were used as cloning vectors whose restriction maps are shown in Figure 3.1 and Figure 3.2 respectively. 3.2.5. Maintenance and storage of bacterial cultures The cultures were maintained by sub-culturing on LB agar and incubating for 24 hrs at 37°C, then kept in the fridge at 4°C. To store isolates for a long time without losing their genetic characteristics, the bacterial strains were transferred to small vials containing Lauria-Bertani broth (LB) with sterilized 1 ml 20% glycerol, then stored at -80°C (Ausubel et al., 1987).
- 52-
Materials & Methods
Chapter Three
Figure (3.1): Restriction map of vector pTZ57R/T.
Figure (3.2): Restriction map of pKO3 - 53-
Materials & Methods
Chapter Three
3.3. Primer Design Careful primer design is crucial for the success of any DNA amplification experiment and is particularly critical when primers are designed to be used for site-specific mutagenesis. Sequenced regions of target DNA can be recovered using the Nucleotide Sequence Search program on the Entrez Browser website provided by the National Center for Biotechnology Information (NCBI) (http://www3.ncbi.nlm.nih.gov/ Entrez; Bethesda, MD). Once the sequences of ssrA and smpB genes and their flanking regions have been retrived from NCBI, specific primers can be developed to allow direct amplification (Table 3.3) or deletion (Table 3.4 and Table 3.6) of these regions according to the objectives of the study. To delete a specific region, primers were designed in a way that they could amplify the entire sequence of the plasmid except for the desired region. The 5' ends of the primers are facing each other and 3' ends orient, so the extension will amplify the entire plasmid. The 5' tails can be readily added to primers without impacting primer annealing while the 3' end of the primer should be an exact match to the template DNA, because extension by DNA polymerase depends on a good match at the 3' end, so that it is possible to add 12 nucleotides of protein A to the 5' end of forward and reverse primers as a tail (Table 3.5). This tail must be chosen from antisense strand to complement with sense strand, then it will be amplified by the reverse primer for one domain of protein A that contains a stop codon. A region with appropriate GC and AT content was chosen for designing the primers; their length and melting temperature were designed with coordination between forward and reverse primers. The melting temperatures were calculated according to the following formula: - 54-
Materials & Methods
Chapter Three
TmºC= 2(A+T) + 4(C+G) and TaºC=Tm-20±5 (Womble, 2000). Tm=melting temperature Ta=annealing temperature A=adenine C=cytosine G=guanine T=thymine
- 55-
Materials &Methods
Chapter Three
Table (3.2): Standard bacterial strains and plasmid vectors Plasmids and bacterial strains Escherichia coli SF216(MG1655) Escherichia coli SF217 (WT3110) Escherichia coli SF 263 (DH5α) Escherichia coli SF (pKO3)
Genotype/Description F- lambda- ilvG- rfb-50 rph-1
Reference MRC
thyA36, deoc2, IN (rrnD rrnE)1, rph, pyrE, Lambda-F. F' Phi80dlacZ DeltaM15 Delta (lacZYA-argF) U169 deoR recA1 endA1 hsdR17 (rKmK+) phoA supE44 lambda- thi-1
MRC MRC Link et al
CamR , M13 ori , sacB and RepA
This study
pTZN2
1928 bp ssrA region encoding tmRNA, smpB and their flanking regions inserted into smaI restriction site of pTZ57R vector. Protein A domain one (195 bp) inserted into MCS of pTZP7R/T plasmid.
pTZN3
Deletion of tmRNA gene from pTZN1
This study
pTZN4
Deletion of smpB gene from pTZN1
This study
pTZN5
Deletion of tmRNA and smpB from pTZN1 Subcloning of a 1528 BamHI and salI inserted fragment from pTZN3 into the BamHI and salI restriction sites of pKO3. Subcloning of a 1418bp BamHI and salI inserted fragment from pTZN4 into the BamHI and salI restriction sites of pKO3. Subclonig of a 868bp BamHI and salI inserted fragment from pTZN5 into the BamHI and SalI restriction sites of pKO3. Deletion of smpB gene from pKNO6
This study
pTZN1
pKON6 pKON7 pKON8 pKON9
- 56-
This study
This study This study This study This study
Materials &Methods
Chapter Three Plasmids
NF1 NF2 NF3 NF4 NF5 NF6 NF7 NF8 NF9 NF10 NF11
Description
Reference
Deletion of a 274 pb including (PK1,MLD,PK2-PK4) from pTZN1 and ligation with protein A This study (domain one) with UAA as stop codon by using primers (TLD.1T.1F and TLD.1T.1R) Deletion of a 271 pb including (PK1, MLD, PK2-PK4) from pTZN1 and ligation with protein This study A (domain one) with UAA as stop codon by using primers (TLD.2T-IF and TLD.2T-1R). This study The same as that of NF1 except that it contains UGA instead of UAA as a stop codon. The same as that of NF2 except that it contains UGA instead of UAA as a stop codon. Deletion of a 210 pb including (MLD, PK2-PK4) from pTZN1 and ligation with protein A (domain one) with UAA as stop codon using primers (PK1.1T-IF and PK1.1T-1R). Deletion of a 198 pb including (MLD, PK2-PK4) from pTZN1 and ligation with protein A (domain one) with UAA as stop codon by using primers (PK1.2T-IF and PK1.2T-1R). The same as that of NF5 except that it contains UGA instead of UAA as a stop codon. Deletion of a 181 pb including (MLD, PK2-PK4) from pTZN1 and ligation with protein A (domain one) with UAA stop codon by using primers (PK1-IF and PK1-2R). Deletion of a 198 pb including (MLD, PK2-PK4) from pTZN1 and ligation with protein A (domain one) with UAA stop codon by using primer (PK1-IF and PK1-1R). Deletion of a 256 pb including (PK1, MLD,PK2-PK4) from pTZN1 and ligation with protein A (domain one) with UAA stop codon by using primer (TLD-1F and TLD-1R) Deletion of a 282 pb including (PK1, MLD, PK2-PK4) from pTZN1 and ligation with protein A (domain one) with UAA stop codon using primer (TLD-2F and TLD-2R).
- 57-
This study This study This study This study This study This study This study This study
Materials &Methods
Chapter Three
Table (3.3): PCR Amplification Primers Name Sequence
Gene/Region
0P1F
5' TAC TTT GGT TAC TGG TCG ACT GGT T 3'
OP2R
5' TGA TGT TCC TGA GGA TCC ATG TCT T 3'
SmpB F
5' ACG CTA TCC CGG CGC TGG GTA ACA T 3'
SmpB R
5' ATT GGA ATT CAC ATC CGA CAC AAA TGT TG 3'
PKO3 F
5' AGG GCA GGG TCG TTA AAT AGC 3'
PKO3 R
5' TTA ATG CGC CGC TAC AGG GCG 3'
TMEC 2F
5 'ATT GGA ATT CAC ATC CGA CAC AAA TGT TG 3'
TM EC 1R
5' AAA GGT TAA GCT TTA ATT AGT TCT CTT CGG A 3'
PN-F1
5'A GAC AAC AAA TTC AAC AAA GAA CAA C 3'
PN-R1
5' TTT GTT GAA TTT GTT GTC TAC TTT CGG 3'
PAL F
5'AAT TAA TCA TCC GGC TCG TAT AAT GTG T 3'
PAL R
5'ATC GAT GAT ATC AAA AAA AAT GCC GCC A 3'
PN-F2
5' TTC AAC AAA GAA CAA CAA AAC GCG TTC 3'
PN-R2G PN-R2A PN-CoF PN-CoR
tmRNA region smpB gene (Accesion No. EG11782) pKO3 MCS
5 'GTT GTC TCA TTT CGG CGC CTG AGC AT 3' (UGA stop codon) 5 'GTT GTC TTA TTT CGG CGC CTG AGC AT 3' (UAA stop codon) 5' GAA GCT GTA GAC TCG AGA TTC AAC AAA GA 3' (XhoI) 5' TCT ACT TCC GGA GCT TAA GCA TCA TTT AG 3' (BspE I) (UAA stop codon)
- 58-
tmRNA gene (Accesion No. EG 30100) One domain protein A Three domain protein (with ptrc promoter) Three domain protein A One domain protein A in chimeric molecules One domain protein A in chimeric molecules One domain protein A in chimeric molecules One domain protein A for cassette mutagenesis
Position
Tm
1-25
53ºC
1904-1928
53ºC
297-303
56ºC
950-970
56ºC
995-1015
53ºC
1127-1147
53ºC
950-970
56ºC
1554-1573
56ºC
101-126
58ºC
267-293
58ºC
6-33
55.5 ºC
719-746
55.5 ºC
111-137
58 ºC
256-281
58 ºC
256-281
58 ºC
1-29
61ºC
157-185
61ºC
Materials &Methods
Chapter Three
Name
Sequence
Gene/Region
Position
Tm
pTZ57R MCS
569-593 795-820
61ºC 58.8 ºC
PT-F PT-R
5' AAC GCC AGG GTT TTC CCA GTC ACG A 3' 5' CCC AGG CTT TAC ACT TTA TGC TTC CG 3'
PD -1F
5'AAA TTC AAC AAA GAA CAA CAA AAC GCG T 3'
Three domain protein (without ptrc promoter)
108-135
58ºC
TLD-aF PK1-aF
5 ' GTA CGT GGA ACC CAA AGC GTT TAG G 3' 5 ' CAA AAG CAG CAA ACG CTG ATA AAA AAC 3'
Chimeric molecules
1110-1134 1165-1191
58ºC 58ºC
Table (3.4): Primers for deletions Name
Sequence
Deletion Region
Position
Tm
Pk1-1F
5' TGG CAA GCG AAT CTC GAG ACT GAC T 3'
MLD,PK2-PK4
1363-1387
58ºC
Pk1-1R
5' GTT TTC GTC GTT CCG GAC TAT TTT TTG 3'
1165-1191
58ºC
Pk1-2R
5 'AGC TGC TAA TCC GGA GTT TTC GTC G 3'
1182-1206
58ºC
TLD-1F
5' CTG ACT AAG CCT CGA GTA CCG AGG 3'
1382-1405
58ºC
TLD-1R
5 ' CAA CCG CCC CTC CGG ATG CAC CT 3'
1126-1148
58ºC
TLD-2F
5΄ ATG TAG TCT CGA GGA TGT AGG AAT TTC 3
1392-1418
58ºC
TLD-2R
5́' CAT GCA CCT CCG GAT TCG CAA ATC C 3’
1110-1134
58ºC
SM del I (Reverse) SM del II (Forward) TM del I (Reverse) TM del II (Forward)
5' AAG CGT CGT GAA TCA TCG GTA ATC TGA A 3'
363-390
60ºC
873-900
60ºC
1052-1080
60ºC
1452-1479
60ºC
5' AAC CTG CAC TCC AAT TAT TGA CCA GTT C 3'
A part of MLD and PK2-PK4 PK1,MLD, PK2-PK4 PK1,MLD, PK2-PK4 smpB gene
5' AAA GGT AAG TAT ACC AGA TTT ATG AGC GC 3' 5' AAT TCT CCA TCG GTG ATT ACC AGA GTC A 3'
The underlined nucleotides represent restriction site
- 59-
tmRNA gene
Materials &Methods
Chapter Three
Table (3.5): Protein A tailed-Primers for deletions Name TLD.1T-1F
Deletion / Region
Sequence 5' CATCTGTTGTTT CTG ACT AAG CAT GTA GTA CCG AGG 3'
TLD.1T-1R 5' CAT GCA CCT TGG GTT TCG CAA ATC CCG 3' 5' TTTAAGTTGTTT ACT GAC TAA GCA TGT AGT ACC GAG G 3' TLD.2T-1F ) 5' CATCTGTTGTTT CAT GCA CCT TGG GTT TCG CAA ATC C 3' TLD.2T-1R Pk1.1T-1F Pk1.1T-1R Pk1.2T-1F Pk1.2T-1R
5' CATCTGTTGTTT TGG CAA GCG AAT GTA AAG ACT GAC T 3' 5' GTT TTC GTC GTT TGC GAC TAT TTT TTG CGG 3' 5' TTTAAGAAGTTT TGG CAA GCG AAT GTA AAG ACT GAC T 3' 5' CATCTGTTGTTT GTT TTC GTC GTT TGC GAC TAT TTT TTG 3'
PK1,MLD, PK2-PK4 PK1,MLD, PK2-PK4 MLD,PK2PK4 MLD,PK2PK4
Position
Tm
1382-1405
64.5ºC
1108-1134
64.5ºC
1381-1405
64.5ºC
1110-1134
64.5ºC
1363-1387
64.5ºC
1162-1191
64.5ºC
1363-1387
64.5ºC
1165-1191
64.5ºC
The underlined nucleotides (12 extra nucleotides) represent overlapping sequence for the protein A (domain one) PCR
- 60-
Materials &Methods
Chapter Three
Table (3.6): PCR Deletion Primers (Chopping of protein A) Name PN-ChFa PN-ChFg PN-Ch1R PN-Ch2R PN-Ch3R PN-Ch4R
Sequences
Description Position Forward primer for chopping of 5' GCA GAA GCT TAA AAG CTA AAT GAT GCT 3' one domain protein A with 142-168 (UAA stop codon) UAA stop codon Forward primer for chopping of 5' GCA GAA GCT TGA AAG CTA AAT GAT GCT 3' one domain protein A with 142-168 (UGA stop codon) UGA stop codon Reverse primer for deletion of 5 'GTC ATC TTT TAA ACT TTG GAT GAA GGC 3' 91-117 a sequence of 8 amino acid Reverse primer for deletion of 5' GGC GTT TCG TTGTTCTTC GTT TAA GT 3' 68-93 a sequence of 16 amino acid Reverse primer for deletion of 5' GTT AGG TAA ATG TAA GAT CTC ATA GAA C 3' 42-69 a sequence of 24 amino acid Reverse primer for deletion of 19-45 5' GAA CGC GTT TTG TTG TTC TTT GTT GAA 3' a sequence of 32 amino acid
- 61-
Tm 59ºC 59ºC 59ºC 59ºC 59ºC 59ºC
Materials & Methods
Chapter Three
3.4. Colony PCR protocol for tmRNA region amplification To amplify the tmRNA region, colony PCR protocol was applied as following: 1. MG1655 strain was cultured on LB agar plate and was incubated at 37ºC for 16hr. 2. A single colony was picked up from overnight culture and was resuspended in 50µl ddH2O. The cells suspension was incubated at 37°C water bath for at least 30 min (Abdulkarim, 1994). 3. PCR master reactions were prepared in a sterile 0.5ml PCR tube: Reaction Components Nuclease free water 10X Taq buffer 10mM dNTP mix 10pmol forward primer (OP 1F) 10pmol reverse primer ( OP 2R) MgCl2 DNA (cell suspension) Taq DNA polymerase (5 u/µl)
Sample 34.8 µl 5 µl 1 µl 1 µl 1 µl 2 µl 5 µl 0.2 µl
Negative control 34.8 µl 5 µl 1 µl 1 µl 1 µl 2 µl 5µl of ddH2O instead of DNA 0.2 µl
4. The PCR reactions were programed in a thermocycler according to the used primers as followings: Steps
Initial Denaturation Denaturation Annealing Extension Final extension Hold
Temperature
Duration
95 ºC 95 ºC 53ºC 72ºC 72ºC 4 ºC
10 min 30 sec 45 sec 2 min 10 min
No. of Cycles 1 Cycle 30 Cycles 1 Cycle
5. The PCR products were examined by electrophoresis on an agarose gel.
- 62-
Materials & Methods
Chapter Three
3.5. Agarose gel electrophoresis protocol This steps was done according to Sambrook et al., (1989) : 1. Placing 1g of powdered, molecular-biology-grade agarose into a conical flask; addition of 100ml of electrophoresis running buffer (1X TBE); and mixing the contents of the flask by swirling. 2. Melting the agarose in a microwave, until agarose became clear. Cooling the agarose mixture to a temperature of approx 55ºC, then 10 µl of 10mg/ml ethidium bromide was added and mixing the gel solution thoroughly by gentle swirling. 3. Pouring the agarose mixture into the assembled gel support (10*20cm); insertion of the comb and allowing the gel to set completly (30-45 min at room temperature). 4. Placing the gel on its support into the electrophoresis apparatus and filling with sufficient electrophoresis running buffer to cover the wells approximately 1mm over the gel, then removing the comb. 5. Mixing the samples of DNA with 0.20 volumes of the desired 6x loading buffer and loading the samples in separate wells; including a DNA size marker in one of the lanes. 6. Closing the lid of the tank to generate an electrical circuit and running at a voltage of 1 to 5 volts/cm; check bubbles are arising from the anode and that the dye is migrating into the gel. 7. After a complete migration of markers, the gel is removed and visualized under ultraviolet light and photographed. 8. Determination of the relative sizes of fragments using the molecular-weight ladders. - 63-
Materials & Methods
Chapter Three
3.6. Recovery of DNA from agarose gel The PCR products from agarose gel were recovered by using GeneJET™ Gel Extraction Kit (Fermentas) which consists of: • Binding Buffer • Wash Buffer (concentrated) • Elution Buffer (10 mM Tris-HCl, pH 8.5) • GeneJET™ Purification Columns (preassembled with collection tubes) Before using the kit, wash buffer should be diluted by adding 45ml of 96% ethanol to 9ml of concentrated wash buffer then: 1. Excising gel slice containing the DNA fragment using a clean scalpel or razor blade. Cutting as close to the DNA as possible to minimize the gel volume. Placing the gel slice into a pre-weighed 1.5 ml tube and weighing. Then, recording the weight of the gel slice. 2. Adding 1:1 volume of Binding Buffer to the gel slice (volume: weight) 3. The gel mixture was incubated at 50-60°C for 10 min or until the gel slice was completely dissolved. The tube was mixed by inversion every few minutes to facilitate the melting process ensuring that the gel is completely dissolved. 4. The color of the solution was checked; A yellow color indicates an optimal pH for DNA binding. If the color of the solution was orange or violet, 10 µl of 3 M sodium acetate pH 5.2 solution was added and mixed. 5. This step was used only when DNA fragment is <500 bp or >10 kb long. • If the DNA fragment was <500 bp, a 1:2 volume of 100% isopropanol to the solubilized gel solution (e.g. 100 µl of isopropanol should be added to 100 mg gel slice solubilized in 100 µl of Binding Buffer). - 64-
Materials & Methods
Chapter Three
• If the DNA fragment was >10 kb, a 1:2 volume of water to the solubilized gel solution (e.g. 100 µl of water should be added to 100 mg gel slice solubilized in 100 µl of Binding Buffer). 6. Transferring up to 800 µl of the solubilized gel solution (from step 3 or 4) to the GeneJET™ purification column. The solution was centrifuged for 1 min. Discarding the flow-through and placing the column back into the same collection tube. 7. This additional binding step is used only if the purified DNA will be used for sequencing. Adding 100 µl of the Binding Buffer to the GeneJET™ purification column. Centrifuged for 1 min. Discarding the flow-through and placing the column back into the same collection tube. 8. 700 µl of Wash Buffer was added to the GeneJET™ purification column. Centrifuged for 1 min. The flow-through was discarded and the column was placed back into the same collection tube. 9. The empty GeneJET™ purification column was centrifuged for an additional 1 min to completely remove residual wash buffer. 10. The GeneJET™ purification column was transferred into a clean 1.5 ml microcentrifuge tube (not included). 50 µl of Elution Buffer or nuclease free water was added to the center of the purification column membrane. Centrifuged for 1 min. 3.7. Digestion of PCR product The PCR product was digested separately with EcoRV, AccI, PvuII restriction enzymes. The reaction mixtures were prepared each in a thin-wall tube at room temperature; mixed thoroughly, span briefly, and incubated at 37˚C for 1hr; reactions were stopped by heating at 80˚C for 10 min; the result was analyzed by gel electrophoresis. - 65-
Materials & Methods
Chapter Three Volume
Component
EcoRV
PvuII
AccI
Water, nuclease free 22 µl 2 µl (fermentas red 10X buffer buffer) PCR product 5 µl
22 µl 2 µl (fermentas red buffer) 5 µl
22 µl 2 µl (NEBuffer 4) 5 µl
Restriction enzyme
1 µl (10 u/µl)
1 µl (10 u/µl)
1 µl (10 u/µl)
Total volume
30 µl
30 µl
30 µl
3.8. Dpn I digestion The Dpn I digests adenomethylated DNA sequence 5'-GATC-3' (Lacks, 1980). To prepare the reaction mixture, the following components were added at room temperature. Component Water, nuclease-free 10X tango buffer Gel purified DNA Dpn I (10 u/µl) Total volume
Volume 7 µl 2 µl 10 µl 1 µl 20 µl
The components were mixed thoroughly, spined briefly and incubated at 37˚C for 16hr and then to inactivate the enzyme, the mixture was heated at 80˚C for 10min. 3.9. DNA clean up The DNA from residual reaction components were cleaned by QIAquick PCR purification kit which consists of: • QIAquick Spin Columns • Buffer PB • Buffer PE (concentrate) - 66-
Materials & Methods
Chapter Three
• Buffer EB • pH Indicator • Collection Tubes • Loading Dye Before using this kit, wash buffer was diluted (buffer PE) by adding 24ml of 96% ethanol to 6ml of concentrated wash buffer to obtain 30ml of PE buffer; adding 1:250 volume pH indicator I to Buffer PB., and then: 1. Adding 5 volumes of Buffer PB to 1 volume of the enzymatic reaction and mixing. 2. If pH indicator I has been added to Buffer PB, the color of the mixture is yellow. If the color of the mixture is orange or violet, 10 µl of 3 M sodium acetate, pH 5.0, was added and mixed. The color of the mixture will turn to yellow. 3. AQIAquick spin column was placed in a provided 2 ml collection tube. 4. To bind DNA, the sample was applied to the QIAquick column and centrifuged at 13000rpm for 30–60 s. 5. The Flow-through was discarded. The QIAquick column was placed back into the same tube. . 6. To wash, 0.75 ml Buffer PE was added to the QIAquick column and centrifuged at 13000rpm for 30–60 s. 7. Flow-through was discarded and the QIAquick column was placed back in the same tube. The column was centrifuged for an additional 1 min. Residual ethanol from Buffer PE will not be completely removed unless the flow-through was discarded before this additional centrifugation. - 67-
Materials & Methods
Chapter Three
8. Placing QIAquick column in a clean 1.5 ml microcentrifuge tube. 9. To elute DNA, 50 µl Buffer EB (10 mM Tris·Cl, pH 8.5) or water (pH 7.0– 8.5) was added to the center of the QIAquick membrane and centrifuged the column for 1 min. 3.10. Exonuclease I Nucleotides from single-stranded DNA were removed in the 3' to 5' direction by mixing the components briefly; spinning thoroughly and incubated at 37 ˚C for 1hr. To inactivate the enzyme, the mixture is heated at 80˚C for 20min and then DNA from enzymatic reaction component was cleaned by QIAquick PCR purification kit Components
Volume
Water, nuclease-free
34 µl
10X Exonuclease Buffer
5 µl
DNA
10 µl
Exonuclease (20 u/µl)
1 µl
Total volume
50 µl
3.11. Cloning of PCR Product to pTZ57R 3.11.1. Plasmid preparation of pTZ57R The pTZ57R plasmid was purified from E. coli (DH5α/ pTZ57R) strain by using GenElute™ Plasmid Miniprep Kit which was purchased from Sigma-Aldrich, Inc. (USA).
- 68-
Materials & Methods
Chapter Three
Kit components • Resuspension Solution • RNase A solution • Lysis Buffer • Neutralization/Binding Buffer • Column Preparation Solution • Optional Wash Solution • Wash Solution Concentrate • Elution solution (10 mM Tris-HCl,1 mM EDTA, pH ~8.0) • GenElute Miniprep Binding Columns and Collection Tubes. Before using this kit, 78µl RNase A solution was added to the resuspension solution and mixed. After the addition of RNase A, the resuspension solution was used and stored at 4°C. 100ml ethanol (96-100%) was added to the concentrated Wash Solution. The Lysis solution and the neutralization solution were checked for salt precipitation before using. They were re-dissolved by warming the solution at 37°C, then cooling back down to 25°C before using without shaking the Lysis Solution vigorously. Plasmid preparation was achieved depending on the protocol provided by the manufacturer of the kit. 1. 1-5 ml of Terrific/Amp medium was inoculated with a single colony from a freshly streaked LB/Amp plates. The culture was incubated at 37°C with vigorously shaking for 12-16 hr. 2. The bacterial culture was harvested by centrifugation at 13000 rpm in a - 69-
Materials & Methods
Chapter Three
micro-centrifuge for 1min at room temperature. The supernatant was decanted and all remaining medium was removed. 3. The pelleted cells were resuspended completely by pipetting up and down in 200µl of the Resuspension Solution. 4. 200µl Lysis Solution was added to the suspended cells and the suspension was mixed thoroughly by inverting the tube 6-8 times until the mixture became viscous and slightly clear, and the mixture was incubated for 5min. 5. The cell debris was precipitated by adding 350 µl of neutralization/binding solution, inverted the tube gently 4-6 times Centrifuged at 13000rpm rounds in a table-top microcentrifuge for 10 min. 6. The supernatant was transferred to the supplied GenElute miniprep binding column by decanting, with avoiding disturbing or transferring the white precipitate (the pellet). Centrifuged at 13000rpm for 1min, the flow-through was discarded and the column was placed back into the same collection tube. 7. 750µl of the Wash Solution was added to the GenElute miniprep binding column, centrifuged at 13000 rpm for 30-60 seconds and the flow-through was discarded, the column was placed back into the same collection tube and centrifuged again at maximum speed for 1-2 min without any additional wash solution to remove excess ethanol. 8. GenElute miniprep binding column was transfered into a sterile 1.5ml microcentrifuge tube. 50µl of the Elution Buffer or water was added to the center of GenElute miniprep binding column to elute the plasmid DNA, without contacting the membrane with the pipette tips, incubated for 2min at room temperature and centrifuged for 1min. The column was discarded and the purified plasmid DNA was stored at -20°C. - 70-
Materials & Methods
Chapter Three
3.11.2. Linearization of pTZ57R The pTZ57R was linearized by smaI restriction enzyme (CCCGGG smaI recognition sequence) to form blunt end. The linearization of the plasmid was done by mixing the components briefly; spinning thoroughly and incubated at 25 ˚C for 4 hrs. To inactivate the enzyme, the mixture is heated at 65˚C for 20min. Components
Volume
Water, nuclease-free
34 µl
10X NEBuffer 4
5 µl
DNA
10 µl
Sma I (20 u/µl)
1 µl
Total volume
50 µl
3.11.3. Vector Dephosphorylation After agarose gel electrophoresis and DNA clean up, to minimize recircularization (religation) of plasmid DNA, the 5' phosphates is removed from both ends of the linear DNA with calf intestinal phosphatase. This is done by mixing the components briefly; spinning thoroughly and incubated at 37˚C for 30min. To inactivate the enzyme, the mixture is heated at 80˚C for 10min. Components
Volume
Water, nuclease-free
34 µl
10X NEBuffer 3
5 µl
Linearized pTZ57R
10 µl
Alkaline phosphatase (5 u/µl)
1 µl
Total volume :
50 µl
- 71-
Materials & Methods
Chapter Three
The DNA from enzymatic reaction component was cleaned by QIAquick PCR purification kit. 3.11.4. Phosphorylation of PCR product Cloning of amplified DNA into linearized 5′-dephosphorylated vector also necessitates the presence of 5′phosphate groups on the PCR products. This was achieved by phosphorylation either the primers before amplification or the PCR product itself. The following reaction mixture was prepared, mixed thoroughly, span briefly and incubated at 37 ˚C. To inactivate the enzyme, the reaction was heated at 75˚C for 10min Components
Volume
Water, nuclease-free
10µl
10X reaction buffer A for T4 polynucleotide kinase
2 µl
ATP ,10 mM
2 µl
T4 polynucleotide kinase (10 u/µl)
1 µl
PCR product
5 µl
Total volume :
20 µl
3.11.5. Ligation of purified tmRNA region into linearized pTZ57R vector (pTZN1 construction) The following reaction mixtures were prepared for Blunt-end ligation in separate sterile thin-walled tubes:
- 72-
Materials & Methods
Chapter Three
Volumes Component
Vector + insert
Control
Water, nuclease free
9 µl
13µl
10X T4 DNA Ligase Buffer
2 µl
2 µl
50% PEG 4000 solution
2 µl
2 µl
Linear vector DNA
2 µl
2 µl
Insert DNA
4 µl
-
T4 DNA Ligase (5 u/µl)
1 µl
1 µl
Total volume
20 µl
20 µl
The components of the tubes were mixed briefly and spun down in a microcentrifuge for 3-5 sec and incubated for 16hr. at 22°C. T4 DNA ligase was inactivated by heating the reaction mixtures at 65°C for 10 min. The ligation mixtures were used for transformation.
3.12. Preparation of Competent Cells and Transformation 3.12.1. Preparation of competent cells using CaCl2 All component cells were prepared by using CaCl2 according to (Sambrook et al., 1989) with modifications: 1. A single bacterial colony was picked up from a plate that had been incubated for 16-20 hrs at 37°C and inoculated to 100ml LB broth. The culture was incubated at 37°C for 3-5 hrs with vigorous agitation until cell density reached mid-log growth phase A595=0.375. 2. Bacterial cultures were transferred to sterile, disposable, ice cold 50ml polypropylene tubes then chilled on ice for 10 min.
- 73-
Materials & Methods
Chapter Three
3. Cell suspension centrifuged at 4000 rpm for 10 min at +4°C in refrigerator centrifuge .Supernatant was discarded; the pellet was resuspended gently in (10ml) of an ice-cold 0.1M CaCl2 solution. 4. The suspension was centrifuged again at 4000 rpm for 10 min at +4°C in refrigerator centrifuge. The supernatant was decanted; the pellet was resuspended gently in 10ml ice cold 0.1M CaCl2 solution. 5. Cells were incubated on ice for 60 min and centrifuged at 4000 rpm for 10 min at +4°C. The tube was inverted on clean kimwipes till the fluid drained away. 6. The pellet was resuspended in 2ml of an ice-cold 0.1M CaCl2 solution. 7. To increase the transformation efficiency, the competent cells were kept at +4°C for 24 hrs before using for transformation. 3.12.2. Transformation Transformation was done according to Sambrook et al., (1989) with modifications: 1. To 200µl of competent cells in a transformation tube, 20 µl of ligation mixture was added and incubated on ice for 30 min. 2. The mixture was heat-shocked by placing the tube in a 42 C° water bath for 90 sec and was then chilled on ice for 5 min. 3. 800µl of pre-warmed (37°C) LB medium was added to the suspension. Incubated at 37 °C with moderate agitation for 60 min. 4. The suspension was centrifuged at 8000rpm for 4 min. The supernatant was discarded, and the pelleted cells were resuspended in 200 ml LB broth.
- 74-
Materials & Methods
Chapter Three
5. The total volume of 200µl was spread on LB/Amp/X-gal/IPTG plates, incubated at 37 °C over night.
3.13. Confirmation of cloning 3.13.1. Blue-white selection Cells that contain the recombinant plasmid (pTZ57R/insert" tmRNAregion") form white colonies whereas the blue colonies represent the cells that contain the vector (pTZ57R) without the insert. 3.13.2. Rapid Screening by Direct Electrophoresis This technique was done according to Casali & Preston, (2003) which can be summarized in the following steps: 1. 10 µl of rapid-screen resuspension buffer was added to Eppendorf tubes. 2. Part of a bacterial colony was transferred with a pipette tip or toothpick to a tube and resuspended in the rapid-screen resuspension buffer. 3.
Resuspended bacterial cells were incubated in resuspension buffer at room temperature for 10 min.
4. The agarose gel was prepared and DNA marker was loaded in one lane of each row and 2µl of lysis buffer loaded into the remaining wells (a lane for each sample). 5. The resuspended bacterial colonies were loaded into the wells containing lysis buffer. 6. Electrophoresis started at 35 V for 15 min to allow the plasmid DNA to enter the gel and then increased to 100 V for 1 h. 7. The agarose gel was examined under ultraviolet (UV) transilluminator.
- 75-
Materials & Methods
Chapter Three
3.13.3. Polymerase chain reaction (PCR) To screen the insert in the transformants, colony PCR was performed with specific primers for the vector to identify the insert size that anneal to sequences flanking the cloning site. PT-F 5' AAC GCC AGG GTT TTC CCA GTC ACG A 3' PT-R 5' CCC AGG CTT TAC ACT TTA TGC TTC CG 3' The PCR master reactions were prepared in a sterile 0.5ml PCR tube as described in 3.4., then the results were analyzed by gel electrophoresis. For further confirmation, plasmids were prepared from transformants using GenElute™ Plasmid Miniprep Kit, as described in 3.11.1. PCR was performed with OP 1F and OP 2R primers to direct amplification of the insert on the plasmid. The PCR master reactions were prepared in a sterile 0.5ml PCR tube Reaction Components
Sample
Nuclease free water 10X Taq buffer 10mM dNTP mix 10pmol forward primer (OP 1F) 10pmol reverse primer ( OP 2R) MgCl2 DNA (cell suspension) Taq DNA polymerase (5 u/µl)
34.8 µl 5 µl 1 µl 1 µl 1 µl 2 µl 5 µl 0.2 µl
Total volume
50 µl
- 76-
Materials & Methods
Chapter Three
The PCR reactions were cycled in a thermocycler according to the used primers as followings: Steps
Temperature
Duration
95 ºC 95 ºC 53ºC 72ºC 72ºC 4 ºC
2 min 30 sec 45 sec 2 min 10 min
Initial Denaturation Denaturation Annealing Extension Final extension Hold
No. of Cycles 1 Cycle 30 Cycles 1 Cycle
3.13.4. Restriction digestion of recombinant plasmid (pTZN1) The choice of appropriate enzyme for the restriction analysis of the clone depends on the plasmid and the insert involved. Recombinant plasmids were digested with diverse restriction enzymes. The plasmids were digested by sma I according to the protocol described in 3.11.2.; also they were undergone double digestion. To double digest the plasmid, reaction mixtures were prepared each in a thinwall tube at room temperature. The components of the tubes were mixed briefly and incubated for 1 hr at 37°C. The enzymes were inactivated by heating the reaction mixtures at 80°C for 10 min. Component
Volumes EcoRV, Pst I
HindIII , EcoRI
HindIII , XbaI
Water, nuclease free
11 µl
11 µl
10 µl
10X buffer (Fermentas)
2 µl of red buffer
2 µl of red buffer
2 µl of tango buffer
PCR product
5 µl 1 µl (10 u/µl), 1 µl (10 u/µl) 20 µl
5 µl 1 µl (10 u/µl) , 1 µl (10 u/µl) 20 µl
5 µl 1 µl (10 u/µl), 2 µl(10 u/µl) " HindIII" 20 µl
Restriction enzyme Total volume
- 77-
Materials & Methods
Chapter Three
3.14. Protein A (domain one) 3.14.1. Protein A (domain one) amplification Protein A (domain one) was prepared from E. coli (DH5α/PAB) strain by colony PCR using Taq polymerase and standard taq buffer from NEB. The protocol can be summarized in the following steps. 1. A single colony was picked up from overnight culture of freshly streaked LB/Amp plate and resuspended in 50ul ddH2O. The cell suspension was incubated at 37°C water bath for at least 30 min. (Abdulkarim, 1994). 2. PCR master reactions were prepared in a sterile 0.5ml PCR tube: Reaction Components
Sample
Nuclease free water 10X Taq buffer 10mM dNTP mix 10pmol forward primer (PN- 1F) 10pmol reverse primer (PN- 2R) DNA (cell suspension) Taq DNA polymerase (5 u/µl)
36.8 µl 5 µl 1 µl 1 µl 1 µl 5 µl 0.2 µl
Total volume
50µl
3. The PCR reactions were cycled in a gradient thermocycler. Steps
Initial Denaturation Denaturation Annealing Extension Final extension Hold
Temperature
Duration
95ºC 95ºC 55ºC G= 10ºC 68ºC 68ºC 4ºC
10 min 30 sec 45 sec
- 78-
30 min 10 min
No. of Cycles 1 Cycle 30 Cycles 1 Cycle
Materials & Methods
Chapter Three
4. The gradient PCR annealing temperatures were as followings: Lines Temp.
1
2
3
4
5
6
7
8
9
48.5 49.3 50.3 52.9 53.7 54.6 55.2 56.2 57.2
10
11
12
58
58.8
59
5. The PCR products were examine by electrophoresis on an agarose gel. 3.14.2. DNA clean up The one domain protein A from residual PCR reaction components was cleaned by QIAquick PCR purification kit using the protocol described in 3.9. 3.14.3. Dpn I digestion One domain protein A was digested with Dpn I by the mentioned protocol in 3.8 and then cleaned by QIAquick PCR purification kit. 3.14.4. Cloning of purified protein A (domain one) to pTZ57R/T (pTZN2 construction) The 3'-dA overhang of the purified one domain protein A generated by taq DNA polymerase during amplification was cloned into pTZ57R/T using InsTAclone™ PCR Cloning Kit. Component Water nuclease-free 5X Ligation Buffer pTZ57R/T Purified PCR fragment T4 DNA Ligase (5 u/µl) Total volume
Volume 19 µl 6 µl 1 µl 3 µl 1 µl 30 µl
The ligation mixture was briefly mixed; centrifuged for 3-5 sec; and incubated overnight at 4 ºC. The ligation mixture was used directly to transform DH5α competent cells and they were plated on LB/X-gal/IPTG/Amp plate. - 79-
Materials & Methods
Chapter Three
Protocols of competent cell preparation and transformation were mentioned in 3.12.1. and 3.12.2., respectively. 3.14.5. Confirmation of cloning of protein A (domain one) To confirm the cloning of protein A (domain one), direct colony PCR of white colonies was achieved using the same protocols mentioned in section 3.13.3. 3.15. Creation of chimeric junctions, deletion, and insertion using PCR The PCR has been successfully used in fusing two different sequences with precision and it can also be used to create deletions or to insert small fragment of DNA, the final product can be obtained in two rounds of PCR. This included mutagenesis by overlap extension for production of chimeric genes by combining two DNA fragments. These primers are crucial because they contain the new junction. In the first round of PCR, each primer consists of 37 nucleotides; 25 of them were designed to delete specific region of ssrA gene and the remaining 12 nucleotides were designed to anneal with sense strand of one domain of protein A gene. The amplified product and amplified one domain protein A became a template for the second round of PCR. In the second round of PCR, protein A tail paired with its complementary strand and two outside primers were designed which were shorter than previous primers; in principle, 2 outside primers paired away of new junction and the chimeric molecules were constructed.
- 80-
Materials & Methods
Chapter Three
3.16. Deletion of (PK1, MLD. PK2-PK4) and (MLD, PK2-PK4) To construct strains that lack (PK1, MLD. PK2-PK4) and (MLD, PK2-PK4) and replacing the deleted parts by a fragment encoding protein A (domain one) with a different stop codon (UGA or UAA). Tailed-primers were designed and were tailed with 12 extra nucleotides complementary to one domain of protein A. Using PCR based deletion, (PK1, MLD.PK2-PK4) and (MLD, PK2-PK4) were deleted and then PCR ligation technique was used. The tailed primers were used to ligate the amplified Protein A domain one with mutated ssrA gene. The constructed plasmid (pTZN1) in 3.11.5 served as a template for the deletion of whole (PK1, MLD.PK2-PK4) and (MLD, PK2-PK4) Deletion mutation was achieved by long PCR using Long Amp Taq PCR kit. The reaction components and the PCR program were as followings: Reaction components Water nuclease free 10X Taq buffer 10mM dNTP mix 10pmol foreward primer 10pmol reverse primer Plasmid DNA Long Amp Taq DNA polymerase (5 u/µl) Total volume
Volumes 15.25 µl 5 µl 0.75 µl 1 µl 1 µl 1 µl 1 µl 25 µl
The PCR reactions cycled in a thermocycler according to the used primers as followings: Steps
Initial Denaturation Denaturation Annealing Extension Final extension Hold
Temperature
Duration
95 ºC 95 ºC 64.5ºC 65ºC 65ºC 4ºC
30 sec 10 sec 45 sec 2:30 min 10 min
- 81-
No. of Cycles 1 Cycle 30 Cycles 1 Cycle
Materials & Methods
Chapter Three
3.17. Domain one amplification by phusion high fidelity PCR kit. One domain protein A, cloned to pTZ57R/T in 3.14.4, was used as a template for this amplification. Plasmid was prepared from E. coli (one domain/ DH5α) strain using GenElute™ Plasmid Miniprep Kit according to the protocol explained in 3.11.1. In a thin-walled PCR tube the following components were added and mixed and all liquid were collected to the bottom of the tube by quick spin. Reaction components Water nuclease free 5X phusion HF buffer 10mM dNTP mix 10pmol forward primer 10pmol reverse primer Plasmid DNA Phusion DNA polymerase (2 u/µl) Total volume
Volumes 33.5 µl 10 µl 1 µl 1 µl 1 µl 3 µl 0.5µl 50 µl
The PCR reactions cycled in a thermocycler according to the used primers Steps
Initial Denaturation Denaturation Annealing Extension Final extension Hold
Temperature
Duration
98 ºC 98 ºC 59ºC 72ºC 72ºC 4ºC
30 sec 10 sec 30 sec 15 sec 10 min
No. of Cycles 1 Cycle 35 Cycles 1 Cycle
3.18. PCR ligation technique The PCR ligation technique was used to generate a precisely fusion of one domain protein A, prepared in 3.17, with mutated ssrA genes, produced by 3.16, without using ligase enzymes.
- 82-
Materials & Methods
Chapter Three
The method employed a two-step PCR strategy; the first step involved two independent PCR to generate two PCR products that were used as a template for second ligation PCR. The reaction mixture was prepared in thin-walled PCR tubes Reaction components Water nuclease free 10X Taq buffer 10mM dNTP mix 10pmol foreward primer 10pmol reverse primer Mutataed ssrA gene One domain protein A Long Amp Taq DNA polymerase (5 u/µl) Total volume
Volumes 14.25 µl 5 µl 0.75 µl 1 µl 1 µl 1 µl 1 µl 1 µl 25 µl
The mutated ssrA genes were: • Two PCR products in which (PK1, MLD, PK1-PK4) were deleted. • Two PCR products in which (MLD, PK1-PK4) were deleted The PCR reactions were gently mixed, span briefly, and cycled in a thermocycler. Steps
Initial Denaturation Denaturation Annealing Extension Final extension Hold
Temperature
Duration
95 ºC 95 ºC 58ºC 65ºC 65ºC 4 ºC
30 sec 15 sec 45 sec 4 min 10 min
No. of Cycles 1 Cycle 30 Cycles 1 Cycle
The PCR products were processed using the same protocols mentioned previously: agarose gel electrophoresis, DNA recovery from the gel, DpnI digestion, DNA clean up, exonuclease I digestion and DNA clean up.
- 83-
Materials & Methods
Chapter Three
3.19. Self circulization of chimeric genes (NF1-NF7) This procedure was done according to the protocol provided by the manufacturer of T4 ligase enzyme and it can be summarized in the following steps: 1. Ligation reactions were prepared in microfuge tubes and they include: Components Water, nuclease-free 10X Ligation Buffer Linear DNA (30ng) T4 DNA Ligase (5 u/µl) Total volume
Volumes 19 µl 5 µl 25 µl 1 µl 50 µl
2. The tubes were vortexed and spun down in a microcentrifuge for 3-5 seconds. 3. The mixtures were incubated overnight at 22°C. 4. The DNA T4 Ligase was inactivated by heating reaction mixtures at 65°C for 10 minutes. 5. Resulting reaction mixture was used directly for transformation, and they were spread on LB/Amp plate. 3.20. Screening of chimeric genes Chimeric genes were screened by direct colony PCR, described in 3.4. Two primers, PN-F2 , PN-R2G and PN-R2A, were used for direct amplification of the fusing one domain protein A with UGA and UAA stop codon, respectively.
- 84-
Materials & Methods
Chapter Three
The PCR reactions were gently mixed, span briefly, and cycled in a thermocycler. Steps
Temperature
Duration
95 ºC 95 ºC 58.5 ºC 68 ºC 68 ºC 4 ºC
30 sec 15 sec 45 sec 30 sec 10 min
Initial Denaturation Denaturation Annealing Extension Final extension Hold
No. of Cycles 1 Cycle 30 Cycles 1 Cycle
Further screening methods were used: • Colony PCR was done for multiple cloning site using primers, PT-1F and PT-1R, flanking the multiple cloning site of pTZ57R. • Nested PCR was performed to the former PCR products using primers specific for tmRNA region amplification, OP-1F and OP-2R. • Nested PCR was done to the former PCR product in order to amplify tmRNA gene after mutation using TMEC 1F and TMEC 2R primers. • Another nested PCR was achieved for the former PCR product using PN-F2, PN-R2A, and PN-R2G primers for the amplification of fused one domain of protein A. 3.21. Cassette Mutagenesis The following protocol was achieved as an alternative way to delete whole (PK1, MLD.PK2-PK4) and (MLD, PK2-PK4) and replacing them with a DNA fragment encoding protein A (domain one) by cassette mutagenesis. Cassette mutagenesis methods that introduce site-specific sequence changes into a target gene are powerful tools for the manipulation of genes. Restriction sites were introduced by oligonucleotide-directed mutagenesis procedures to flank closely the target sequence in the plasmid containing the gene. The restriction sites - 85-
Materials & Methods
Chapter Three
to be introduced were chosen based on their uniqueness to the plasmid and the target gene which has been cloned. Nine primers (Table 3.7 and 3.8) were designed with restriction sites (forward primers with XhoI and reverse primers with BspEI restriction sites); 7 of them were used to (PK1, MLD.PK2-PK4) and (MLD, PK2-PK4) and the remaining were used to amplify one domain protein A. 3.22. Deletion mutation in ssrA gene The constructed plasmid (pTZN1) in 3.11.5 was used as a template for the deletion of (PK1+MLD+PK2-PK4) and (MLD+PK2-PK4) by long PCR using long Amp Taq PCR kit. Plasmids were prepared using GenElute™ Plasmid Miniprep Kit according to the protocol described in 3.11.1. The PCR master mix and PCR cycling condition is the same as described in 3.16 except that the suitable annealing temperature was 58 ºC for the used primers (Table 3.7). Table (3.7): Used primers for the deletion Pk1-1F Pk1-1R Pk1-2R TLD-1F TLD-1R TLD-2F TLD-2R
Primers 5' TGG CAA GCG AAT CTC GAG ACT GAC T 3' 5' GTT TTC GTC GTT CCG GAC TAT TTT TTG 3' 5 'AGC TGC TAA TCC GGA GTT TTC GTC G 3' 5' CTG ACT AAG CCT CGA GTA CCG AGG 3' 5 ' CAA CCG CCC CTC CGG ATG CAC CT 3' 5΄ ATG TAG TCT CGA GGA TGT AGG AAT TTC 3' 5́' CAT GCA CCT CCG GAT TCG CAA ATC C 3’
3.23. Domain one amplification Protein A (domain one), cloned to pTZ57R/T (pTZN2) described in 3.14.4, was used as a template for this amplification. Plasmids were prepared from one E. coli (domain/ DH5α) strain using GenElute™ Plasmid Miniprep Kit according to the protocol described in 3.11.1. The PCR master mix and PCR cycling condition is - 86-
Materials & Methods
Chapter Three
the same as described in 3.17 except that the suitable annealing temperature was 61ºC for the used primers (Table 3.8). Table (3.8): Used primers to amplify one domain Primers PN-CoF 5' GAA GCT GTA GAC TCG AGA TTC AAC AAA GA3' PN-CoR 5' TCT ACT TCC GGA GCT TAA GCA TCA TTT AG 3' UAA stop codon 3.24. DNA extraction from agarose gel The DNA bands obtained in 3.22 and 3.23 were recovered from agarose gel using GeneJET™ Gel Extraction Kit according to the protocol described in 3.5. 3.25. Dpn I digestion The protocol is described in 3.8. 3.26. DNA clean up The protocol is described in 3.9. 3.27. Double digestion with XholI and BspEI enzymes Double restriction digestion of DNA was done using two restriction enzymes in a buffer where both enzymes keep their activities, usually not lower than 50%. The DNA bands were undergone double digestion with XhoI and BspEI restriction enzymes according to the protocol provided by the manufacture. The reaction mixture (Table 3.9) was prepared and incubated at 37 ºC for 1hr, and then the reaction was stopped by heating at 80 ºC for 20 min.
- 87-
Materials & Methods
Chapter Three
Table (3.9): Reaction mixture components for double digestion with XhoI and BspEI Component Water, nuclease-free 10X NEBuffer 3 10X BSA Purified DNA Xho I (20000 u/ml) BspE I (10000 u/ml) Total volume
Volume 28 µl 5 µl 5 µl 10 µl 1 µl 1 µl 50 µl
3.28. DNA clean up The DNA was cleaned again from residual enzymatic reaction buffers according to the protocol described in 3.9. 3.29. Sticky end ligation ( construction of NF8-NF11) The final step in the cloning was the joining of linear DNA together, the ends of mutated ssrA gene, created by XhoI digestion, were complementary to the ends of protein A which were formed by the same restriction enzyme. The other ends of mutated ssrA gene, produced by BspEI digestion, were complementary to the ends of protein A which were formed by the same restriction enzyme. According to the protocol provided by the manufacturer, the reaction mixture was incubated overnight at 16ºC. The whole volume of this mixture was used for the transformation of 200 µl of chemically prepared competent cells and they were selected for LB/Amp plates. Component Water, nuclease-free 10X T4 ligase buffer Linear vector DNA (mutated ssrA gene) Insert DNA (one domain) T4 DNA ligase (5 u/µl) Total volume - 88-
Volume 11.5 µl 2 µl 2 µl 4 µl 0.5 µl 20 µl
Materials & Methods
Chapter Three
3.30. Confirmation of cloning Transformants were screened by direct colony PCR. The PCR master mix and its cycling conditions were the same as mentioned in 3.17 and then the results were analyzed by gel electrophoresis. 3.31. Chromosomal mutagenesis and gene replacement It is a method for generating gene replacements and deletions described in E. coli which can be applied to most genes. The use of a temperature-sensitive pSC101 replicon to facilitate the gene replacement made this method unique and particularly effective. The method proceeded by homologous recombination between a gene on the chromosome and homologous sequences carried on a plasmid temperature sensitive for DNA replication. Thus, after transformation of the plasmid into an appropriate host cell, it is possible to select for integration of the plasmid into the chromosome at 42°C. Subsequent growth of these cointegrates at 30°C leads to a second recombination event, resulting in their resolution. The chromosome will either undergo a gene replacement or retain the original copy of the gene. To delete a specific gene on the bacterial chromosome, the following steps were involved: 3.31.1. Deletion mutation by long PCR Deletion is a type of mutation involved the loss of genetic materials. From the plasmid (pTZN1), previously constructed in 3.11.5, the ssrA gene, smpB gene and tmRNA with smpB together were deleted by long PCR using TM del I and TM del II, SM del I and SM del II, and TM del I and SM del II, respectively (Table 3.4).
- 89-
Materials & Methods
Chapter Three
The reaction mixture was prepared from the following components: Reaction componenets Nuclease free water 10X long buffer 2 mM dNTP mix 10pmol foreward primer 10pmol reverse primer Plasmid DNA Taq DNA polymerase (5 u/µl) Total volume
Volumes 17.75 µl 2.5 µl 2.5 µl 0.5 µl 0.5 µl 1 µl 0.25 µl 25 µl
The used PCR program involved three steps Steps
Initial Denaturation Denaturation Annealing Extension Denaturation Annealing Extension Final extension Hold
Temperature
Duration
94 ºC 95 ºC 60 ºC 68 ºC 95 ºC 60.5 ºC 68 ºC 68 ºC 4 ºC
2 min 15 sec 45 sec 4 min 15 sec 45 sec 4 min:10 sec 10 min
No. of Cycles 1 Cycle 10 Cycles
20 Cycles 1 Cycle
3.31.2. DNA recovery from agarose gel The DNA bands were recovered from agarose gel using GeneJET™ Gel Extraction Kit according to the protocol described in 3.6. 3.31.3. DpnI digestion The protocol is described in 3.8. 3.31.4. Exonuclease I The protocol is described in 3.10.
- 90-
Materials & Methods
Chapter Three
3.31.5. Self circularization or religation The linear DNA was self circularized by the protocol described in 3.19. 3.31.6. Transformation The ligation mixtures were used with chemically prepared competent cells, described in 3.12. They were selected on LB/Amp plate. 3.31.7. Screening of transformants The PCR was used to screen for gene deletion. The plasmids were prepared from transformants and were amplified in the first round of PCR using OP-1F and OP-2R primers. For further confirmation, plasmids suspected in the first round with deleted tmRNA gene (pTZN3), were amplified with TMEC 1F and TMEC 2R primers and plasmids with deleted smpB gene (pTZN4) were amplified with SmpB F and SmpB R primers whereas those with deleted tmRNA and smpB together (pTZN5) were amplified by TMEC 1F, TMEC 2R
and SmpB F, SmpB R,
separately. 3.31.8. Subcloning to pKO3 plasmid In molecular biology, subcloning is a technique used to move a particular gene of interest from a parent vector to a destination vector in order to further study its functionality. Subcloning of the constructed plasmids was done by the following protocols. 3.31.8.1. Double digestion of the parent vector Restriction enzymes were used to excise the gene of interest, the insert, from the parent vectors (pTZN3, pTZN4, pTZN5) which were undergone double digestion with BamHI and Sal I restriction enzymes.
- 91-
Materials & Methods
Chapter Three
The reaction mixtures were incubated overnight at 37ºC, then the results were analyzed by gel electrophoresis and the genes of interest were purified from agarose gel. Component Water, nuclease-free 10X NEBuffer 3 10X BSA Plasmid DNA BamH I (10 u/µl) Sal I (10 u/µl) Total volume 3.31.8.2. Double digestion of destination vector
Volumes 28 µl 5 µl 5 µl 10 µl 0.5 µl 1 µl 50 µl
The same restriction enzymes were used to digest the destination vector, pKO3, by the same protocol as in the digestion of parent vectors and then the vector was purified using QIAquick PCR purification kit. 3.31.8.3. Construction of (pKON6, pKON7, pKON8) plasmid The purified inserts and the purified destination vector were mixed together with DNA ligase. Component Water, nuclease-free 10X T4 ligase buffer Distination vector PKO3 Insert DNA (1:3 molar ratio) T4 DNA ligase (5 u/µl) Total volume
Volumes 5.5 µl 2 µl 3 µl 9 µl 0.5 C 20 µl
The reaction components were incubated overnight at 16ºC and the total reaction volume were used with chemically prepared competent cells, described in 3.12, except for that 800µl of pre-warmed LB medium was added to the suspension; incubated at 30°C with moderate agitation for 60 min. The transformants were selected for LB/ chloramphenicol plates. - 92-
Materials & Methods
Chapter Three
3.31.8.4. Confirmation of cloning The PCR was used for screening of transformants. PKO3 F and PKO3 R, primers that flank the right and the left vector-insert junction on PKO3 were used. Direct colony PCR was made according to the protocol described in 3.14.1 Steps
Initial Denaturation Denaturation Annealing Extension Final extension Hold
Temperature
Duration
95 ºC 95 ºC 53ºC 68ºC 68ºC 4ºC
10 min 15 sec 45 sec 1 min 10 min
No. of Cycles 1 Cycle 30 Cycles 1 Cycle
3.31.8.5. Competent cell preparation from E. coli MG1655 and W311 strains Competent cells were prepared from freshly streaked overnight culture of MG1655 and W3110 by the protocol described in 3.12.1. 3.31.8.6. First protocol for gene replacement Gene replacement was done according to Link et al., (1997) and it can be summarized in the following steps: 1. The gene replacement vector, pKO3, carrying in vitro-altered sequences is transformed into E. coli MG1655, allowed to recover for one hour at 30 ºC. 2. The cells were plated on prewarmed chloramphenicol-LB plates and incubated at both 42 and 30°C. 3. From the 30°C plates, one to five colonies were picked into 1 ml of LB broth, serially diluted, and again plated at 42°C on prewarmed chloramphenicol-LB plates. 4. From previous 42°C plates, one to five colonies serially were diluted in 1ml LB broth and immediately plated at 30°C on 5% (wt/vol) sucrose – LB plates. - 93-
Materials & Methods
Chapter Three
5. The 5% sucrose plates were replica plated to chloramphenicol plates at 30°C to test for the loss of the replacement vector. 6. Sucrose resistant colonies which were not grown on chloramphenicol plates were screened for gene replacement. 3.31.8.7. Screening for gene replacements. To screen for gene replacements, OP-1F and OP-2R primers that flank the targeted region were used in the first round of PCR. For further confirmation, depending on the results of the first round of PCR, suspected colonies that may contain deleted tmRNA gene on E. coli chromosome, were again amplified by TMEC-1F and TMEC-2R primers, whereas SmpB-F and SmpB-R primers were used for colonies suspected to contain SmpB gene-deleted chromosome. 3.31.8.8. Second protocol for gene replacement This protocol was done according to Emmerson et al., (2006) The main steps of this protocol can be summarized in the followings: 1. Transferring the replacement plasmid into E coli MG1655 strain. 2. Plating 250 µl of the recovered transformation onto LB agar plates containing chloramphenicol (25 µg/ml) 3. Recovering at 30°C in a static incubator for ~48 hrs 4. Inoculating 100ml of LBC broth (Luria-Bertani broth containing 25 µg/ml of chloramphenicol) with ~10 colonies from the recovered transformation plate. 5. Incubating at 42°C and 200 RPM in a shaking incubator for ~16 hours. 6. Subculturing into 100 ml LBC broth, incubated for ~8 hrs at 42°C and 200 RPM. - 94-
Materials & Methods
Chapter Three
7. After 8 hrs, the sub-culturing step was repeated into LBC and was incubated for ~16 hrs at 42°C and 200 RPM 8. The sub-culturing step was duplicated into LBC broth and was incubated for ~8 hrs at 42°C and 200 rpm. 9. After 8 hrs. sub-culture into 100 ml of LB broth and was incubated for ~16 hrs at 30°C and 200 RPM 10. Before discarding the culture, the LB was used for serial dilutions. 250 µl of the 10-4 and 10-5 dilutions were plated onto LBC agar plates. The cultures were incubated at 30°C in the static incubator for 16 hrs. These cultures can be used to screen for primary integrants if later steps in the allelic exchange process fails. 11. Sub-culturing into 100 ml of the LB broth and incubated for ~8 hrs at 30°C and 200 RPM 12. Repeat the sub-culturing step into LB broth and incubated for ~16 hrs at 30°C and 200 RPM 13. Repeat the sub-culturing step into LB broth and incubated for ~8 hrs at 30°C and 200 RPM 14. After 8 hrs, serial dilutions were made of the cultures and was plated out 250 µl of the 10-3, 10-4, 10-5 and 10-6 dilutions onto LB agar plates containing 6% sucrose and no NaCl. It was then incubated for ~16 hrs in a static incubator at 30°C. 15. Using the colonies from the serial dilution, LB sucrose agar plates were used to create patch plates. Each colony screened should be patched on an LBC agar plate. Only those colonies that grew on LB sucrose and not LBC would be screened by PCR. The colonies that can only grow on the - 95-
Materials & Methods
Chapter Three
LB sucrose patch plate are further checked by PCR (Emmerson et al., 2006). 3.32. smpB deletion on pKON6 plasmid: The pKON6 plasmid were used as a template for smpB deletion. Long PCR, explained in 3.31.1, was used. Steps
Initial Denaturation Denaturation Annealing Extension Denaturation Annealing Extension Final extension Hold
Temperature
Duration
94 ºC 95 ºC 60 ºC 68 ºC 95 ºC 60.5 ºC 68 ºC 68 ºC 4 ºC
2 min 15 sec 45 sec 6 min 30 sec 15 sec 45 sec 6 min 40 sec 10 min
No. of Cycles 1 Cycle 10 Cycles
20 Cycles 1 Cycle
The results were analyzed by gel electrophoresis; the DNA was recovered from agarose gel and undergone DpnI and Exonuclease digestion; T4 DNA ligase was used for self circularization. 3.33. Plaque assay Lytic phages are enumerated by a plaque assay. A plaque is a clear area which results from the lysis of bacteria. Each plaque arises from a single infectious phage. The infectious particle that gives rise to a plaque is called a PFU(plaque forming unit). The below protocol was applied for the Bacteriophage plaque assay according to Sambrook et al., (1989) and Miller, (1992) 1. Preparation of competent cells from ∆tmRNA strain.
- 96-
Materials & Methods
Chapter Three
2. Transforming all constructed mutagenic ssrA genes fused with protein A tailed strain to chemically prepared ∆tmRNA competent cell. 3. Inoculating 5ml LB +0.1M MgS04 with a single bacterial colony from previous transformant plate. Growing the cultures overnight at 37ºC with moderate agitation. 4. Melting top agar by heating it in a microwave oven for a short period of time. Storing aliquots of melted agar (4ml) on a heating block or in water bath at 50 ºC for keeping the solution molten. 5. Preparing tenfold serial dilutions of the bacteriophage stocks (in SM medium+ gelatin), mixing each dilution by gentle vortexing or by tapping on the side of the tube. 6. Dispensing 0.1ml of each overnight culture of the plating bacteria into a series of sterile tubes. 7. Adding 0.1ml of each 10-4 ,10-5 ,10-6 dilutions of the bacteriophage stock to a tube of plating bacteria. Mixing the bacterial and bacteriophage by shaking or gently vortexing. 8. Incubating the mixture for 10 min at room temperature. 9. Adding an aliquot of molten agar to the first tube. Mixing the content of the tube by gentle tapping or vortexing for few seconds and without delay pouring the entire contents of the tube onto the center of a labeled agar plate (R plate with their selective antibiotics). Swirling the plate gently to ensure an even distribution of bacteria on R top agar. 10. Allowing the top agar to harden by standing the plates for 5-10 min at room temperature and then incubating the plates overnight at 37 ºC. 11. Counting or selecting individual plaques . - 97-
Materials & Methods
Chapter Three
3.34. Purification of λ bacteriophage This protocol was done according to Sambrook et al., (1989) by: - Placing 1ml of SM in a sterile microfuge tube or polypropylene test tube and then adding 1 drop (approximately 50 µl) of chloroform. - Removing the plaque from the plate using a sterile open-ended capillary tube or Pasteur pipette to pierce the agar (both top and bottom layers). - Washing out the fragments of agar from Pasteur pipette into the tube containing SM/chloroform. - Letting the capped tube stand for 1-2 hours at room temperature to allow the bacteriophage particle to diffuse from the agar after that store the bacteriophage suspension at 4 ºC. 3.35. Purification of λ bacteriophage by plate lysis and elution This protocol was done according to Sambrook et al., (1989) by: 1. Preparing infected culture for plating (usually 0.1ml of the previous resuspended plaque with 0.1ml of plating bacteria MG1655 ) 2. Adding 4 ml of molten R top agar to the infected bacteria, mixing and pouring the entire content onto the surface of R plate without antibiotics. 3. Incubating the plate without inverting for 12-16 hours at 37 ºC. 4. After incubation, 5 ml of SM was added to the surface of each plate in which there was total lysate, storing the plates for several hours at 4 ºC. 5. Using a sterile pasture pipette for each plate, transferring as much as possible SM into a sterile screw-cap tube.
- 98-
Materials & Methods
Chapter Three
6. Adding 1 ml of fresh SM to each plate, swirling the fluid gently, and storing the plate for 15 min in a tilted position to allow all of the fluid to drain into one area. Again removing the SM and combine it with the first harvest. 7. Adding 0.1 ml of chloroform to the tube containing SM, vortexing the tube briefly. 8. Removing the bacterial debris by centrifugation at 4000 rpm for 10 min at 4 ºC. 9. Transferring the supernatant to a clean sterile tube then adding 1 drop of chloroform to the tube. 10. Storing the resulting bacteriophage stock at 4 ºC. 11. Then, the plaque assay was done with this lambda stock for all the constructs (mutated ssrA gene to which protein A ligated) by the same protocols as described in 3.33. 3.36. Isolation of bacteriophage from sewage water This protocol was done according to Alexander et al., (2004), by: 1. Preparing overnight culture of E. coli MG1655 strain. 2. Pipetting 5 ml of 10X nutrient broth into the flask containing 40 ml of raw sewage. 3. Inoculating the sewage in the flask with 5 ml of an overnight culture of E. coli MG1655. 4. Inoculating a separate flask containing 45 ml of 1X nutrient broth with 5 ml of an overnight culture of E. coli MG1655. 5. Incubating both cultures at 37 ºC, shaking for 24 hours.
- 99-
Materials & Methods
Chapter Three
6. Transferring 10 ml of the sewage-bacteriophage culture into a centrifuge tube, and centrifuge the sample at 2,000 RPM for 5 minutes. Most of the remaining cells will be pelleted. The supernatant contains bacteriophage. 7. Filtering the supernatant into a sterile tube through 0.22 micron filter. The filtrate contains bacteriophage and storing it in 4 ºC. 8. Then plaque assay was made for both ∆ tmRNA strain and control E. coli MG1655. 3.37. Total RNA isolation: Total RNA were extracted from all the previous constructed which were transformed to ∆tmRNA competent cell using E.Z.N.A.™ Viral RNA kit. Kit components: • QVL lysis buffer • RWB buffer • Carrier RNA (poly A) • HiBind® RNA column • 2ml collection tube • DEPC- ddH2O Before using this kit, 1ml QVL buffer was added to the tube of lyophilized carrier RNA, dissolving carrier RNA completely and transferring the mixture to the QVL lysis buffer bottle. Mixing thoroughly by shaking a few times, adding 45ml absolute ethanol to the RWB buffer and then the following steps were undergone:
- 100-
Materials & Methods
Chapter Three
1. Transferring the bacterial culture to a microcentrifuge tube, centrifuged for 1 min at a maximum speed (14000 rpm) in a microcentrifuge and the supernatant discarded. 2. Adding 500µl QVL lysis buffer to the bacterial pellet and then mixing thoroughly by vortexing for 30 seconds. 3. Incubating at room temperature for 5-10 minutes. 4. Spinning briefly to collect any liquid from lid. 5. Adding 350µl of absolute ethanol (96-100%) to the sample, mixing thoroughly by vortexing for 30 seconds, centrifuging briefly to collect any liquid droplets from the lid. 6. Applying the 750µl of the sample to a HiBind® RNA column assembled in a 2 ml collection tube. Centrifuging at 13000 rpm for 15 seconds, discarding the flow-through. 7. Washing the column with RWB buffer by pipetting 750µl directly into the spin column, centrifuging at 13000rpm for 15 seconds, discarding the 2ml collection tube. 8. Placing the column in a clean 2ml collection tube and adding 500µl RWB buffer, centrifuging and discarding the flow-through. 9. Centrifuging the empty column within a collection tube for 1 min at full speed to completely dry the column. 10. Transferring the column to a clean microfuge tube and eluting the RNA with 50-100 µl of DEPC-treated water and then centrifuging at maximum speed for 1 min.
- 101-
Materials & Methods
Chapter Three
3.38. Reverse transcription (RT) reaction The used protocol can be summarized in the following steps: 1. Adding the following components into a sterile microfuge tube: Component RNA soln. Primer (reverse primers of protein A 40µM) dNTP mix (2.5Mm) Water, nuclease free Total volume
Volumes 3 µl 2 µl 4 µl 7 µl 16 µl
2. Heating the mixture for 3-5 minutes at 65-80°C. Spinning briefly and placing promptly on ice. 3. Adding the following components: Component 10X Reaction Buffer RNAse inhibitor (10 u/µl) M-MuLV Reverse Transcriptase (200 u/µL) Total volume
Volumes 2 µl 1 µL 1 µl 4 µl
4. Incubating at 42°C for one hour. 5. Inactivating the enzyme at 90°C for 10 minutes. 6. Storing the products at -20°C or proceed to next step. 3.39. Amplification of cDNA by PCR Taq DNA polymerase and thermo taq buffer were used to amplify cDNA. Component Nuclease free water 10X thermopol reaction buffer 10 mM dNTP mix 10pmol forward primer 10pmol reverse primer cDNA Taq DNA polymerase (5 u/µl) Total volume - 102-
Volumes 16 µl 2.5 µl 0.5 µl 0.5 µl 0.5 µl 5 µl 0.125 µl 25 µl
Materials & Methods
Chapter Three
The PCR reactions were gently mixed, span briefly, and cycled in a thermocycler. Steps
Initial Denaturation Denaturation Annealing Extension Final extension Hold
Temperature
Duration
95 ºC 95 ºC 56ºC 68ºC 68ºC 4 ºC
30 sec 15 sec 45 sec 40 sec 5 min
No. of Cycles 1 Cycle 30 Cycles 1 Cycle
3.40. Cloning of three domain protein A to pTZ57R/T Three domains of protein A were prepared from E. coli (DH5α/PAB) by colony PCR. Two fragments from the three domains were cloned: a fragment with ptrc promoter and the other without ptrc promoter. PAL F and PAL R primers were used for the first fragment whereas PD 1F and PAL R were used for the second fragment. The PCR reactions were gently mixed, span briefly, and cycled in a thermocycler. Steps
Initial Denaturation Denaturation Annealing Extension Final extension Hold
Temperature
Duration
95 ºC 95 ºC 55.5ºC 68ºC 68ºC 4 ºC
10 min 15 sec 45 sec 45 sec 10 min
No. of Cycles 1 Cycle 30 Cycles 1 Cycle
The results were analyzed by gel electrophoresis, DNA bands were gel purified after DpnI digestion and they were cloned to pTZ57R/T by the mentioned protocols. 3.41. Screening of transformants Transformants were screened by colony PCR of E. coli (DH5α/ 3domain) strain by the previous protocols and cycling conditions. - 103-
Materials & Methods
Chapter Three
3.42. Chopping of protein A (domain one) Domain one of protein A was chopped by the deletion of a part of it. The chopping was done by designing two forward primers with UAA and UGA stop codons and four reverse primers. Colony PCR was made for a construct that contained a mutated tmRNA gene in which the whole (PK1+MLD+PK2-PK4) (NF10,NF11) had been replaced by domain one and the other construct was that contained a tmRNA gene in which the (MLD+PK2-PK4)(NF8,NF10) was replaced with domain one. The PCR reaction components were the same as described in 3.31.1 except that 5 µl of cell suspension added as a DNA template instead of 1 µl of plasmid DNA.The following PCR cycling conditions were applied. The PCR reactions were gently mixed, span briefly, and cycled in a thermocycler. Steps
Initial Denaturation Denaturation Annealing Extension Denaturation Annealing Extension Final extension Hold
Temperature
Duration
95 ºC 96 ºC 59 ºC 68 ºC 96 ºC 59.5 ºC 68 ºC 68 ºC 4 ºC
10 min 20 sec 45 sec 4 min 20 sec 45 sec 4 min 10 sec 10 min
No. of Cycles 1 Cycle 10 Cycles
20 Cycles 1 Cycle
The results were analyzed by gel electrophoresis; DNA bands were purified and undergone Dpn I and exonuclease I digestion. After purification from residual enzymatic buffer, they were religated and transformed to chemically prepared competent cells. After that, the transformants were screened by direct colony PCR with PNCOF and PNCOR primers.
- 104-
Materials & Methods
Chapter Three
3.43. Statistical analysis Analysis of data was performed by using SPSS (Version 11.5). Results are expressed as mean ± standard error (mean ± SE). 3.44. Sequencing The recombinant plasmids and PCR products were sequenced using BigDye Terminator v3.1 cycle sequencing RR-2500 kit and depending on the cycle sequencing technology (dideoxy chain termination; Sanger Sequencing) on ABI 3730
XL
96-capillary
sequencer
(BioScience
(www.lifesciences.sourcebioscience.com/). 3.45. Alignment of sequences Homology searches were conducted using NCBI BLAST between the sequences of standard staphylococcus aureus protein A which was provided by (Björnsson et al., 1997), standard E. coli tmRNA region (accesion number of tmRNA: EG 30100 and accesion number of smpB: EG11782) which are available at the (NCBI) (Wheeler
et al., 2003) at (http://www.ncbi.nlm.nih.gov) and
constructed strains.
- 105-
Chapter Four
Results & Discussion
4. RESULTS AND DISCUSSION
4.1. Cloning of tmRNA region The SmpB-SsrA system is thought to play a crucial role in bacterial survival under adverse environmental conditions. To study the role of this system in the survival of E coli as well as its support to phage growth, several constructs were prepared. The tmRNA region (1928bp) from MG1655 has been amplified by colony PCR using primer pairs OP 1F and OP 2R to obtain sufficient DNA for cloning. For further confirmation, restriction digestion, using EcoRV, AccI and Pvu II separately, was achieved before starting with the cloning steps. Restriction digestion would therefore cleave the PCR product into two sub-fragments that were readily resolvable by agarose gel electrophoresis. After restriction digestion of the fragment of tmRNA regions, two bands were clearly visible, representing products of 1068bp and 860bp with Acc I, 1115 and 813bp with EcoRV, 1361 and 567 bp with Pvu II restriction enzymes (Figure 4.1). Methylation may interfere with digestion and cloning steps and it can also affect the efficiency of plasmid transformation (Casali & Preston, 2003). To avoid such problem, endonuclease digestion with DpnI, one of only a few enzymes known to cleave methylated DNA preferentially, was performed for the PCR products (1928pb). It will only cleave DNA from dam+ strains (Gerstein, 2001). Clark, (1988) described template-independent terminal transferase activity of Taq DNA polymerase in which the enzyme adds a single nucleotide to the 3' termini of an amplified fragment. Although this activity may result in the addition of any of the four nucleotide bases, there is a strong bias for the addition of adenylate, therefore it is necessary to convert a 5' or 3' overhang to a blunt end by - 106-
Chapter Four
Results & Discussion
using Exonuclease I enzyme in order to form compatible ends with the linearized vector. A key step in the construction of recombinant plasmids is the verification of the successful cloning of insert DNA into the vector. A number of commonly used plasmids facilitate phenotypic selection and/or screening methods for rapid identification of insert-containing clones. The first approach involved cloning PCR products into a plasmid that has been digested to produce blunt ends. The pTZ57R plasmid was digested with appropriate restriction enzyme to form a compatible end with the insert. Thus, it was linearized by sma I restriction enzyme (CCCGGG sma I recognition sequence) to form blunt end. Dephosphorylation of linearized vector was performed in order to reduce its ability to recirculize during ligation and to increase the proportion of recombinant clones. Calf intestinal alkaline phosphatase (CIAP) or shrimp alkaline phosphatase (SAP) are most commonly used in these reactions (Sambrook et al., 1989). In order to assess the success of the dephosphorylation, reaction test ligations can be performed. If the PCR product is to be cloned into a nonphosphorylated vector, it is critical to add phosphate groups to the insert. In such situation, T4 polynucleotide kinase can be used with tmRNA region (1928bp). This enzyme catalyzes the transfer of phosphate from ATP to the 5' terminus of dephosphorylated DNA (Casali & Preston, 2003). To increase the efficiency of cloning, DNA insert and linearized vectors were purified from residual reaction components using QIAquick PCR purification kit because the DNA quality is one of the most important factors for obtaining complete digestion and successful cloning. Contaminants such as phenol, chloroform, protein, alcohol, and RNA can adversely affects subsequent reactions (Sambrook et al., 1989).
- 107-
Chapter Four
Results & Discussion
Once the vector and insert have been prepared for ligation, it is necessary to estimate the concentration of the DNA. This may be estimated by agarose gel electrophoresis by running it against molecular-weight markers of known concentration. The optimal vector: insert DNA ratio will vary with different vectors and inserts and various ratios should be tried and it was found that (2:4) was optimum for the clones. The population of recombinants can be increased by performing the reaction at a high DNA concentration; in dilute solutions circularization of linear fragments is relatively favored because of the reduced frequency of intermolecular reactions (Primrose et al., 2001). The 1928 bp blunt-ended fragment was inserted into the SmaI site of the pTZ57R plasmid (pTZN1). Ligation involves creating a phosphodiester bond between the 3'- hydroxyl group of one DNA fragment and the 5'-phosphate group of another and is equivalent to repairing nicks in a duplex strand. The enzyme most frequently used to ligate fragments is bacteriophage T4 DNA ligase (Sambrook et al., 1989). The temperature and time necessary for a successful ligation has considerable range and will vary depending on the length and base composition of the fragment ends. The optimal temperature is a compromise between that for ensuring annealing of ends (the Tm of ends are generally 12–16ºC) and the optimal temperature (25ºC) for activity of T4 DNA ligase (Casali & Preston, 2003). After that, ligation mixture is transformed to chemically prepared competent E coli/ DH5α cell. To assess the efficiency of the transformation, host cells should also be transformed with supercoiled plasmid (pTZ57R) as a control. To test ligation efficiency, Blue–white selection is the easiest screening method and the use of blue/white selection may aid identification of colonies containing plasmids with inserts (Figure 4.2).
- 108-
Chapter Four
Results & Discussion
Competent cells of a suitable strain of Escherichia coli allowing blue/white selection, and standard materials for culturing bacteria, LB agar plates, with ampicillin, X-gal, IPTG were used. Blue/white screening of colonies is not always reliable especially when short fragments are cloned. Therefore, additional screening method, Rapid Screening by Direct Electrophoresis, was used. Other screening methods are required to confirm the presence and/or orientation of the intended insert. A polymerase chain reaction (PCR) strategy may be sufficient to verify the presence and the orientation of the intended insert depending on the availability of vector- and insert-specific primers. The selection of primers for PCR is dictated by the goal of the screening. If the screening is aimed at only determining the presence of insert DNA, vector-based primers that anneal to sequences flanking the cloning site are suitable (PT-F and PT R were used) (Table 3.3). However, to determine the orientation of insert DNA, it is necessary to use one primer that anneals to the insert DNA in conjunction with one of the vector-based primers (OP 1F, PT R) (Table 3.3). One of the keys to monitor cloning projects is to perform restriction enzyme digests and run gel electrophoresis to analyze the results. Predicting fragment sizes and their motilities on the gels are important to be able to interpret the results. Single digestion with smaI was performed by producing 4814 bp and also a double digestion with two enzymes was done. Digestion by EcoRV and PstI, Hind III and EcoR I, Hind III and Xba I produced, 593 bp and 4221 bp, 2811bp and 2003 bp, 2840 bp and1974 bp, respectively (Figure 4.1). For further confirmation, samples were sent for sequencing and the result confirmed the cloning of tmRNA into pTZ57R (Appendix 3)
- 109-
Chapter Four
Results & Discussion
Figure (4.1): Cloning of tmRNA region into pTZ57R plasmid Lane M: 1Kb DNA ladder Lane 1: Colony PCR amplification of tmRNA region (1928pb) from MG1655 strain. Lanes (2-4): tmRNA PCR digested with PvuII (lane 2), AccI (lane 3), and EcoRV (lane 4). Lane 5: Recombinant plasmid (pTZN1) digested with SmaI resulting in a 4814bp linear fragment Lanes (6-8): Double digestion of plasmid pTZN1 with EcoR1, PstI (Lane 6), HindIII, EcoRI (Lane 7), and HindIII, XbaI (Lane 8).
4.2. Cloning of protein A (domain one) (pTZN2 construction) The protein A reporter gene 3A is the product of 3A gene which consists of three repeats of the A domain, an engineered derivative of the antibody-binding B domain of protein A from Staphylococcus aureus (Björnsson et al., 1997). Domain one of this reporter gene was used for in vivo and in vitro studies of E coli tmRNA concerning λ and helper phage growth. For subsequent manipulation, domain one (195 nt) was amplified by colony PCR from E coli (PAB/DH5α) using PN-F1 and PN-R1primer pairs. PCR performed with Taq polymerase that lacks 3′to 5′exonuclease activity and tends to add non-template directed nucleotides to the ends of double-stranded DNA fragments (NEB).
- 110-
Chapter Four
Results & Discussion
Figure (4.2): Blue white screening of cloning tmRNA region to pTZ57R plasmid Because the predominant nucleotide added in this non-template-directed manner is adenosine, many successful protocols have used vectors with a thymidine overhang to direct the cloning. The dT overhang-containing vector, pTZ57R/T 2886nt, is called T-vector, and the corresponding cloning is named T-A cloning (Chen & Janes, 2002). The T-vectors are available commercially and they arrive prepared for immediate use in ligation reactions without additional modification by the researcher and this technique eliminates the need for restriction enzyme sites to be incorporated into the primers to facilitate cloning of the PCR product. T-vectors will ligate to any PCR product present in the reaction, so it is important that reaction conditions do not result in the production of multiple products. The presence of multiple products will increase the effort required to construct a clone. Therefore, gradient PCR program was used to obtain only one domain of protein A (Figure 4.3) and the result of sequencing confirmed the amplification of one domain of protein A (Appendix 3). The methylated parental DNA was digested by Dpn I endonuclease which greatly improved the selection of the desired insert, to generate high-quality DNA - 111-
Chapter Four
Results & Discussion
for cloning, one domain purified by PCR purification kit prior to the ligation reaction. This method has the advantage that the PCR product is cloned in a single step, in addition, the single 3' nucleotide overhangs prevent self-ligation and concatamerization of both the vector and insert DNA, thus reducing background during the screening stage (Gerstein, 2001; Weissensteiner et al., 2004).
Figure (4.3): Colony PCR (gradient: annealing temp: 48.5-59°C) for amplification of a DNA fragment encoding domain one of the protein A using E coli (DH5α, PAB) cells as template (Note: Lanes 1-9 are identical).
4.3. Creation of chimeric junctions, deletion and insertion using PCR Deletion of (PK1, MLD, PK2-4), (MLD, PK2-4) and tail addition To study the requirements for TLD and PK1 structure and their relation to tmRNA function and bacteriophage growth, long PCR based deletion has been applied with great success in deletion of (PK1, MLD, PK2-4),(MLD,PK2-4) and replacing them with protein A (domain one) gene. This technique is a versatile technique that allows operations as different as creation of deletions, addition of small insertions, site-directed mutagenesis at any chosen location in the molecule of interest (Bartlett & Stirling, 2003). Primer-directed mutagenesis was used to create a deletion and addition on the pTZN1 construct. Because mismatches - 112-
Chapter Four
Results & Discussion
between templates and primers are tolerated under certain PCR conditions, primers can be designed to include predefined changes, so-called mutagenic primers (Chen & Janes, 2002). Primer design is critical to the success of this technique; therefore, forward and some of reverse PCR primers were designed to perform two functions. They carried specific sequences at their 3′ ends that were used for specific sequence deletion while at their 5′ ends there was a short tail with an arbitrary sequence of 12 extra nucleotides that did not anneal to the sequence adjacent to the 3′ binding sequence by which junction was occurred with the sense strand of one domain of protein A gene. Thus, ligation of one large DNA fragment with another was accomplished without subcloning (Figure 4.4).
Figure (4.4): Deletion and tail addition 1 Kb Lane M: 1Kb DNA ladder Ladder Lane b-e: PCR based deletion of 274bp, 271bp, 201bp, 198bp fragment from pTZN1 plasmid resulting in the generation of linear fragments with 4540bp (Lane b), 4543bp (Lane c), 4613bp (Lane d), 4616bp (Lane e), respectively. Lane a: pTZN1 plasmid (4814bp) digested with smaI (control).
- 113-
Chapter Four
Results & Discussion
To avoid the presence of single base overhang and to increase the fidelity of protein A (domain one), phusion high fidelity PCR kit was used employing PN-F1 and PN-R1 primers. The high fidelity DNA polymerases has 3′ to 5′ proofreading activity and the estimated error rates for these proofreading enzymes are approximately 1 to 2 X 10–6 errors per nucleotide per duplication, representing a 10-fold improvement over Taq DNA polymerase. It is important to note that these proofreading enzymes with lower error rates also have lower extension rates, resulting in lower PCR efficiency. Therefore, more amplification cycles were required to obtain adequate amount of amplified DNA (Figure 4.5) (NEB).
Figure (4.5): PCR amplification of domain one of the protein A (195 bp) using pTZN2 as a template. To complete the translation of truncated proteins and to facilitate recycling of stalled ribosomes, one domain protein A was provided with a stop codon, Ochre UAA or Opal UGA. In E. coli, tmRNA a tandem pair of UAA stop codons, apparently directing the addition of 10 amino acids to the truncated protein, is situated within a loop of helix 5 (Felden et al., 1996), only a histidine CAU codon in the one domain protein A sequence was changed to a stop codon (Ochre UAA - 114-
Chapter Four
Results & Discussion
and Opal UGA) separately by one mutagenic oligoncleotide (PN-R2A and PNR2G) respectively because Wower et al., (2005) demonstrated that a single stop codon was sufficient to terminate trans-translation in vivo. In order to make chimeric molecules, PCR ligation technique was applied in which each PCR product, shown in Figure 4.4, 4540 nt, 4543 nt, 4613 nt, and 4616nt, were mixed with 195nt one domain protein A separately during subsequent PCR cycles producing chimeric junction and then the chimeric genes were amplified using two outer PCR primers designed from the terminal regions of the full-size DNA fragment. To ensure the amplification of the entire chimeric genes, long PCR was used and the resultant products were religated and were used for transformation (NF1-NF5, NF7) (Figure 4.6). 4.4. Cassette mutagenesis To prepare E coli tmRNA containing mutation and its truncated derivative tmRNA lacking both mRNA-like segment and pseudonots PK1-PK4, a second cloning strategy was applied as an alternative approach depending on the PCR based mutagenesis which is widely used in molecular biology. The introduction of PCR methodologies has had an enormous impact on the field of site-directed mutagenesis. Specifically, PCR has vastly improved the efficiency and versatility of DNA synthesis and mutagenesis (Khudyakov & Fields, 2003). To improve the efficiency of cloning, directional cloning was performed using primers designed to include unique restriction enzyme recognition sites, It is considered the most efficient approach because it precludes vector religation and greatly reduces the background level of non-recombinants. In this alternative approach, a single oligonucleotide deletion primer serves two purposes simultaneously: it generates deletions and introduces a unique restriction site, taking in account that the mismatches should normally be located in the middle or 5′ end of the primer (Ward, 2002; Khudyakov & Fields, 2003; Gaytan et al., 2005). - 115-
Chapter Four
Results & Discussion
7
6
5
4
3
2
1
1Kb Ladder
Figure (4.6): Chimeric genes Lane M: 1Kb DNA ladder Lane 1: (NF1) PCR amplification for fusion of 195 bp of protein A (domain one with UAA stop codon) fragment with the 4540 bp PCR fragment (from Figure 4.4 lane b). Lane 2: (NF2) PCR amplification for fusion of repeated region of 195 bp of protein A (domain one with UAA stop codon) fragment with the 4543 pb PCR fragment (from Figure 4.4 lane c). Lane 3: (NF3) PCR amplification for fusion of 195 bp of protein A (domain one with UGA stop codon) fragment with the 4540 bp PCR fragment (from Figure 4.4 lane b). Lane 4: (NF4) PCR amplification for fusion of repeated region of 195 bp of protein A (domain one with UGA stop codon) fragment with the 4543 pb PCR fragment (from Figure 4.4 lane c). Lane 5: (NF5) PCR amplification for fusion of 195 bp of protein A (domain one with UAA stop codon) fragment with 4613 bp PCR fragment (from Figure 4.4 lane d). Lane 6: (NF6) PCR amplification for fusion of repeated region 195 bp of protein A (domain one with UGA stop codon) fragment with 4616 bp PCR fragment (from Figure 4.4 lane e). Lane 7: (NF7) PCR amplification for fusion of 195 bp of protein A (domain one with UGA stop codon) fragment with 4613 bp PCR fragment (from Figure 4.4 lane d). The constructs, (NF1and NF2), (NF3 and NF4), (NF5 and NF6), and NF7 were amplified using the primer pairs (TLD-aF, PN-R2A), (TLD-aF, PN-R2G), (PK1-aF, PNR2A) and h (PK1-aF, PN-R2G), respectively.
- 116-
Chapter Four
Results & Discussion
One of the challenges of this project is the automation and coordination of primer design and synthesis. To prevent nucleotide shift caution should be considered in introducing restriction enzyme recognition site in protein A primers because nucleotide shift +1 or –1 at each primer results frame shift in the proteincoding sequence and abolish the production of the normal protein. Beside of the restriction site, protein A (domain one) was provided with a stop codon in order to complete the translation of truncated proteins and to facilitate recycling of stalled ribosomes, a valine GUC codon was changed to a stop codon (Ochre UAA) by a mutagenic oligoncleotide (PN-COR). Long Amp. taq PCR kit and Phusion High-Fidelity PCR kit were used for the deletions in tmRNA gene and the amplification of protein A fragment, respectively, because it is critical to choose the polymerase that has both the processivity to amplify the entire construct as well as the fidelity to amplify the target sequence without introducing mutations in addition to those directed by the mutagenic primers. This approach has been employed to construct four specific deletions in tmRNA region (Figure 4.7) and then ligated with one domain protein A gene. After ligation and transformation, the resulted constructs were designated as NF8, NF9, NF10, NF11. For further confirmation, the constructs were sent to be sequenced and the results confirmed the appropriate ligation (Appendix 3).
- 117-
Chapter Four
Results & Discussion
4
3
2
1
1Kb Ladder
Figure (4.7): PCR based deletion PCR based deletion of 181bp, 198bp, 256bp, and 282bp from pTZN1 using primers (in table 3.4) with restriction sites (XhoI, BspEI), resulted in generation of fragments 4633bp (Lane 1), 4616bp (Lane 2), 4558bp (Lane 3), and 4532bp (Lane 4) respectively.
1
A
2
M
B
Figure (4.8): PCR amplification confirming the ligation of protein A by chimeric junction and cassette mutagenesis (A) Lane M1: 100bp DNA ladder, lane M2: 1Kb DNA ladder. Lane (1-17): Nested PCR (colony PCR) for amplification of a fragment encoding domain one of the protein A from NF1 (Lanes 1 and 2), NF3 (Lanes 3 and 4), NF5 (Lanes 5 and 6), NF7 (Lanes 7 and 8), NF8 (Lanes 9 and 10), NF9 (Lanes 11 and 12), NF2 (Lane 13), NF4 (Lane 14), NF10 (Lanes 15 and 16), and NF11 (Lane 17) constructs. (B) Lane M: 100bp DNA ladder, Lanes (1, 2) Nested PCR amplification of domain one of the protein A (195 bp) from NF2 (Lane 1) and NF4 (Lane 2) constructs. The fragments (390 bp) represent repeated region of domain one of protein A.
- 118-
Chapter Four
Results & Discussion
4.5. Chromosomal mutagenesis and gene replacement Despite the power of sequencing and of emerging high-throughput technologies to collect data rapidly, the definitive functional characterization of unknown genes still requires biochemical and genetic analysis. A popular approach to the functional characterization of an uncharacterized gene is to delete its coding sequence from the genome and look for consequent phenotypic changes of deletants. Methods to precisely delete E. coli genes are based on promoting genetic exchange between an altered locus engineered in vitro and the target chromosomal locus (Emmerson et al, 2006). The replacement procedure starts with the in vitro construction of deletions, it has become necessary to establish a procedure that will permit rapid utilization of the available sequence information and analyze gene function systematically (Link et al, 1997). Therefore, PCR based method for direct gene deletion was used, and a generic PCR based method using two flanking primers were developed to perform internal deletion mutations. The overall procedure involved deletion of tmRNA, smpB and tmRNA-smpB together from (pTZN1) plasmid by long PCR (Figure 4.912). The results of sequencing supported the success of PCR-based deletions of the three constructs (Appendix 3).
- 119-
Chapter Four
Results & Discussion
M
M
Figure (4.9): PCR based deletion (A) Lane M: 1Kb DNA ladder PCR based deletion of tmRNA gene from pTZN1 plasmid used as a template resulted in generation of 4414bp fragment (Lanes 2 and 1), lane 3 represents linearized pTZN1 (4814bp) using smaI (control). (B) Lane M: 1Kb DNA ladder Deletion of smpB gene from pTZN1 by PCR based deletion, resulting in the generation of a 4304bp (Lane 2 and Lane 3), lane 1 (3753bp) represents the deletion of both tmRNA and smpB genes from pTZN1 using PCR based deletion technique.
Figure (4.10): Genetic map of pTZN3 construction - 120-
Chapter Four
Results & Discussion
Figure (4.11): Genetic map of pTZN4 construction
Figure (4.12): Genetic map of pTZN5 construction - 121-
Chapter Four
Results & Discussion
In addition to the replacement process, subclonings were required for the regions covering the flanking of the deleted regions. This traditionally involved the use of restriction enzymes, BamHI and SalI, to precisely excise the regions, 1528nt, 1418pb, 868bp, separately representing the remnants after the deletion of tmRNA, smpB and both together respectively from 1928bp tmRNA region cloned to pTZ57R plasmid(pTZN1). The constructs were subsequently subcloned into the replacement vector at the same or compatible sites. To facilitate subcloning, these appropriate unique restriction sites were added by site-directed mutagenesis at flanking regions. In order to make deletion in the E. coli chromosome, low-copy-number temperature-sensitive plasmid vector, pKO3 (5681bp), was used. This vector, pKO3, is a gene replacement vector that contains a temperature-sensitive origin of replication and markers for positive and negative selection for chromosomal integration and excision (Link et al, 1997). To assess the accuracy of the subcloning, primers were used for the sites pKO3-left and pKO3-right flanking the cloning site that enabled the screening of the replacement vector for the inserts, 1528pb (pKON6), 1418bp ((pKON7), 867pb (pKON8) by PCR (Figure 4.13). A number of techniques are now available for generating relatively specific deletion in the bacterial chromosome. In order to immune to exonuclease digestion, closed circular replicating plasmids were used as a delivery system (Merlin et al, 2002). The plasmids, which incorporated cloned DNA flanking the target, were forced to integrate into one of the homologous regions by selection for retention of a plasmid marker under restrictive conditions because the disruption of targeted genes on the E. coli chromosome relies on homologous recombination in vivo in E. coli and allows a wide range of modifications of DNA molecules of any size and at any chosen position. Homologous recombination is the exchange of genetic material between two DNA molecules in a precise, specific and accurate manner. - 122-
Chapter Four
Results & Discussion
These qualities are optimal for engineering a DNA molecule regardless of its size. Gene replacement occurs through homology regions, which are stretches of DNA shared by the two molecules that recombine (Hamilton et al., 1989; Link et al., 1997; Emmerson et al., 2006). To screen for chromosomal integrates, the in vitro altered sequences carried in the vector pKO3 (pKON6, pKON7, pKON8), were transformed into E. coli (MG1655), and the transformed cells were allowed to briefly recover at the permissive temperature (30°C). The cells were then plated on chloramphenicol plates at the nonpermissive temperature (42°C). The repA (Ts) replication origin is derived from pSC101 and has a permissive temperature of 30°C but is inactive at 42 to 44°C and also the cat gene (encoding chloramphenicol resistance) is used as a marker to select for chromosomal integrates and as a marker for cells harboring vector sequences after plasmid excision (Link et al, 1997). Thus, only integrants resulting from a homologous recombination between one of the arms of homology and the corresponding wild-type locus survive (Merlin et al., 2002). Integrants were large colonies recognized as a small number of large colonies, often on a background of microcolonies (Figure 4.14)
- 123-
Chapter Four
Results & Discussion
M1
M2
M1
M1
Figure
(4.13):
Colony
PCR
using
primers
M2
flanking
pKO3
inserts
(A) Lane M1: 1Kb DNA ladder Lane M2: 100bp DNA ladder Lane 1: PCR amplification of tmRNA region (1928bp) using E. coli MG1655 cells as template Lanes 2 and 3: Colony PCR amplification of pKON7 insert. (B) Lane M1: 1Kb DNA ladder Lanes (1-9) Colony PCR amplification of the pKON8 insert (lanes 1-9 are identical) (C) Lane M1: 1Kb DNA ladder Lane M2: 100bp DNA ladder Lanes (2, 3): Colony PCR amplification of pKON6 insert (all bands are identical).
- 124-
Chapter Four
Results & Discussion
A
B
C
Figure (4.14): Single cross over of pKON7 (A), pKON6 (B), and pKON8 (C) into the E. coli MG1655 genome by using LB plate with chloramphenicol as a growth medium. To select those that the in vitro altered sequence has replaced the wild-type locus, the integrants were repurified on the same medium at 42°C and selective pressure is released by overnight culture at 30°C in LB medium supplemented with 5% sucrose, allowing the cointegrate to resolve by means of a second homologous recombination. Sucrose kills bacteria containing a functional sacB gene (Bloor & Cranenburgh, 2006). - 125-
Chapter Four
Results & Discussion
To screen the desired gene, PCR was performed for sucrose-resistant and chloramphenicol-sensitive colonies by using primers (OP-1F, OP-2R) and (TMEC2F, TMEC1R) to the genomic DNA flanking the altered sequence. The main disadvantage of the method was time consuming; the linear replacement methods, in contrast, can be very much faster. However, a large replacement can be made and each step of the procedure can be monitored for success and the number of successful replacements is expected to be high. Furthermore, it is easy to judge whether failures have a technical or biological basis. Employing the method described by Link et al., (1997) the precise deletion of E. coli tmRNA gene was obtained (Figure 4.15) and confirmed by sequencing (Appendix 3). The frequency of colonies bearing the tmRNA deletion allele after resolution of the plasmid integrates were very low because the PCR-screens were performed for about 400 sucrose-resistant and chloramphenicol-sensitive colonies and also the deletion of E. coli smpB and tmRNA with smpB together unfortunately were not obtained. This suggests that cointegrate is not stable and is quickly resolvable when selective pressure is withdrawn and the plasmid is often lost during excision (Merlin et al., 2002). This low frequency may be correlated to the average size of the flanking homologies. If the nonhomologous sequences were less than the total homology present, the integration frequency resembled that of uninterrupted sequences. In the case where the region of nonhomology was on the chromosome rather than on the plasmid, the insertion frequency was reduced 50% compared with the value for the inverse experiment (Hamilton et al., 1989). Another reason behind such result may be due to dissimilar size (1061nt, 467nt), (372nt, 1046nt) and (390nt, 478nt) of right and left hand flanking regions - 126-
Chapter Four
Results & Discussion
for deletion of tmRNA, smpB and both together, respectively, because it is important to have similar sizes of left and right hand flanking regions to maximize the efficiency of exchange. Grossly differing flanking regions will favor recombination at one flanking region thereby reducing frequency of the double crossover event that is required for successful allelic exchange (Emmerson et al., 2006). To maximize the efficiency of exchange flanking regions, it is preferred to be between 600bp and 1000bp of DNA (Emmerson et al., 2006). Additionally, the use of temperature-sensitive plasmid vector may be another possible reason explaining low integration frequency because it is a derivative of pSC101 that has a copy number of 6 to 10 per cell, for some genes, making a gene dosage problem with 6 to 10 copies per cell (Merlin et al., 2002). To delete desired endogenous gene, tmRNA, another alternative protocol was performed according to Emmerson et al., (2006). The exchange process relies on a series of sub-culturing steps. Unexpected results were obtained. The results are still a challenging question for future study because instead of 1528nt region, approximately about (200-250 nt), (400-500 nt) and (800-900 nt) were produced M1 M2 when the assumed integrates, sucrose-resistant and chloramphenicol-sensitive, were amplified by PCR using the primer pair (OP-1F, OP-2R). These may be attributed to some recombination activities of the E. coli including transposons that result in a random transposon mutagenesis.
- 127-
Chapter Four
Results & Discussion
Figure (4.15): PCR amplifications of E. coli MG1655 and E. coli MG1655/∆ssrA. Lane M1: 1Kb DNA ladder, Lane M2: 100 pb DNA ladder the PCR amplification of the tmRNA region (Lane 1: 1928 pb), tmRNA gene (Lane 3: 643 pb) and smpB gene (Lane 5: 653 pb) from E. coli MG1655. PCR amplification of the tmRNA region (Lane 2: 1528 pb), tmRNA (Lane 4: 243 pb) and smpB gene (Lane 6: 653 pb) from E. coli MG1655/∆ssrA.
4.6. SmpB deletion on pKON6 plasmid To increase the frequency of recombination, smpB gene was deleted by long PCR (Figure 4.16). In order to demonstrate the accuracy of the deletion and religation, PCR screens also were performed (Figure 4.17). The integration frequency was most closely correlated to the average size of the flanking homologies, longer regions of homology are required to achieve good rates of recombination (Bloor & Cranenburgh, 2006). When tmRNA and smpB genes were deleted sequentially the flaking region between these two gene remain, which is about 214bp so that right flanking region became 692bp from 478bp - 128-
Chapter Four
Results & Discussion
M
Figure (4.16): Construction of pKON9 vector PCR based deletion of smpB gene from tmRNA region by using pKON6 plasmid as a template (Lane 1) and Lane M is the 1Kb DNA ladder
Figure (4.17): PCR screen of pKON9 construct Plasmid amplification of pKNO9 insert resulted in (Lane 1: 1081 bp region (using primers OP-1F and OP-1R), lane 2: 1233 bp region (using primers PKO3-F, PKO3-R) (Lane 2); lane 3: 243 bp (using primers TMEC 2F and TMEC 1R) and lane 4: 143 bp (using primers (SmpB F and SmpB R)
- 129-
Chapter Four
Results & Discussion
4.7. Bacteriophage assay To assess the effect of various mutations in tmRNA on phage growth and to investigate whether the trans-translation model, as proposed, might explain the defect in phage growth seen in ssrA mutant strains, bacteriophage assay was performed. One of the most important procedures in virology is measuring the virus titer – the concentration of viruses in a sample. A widely used approach for determining the quantity of infectious virus is the plaque assay. This technique was first developed to calculate the titers of bacteriophage stocks. Renato Dulbecco modified this procedure in 1952 for use in animal virology, and it has since been used for reliable determination of the titers of many different viruses (Cann, 2005). To investigate the physiological connection between tmRNA and phage growth, λ and helper phage were chosen other than λimmP22 phage because of the unknown effects of ssrA mutation on their growth. Bacteriophages, or bacterial viruses, have been major research tools for molecular biology, and the history of research with them is virtually a history of molecular biology itself (Guttman & Kutter, 2002). Like other viruses, phages rely on a variety of host macromolecules to support their programmed development (Retallack et al., 1994). A plaque is a clear area which results from the lysis of bacteria. Therefore, to obtain a more quantitative assessment, plaque forming unit was counted in which each plaque arises from a single infectious phage (Clokie & Kropinski, 2009). In order to support phage growth, tmRNA mutants must be able to enter the ribosome, resume translation on the tmRNA template, and bring about termination at a stop codon. The phage growth requires only the release of the ribosomes, not proper frame choice or destruction of the aborted polypeptide (Miller et al., 2008; Ivanona, 2005) indicating the primary function of tmRNA which is ribosomal
- 130-
Chapter Four
Results & Discussion
rescue and not the tagging for degradation of the anomalous polypeptide as it was suggested in the original trans-translation model by keiler et al., (1996). In addition to unraveling important aspects of the biology of ssrA, our experiments raise new questions concerning the physiological connection between λ and helper phage other than λimmP22 phage and the mode of action of ssrA gene because the results provided a compelling evidence that only TLD is essential whereas PK1-PK4 are not essential for tmRNA function. The results of phage assay of different constructs (Table 4.1) (Figure 4.1820) revealed that K-12 derivatives, NF7, NF5 in both lambda and helper produced stable tmRNA at levels sufficient for a functional tmRNA to support phage growth but NF7 produced normalized tmRNA level above the (pTZ57R/1928). These data provided furthur evidence that tmRNA with UGA stop codon support phage growth more efficiently than with UAA stop codon. The present results are consistent with Roche and Sauer, (2001) and Miller et al., (2008) who concluded that the tag template after the resume codon can be altered with little or no effect. Because it appears that the crucial sequence acts locally: a five-nucleotide sequence immediately upstream of the resume codon sets the precise frame (Williams et al., 1999; Lee et al., 2001; Ivanova et al., 2002). But they conflict the suggestions that stated replacing a tmRNA pseudoknot with single-stranded RNA or disrupting its structure is significantly more deleterious than replacing it with a folded element. Suggested roles for pseudoknots include aiding in overall tmRNA folding, slowing tmRNA degradation, maintaining the correct geometry for efficient translation switching to the tmRNA ORF, and serving as binding sites for proteins that facilitate tmRNA function (Nameki et al., 1999a; Nameki et al., 1999b). However Lee et al., (2001) also has shown that none
- 131-
Chapter Four
Results & Discussion
of the other three pseudoknots are involved either in efficiency or in fidelity of trans-translation. Additionally, Wower et al., (2004) by gel mobility shift assays demonstrated that the deletion of PK2 in particular weakened the interactions between tmRNA and ribosomal protein S1, suggesting that PK2 may be an important S1 binding site in tmRNA and also demonstrated that alterations in helix 5 and the PK2-PK4 region adversely affect maturation of tmRNA precursors. Because formation of the double stranded acceptor stem is a prerequisite for trimming the termini of the precursor tmRNA, this finding implied that disruption of pseudoknots impairs the folding of the 3′ and 5′ termini of tmRNA into a tRNA-like structure and suggested that the presence of at least one pseudoknot, optimally PK4, is required for tmRNA tagging. Furthermore, cryo-electron microscopy revealed that PK2 remains available for interactions with protein S1 when tmRNA enters the ribosome (Valle et al., 2003). The present study suggests that mutant tmRNAs (NF5, NF7) in which PK2PK4 had been replaced with one domain protein A without adversely affecting maturation of tmRNA precursors because co-expression of protein SmpB with tmRNA significantly improved the maturation of tmRNA precursors, indicating an unanticipated role for this protein in trans-translation. Because SmpB forms a tight complex with the TLD (Gutmann et al,2003), it may facilitate the formation of the acceptor arm in precursor tmRNA and, thus, assists in the formation of a structure that is suitable for trimming by RNases P, T, and PH. Moreover, because prebinding of SmpB to stalled ribosomes triggers trans-translation, overexpression of truncated proteins is likely to recruit SmpB to ribosomes and might limit its availability for tmRNA maturation (Hallier et al., 2004).
- 132-
Chapter Four
Results & Discussion
Table (4.1): The phage assay (PFU*10 7/mL) of different constructs. Mean ± SE Constructs
Helper Phage (PFU*107/mL)
Lambda Phage (PFU*10 7/mL)
6256.333 ± 4.055
Totally
0.000 ± 0.000
0.000 ± 0.000
pTZN1
4178.667 ± 2.028
3771.000 ± 1.528
NF1
235.333 ± 1.764
263.667 ± 2.028
NF2
54.000 ± 0.577
12.667 ± 0.882
NF3
16659.333 ± 1.202
4306.000 ± 3.055
NF4
494.667 ± 2.404
489.333 ± 4.055
NF5
1801.333 ± 0.882
1439.333 ± 0.882
NF7
5173.667 ± 2.728
2498.000 ± 2.082
NF8
0.000 ± 0.000
0.000 ± 0.000
NF9
1258.000 ± 2.082
1483.000 ± 2.082
NF10
706.667 ± 2.404
328.333 ± 4.910
NF11
1027.000 ± 3.055
1150.000 ± 1.528
pTZN3
0.000 ± 0.000
0.000 ± 0.000
pTZN2
0.000 ± 0.000
0.000 ± 0.000
E coli MG1655 E coli MG1655/ ∆ssrA
- 133-
Chapter Four
Results & Discussion
Figure (4.18): Phage assay (PFU * 107/mL) of different constructs. Obtained data provide first evidence that the psedoknots PK2-PK4 play an important role in the stability of tmRNA and therefore successfully inter changeable and efficiently support phage growth. This finding is consistent with Metzinger et al., (2005) and Dulebohn et al., (2007) who reported that pseudoknots PK2–PK4 can be replaced with RNA single strands without affecting significantly trans-translation in E.coli cells. The common layout of the secondary structures indicated a similar function in all bacteria. The number and size of the pseudoknots varied, supporting the idea that the pseudoknots may only enhance the essential functions carried by the TLD and the MLD (Burks et al., 2005).
- 134-
Chapter Four
Results & Discussion
A
B
Figure (4.19): Plaque assay for λ phage using E coli MG1655 resulting in total lysis (A) whereas using E coli MG1655/ ∆ssrA (B) did not produce plaques.
A
B
Figure (4.20): Plaque assay for helper phage using E coli MG1655 resulting in formation of plaques (A) whereas using E coli MG1655/ ∆ssrA (B) did not produce plaques.
.
The sequence of tmRNA encoding the tag peptide with PK2-PK4 were deleted completely directly after GCA resume codon and replaced with one domain - 135-
Chapter Four
Results & Discussion
protein A gene with UAA stop codon (NF9) and its resume codon changed from GCA which encodes alanine to CGG encode argnine. In conclusion, our result indicates that aminoacylation plateau levels of tmRNA construct were sufficient to support phage growth (Table 4.1). The provided result supported by Williams et al., (1999) who found that changing the wild-type alanine resume codon in E. coli tmRNA to another codon, did not affect trans-translation, and the appropriate amino acid, according to the genetic code, was translated in the tag sequence. A variety of sense codons can replace the naturally-occurring GCA alanine codon as the resume codon, both AAA and AAG lysine codons are non-functional resume codons. (O’Connor, 2007) but altering the amino acid identity from alanine to histidine did not abolish trans-translation confirming the importance of aminoacylation but not the one of the alanine amino acid itself (Ivanona, 2005). These results suggest that the main function of tmRNA in releasing stalled ribosomes is to supply a stop codon and so facilitate termination and subsequent ribosome recycling (O’Connor, 2007). Mutation of this upstream sequence (UAGUC) leads to the shifting of the frame of the tag sequence in vitro (Lee et al., 2001). Based on extensive mutational analysis, reported evidences speculate the present results that the MLD, PK2-PK4 can be replaced by the other sequence which is consistent with Miller et al., (2008) who concluded that the resume codon lies 12 nucleotides downstream from pseudoknot 1, which like the other three pseudoknots can be replaced by unrelated sequences without loss of activity. Concerning the constructed strains in the present study that carry mutated tmRNA and use argnine as a resume codon in their respective tmRNA mediated protein tagging system, their tmRNA structures might allow specific recruitment of tRNA Arg. Out of 140 known tmRNA sequences from 118 species, alanine is the resume codon for >80% of all tmRNA sequences. The remaining ones possess - 136-
Chapter Four
Results & Discussion
either a glycine, an aspartic acid or a valine resume codon. This suggests that an alanine codon is preferred for resuming translation within the tmRNA internal ORF. For the other few species with either glycine, aspartic acid or valin as a resume codon, their tmRNA structures might use either tRNA Gly, tRNA Asp or tRNA Val, but not tRNA Ala in tran-translation process (Gillet & Felden, 2001). However, the new finding here, in contrast to the NF9, NF8 definitely didn’t support the growth of both phages. This construct contains the plasmid harboring tmRNA gene in which the final three amino acids (Leu. Ala. Ala.) of MLD and PK2-PK4 were completely deleted and they were replaced with one domain protein A gene with UAA stop codon and the 6th and 7th codons were changed from TAC, encodes tyrosin, and GCT, encodes alanine, to TCC, encodes serine, and GGA, encodes glycine, respectively. This result may indicate that the lack of functional tmRNA, is unable to charge Ala, and does not interact with the ribosome and abolish ribosome recycling. However, more detailed investigations might explain the observed inactivation in the future because tmRNA inactivation could be a useful therapeutic target to increase the sensitivity of pathogenic bacteria against antibiotics (de la Cruz & Vioque, 2001) To determine the roles of tmRNA domain, tagging potential of tmRNA was tested that lack the whole PK1, MLD, PK2-PK4. Four derivatives of tmRNA were constructed, both NF3 and NF1 derivative carrying tmRNA with deletion from (47289)nt, and the deleted regions (PK1, MLD, PK2-PK3) were replaced with one domain protein A gene with different stop codons UGA and UAA separately. Surprisingly, unexpected results were obtained. Both strains, NF1 and NF3, supported the phage growth (Table 4.1). Based on these results, NF3 with UGA termination signal produced a very stable tmRNA comparing with the control and about two folds of that of MG1655 whereas NF1 with UAA termination signal - 137-
Chapter Four
Results & Discussion
reduced dramatically the efficiency of targeting toward phage growth and it may provide the evidence that there was a sharp decrease in plasmid yields carry tmRNA mutant. In another finding, two other tmRNA derivatives with PK1,MLD,PK2-PK4; NF10 whose nucleotides were 47G, 49C, 305A, 307G, 308T were replaced by 47C, 49G, 305C, 307C, 308G, repectively and NF11 whose nucleotides 34A, 37C, 38A, 312A, 313C were replaced by 34T, 37G, 38G, 312C, 313T, respectively. Additionally, in both constructs, from the converted nucleotides were replaced with one domain protein A with UAA termination codon. The obtained data indicated that they produced functional tmRNA with less efficiency comparing to both pTZ57R/1928 and MG1655. These results conflict the speculation that translation of the resume codon of the tmRNA open reading frame by a tRNA is both necessary and sufficient for ribosome recycling (O’Connor, 2007) and also they are in consistence with works of Williams et al., (1999), Lee et al., (2001) and Ivanova et al., (2002) who suggested that the sequence upstream of the tag starting point, especially the core AGU(86-88) sequence is essential for trans-translation and it has been shown to be essential for protein tagging by tmRNA. The core sequence, may interact with the decoding region or its periphery of the ribosome directly or via trans-acting factor (Lee et al., 2001) because this '-1 triplet' forms an A-form structure even in its unpaired state; this structure mimics the codon-anticodon interaction and binds directly to the ribosomal decoding center. The -1 triplet hypothesis is important because it is the most credible model for reading-frame selection that postulates direct binding of the ribosome to the tmRNA upstream sequence (Lim & Garber, 2005). Mutations in this upstream region (residues 84-90 in E. coli) have been shown to affect frame choice, with several mutations causing the tag to be translated in the incorrect frame (Lee et al., 2001). - 138-
Chapter Four
Results & Discussion
Our findings disfavor -1 triplet hypothesis, a model in which the ribosome binding selects the assumed reading frame (protein A) in tmRNA directly, an alternative suggestion might be that TLD or mostly protein A may have an intramolecular interaction with the decoding center of ribosome and may facilitate translocation of TLD domain from the ribosomal A site to the P site by transpeptidation and may likely to play a major role in positioning the assumed frame. These observations are further supported by Shimizu and Ueda, (2006) who provided further evidence that the tmRNA -1 triplet sequence, and indeed the whole template sequence, is not required for ribosome binding, A-site accommodation, or peptidyl transfer. Miller et al., (2008) finding disprove the -1 triplet hypothesis which is not required for accommodation of tmRNA into the ribosome, although it plays a minor role in frame selection instead of supporting a model in which the binding of a separate ligand to A86 is primarily responsible for frame selection. The present results are consistent with that the -1 triplet sequence which is not required for any essential function of tmRNA in the support of phage growth. Moreover, it has been determined that the critical function of tmRNA in phage survival is ribosome release. Improper frame selection and degradation of the protein by protease recognition of the tag are not required for phage survival (Watts, 2008; Miller et al., 2008). Additionally, these results are in accord with previous studies which have reported that the growth of some λimmp22 hybrid is supported effectively by mutant tmRNAs adding tags that do not contain the signal for protein degradation. Growth of this hybrid is not supported by a mutant tmRNA that cannot be charged with alanine. These observations led to the proposal that tagging for proteolysis might not be the primary role for tmRNA; rather, in some cases, tmRNA may only
- 139-
Chapter Four
Results & Discussion
be required to remove the stalled ribosome from intact mRNA, with degradation of polypeptides serving only an ancillary role (Huang et al., 2000). The obtained results conflict with the earlier studies performed by Nameki et al., (1999a, 1999b), Felden et al., (2001), Takada et al., (2002), and Withey and Friedman, (2003) who proposed that first pseudoknot structure (PK1) 12 nt upstream of the tag-encoding sequence is important for efficiency of transtranslation, mutation disrupting each stem of PK1 or replacing it with single stranded RNA inactivate or abolish both of the aminoacylation and alanine incorporation activities of tmRNA. On other hand, the present results also conflict with that the deletions of PK1 and residues 69–78 affected the placement of the resume codon on the ribosome. This suggestion is consistent with earlier studies that revealed that mutations in the region upstream of the resume codon lead to the resumption of translation in the incorrect frame (Lee et al. 2001; Trimble et al. 2004; Miller et al. 2008). In the current study, PK1 was successfully replaced with one domain protein A gene and produced a functional mutant tmRNA regarding the phage growth support. It has been reported that this pseudoknot can be lost in plastid tmRNA of Cyanidioschyzon merolae (Novoa & Williams, 2004). Our finding is consistent with comparative analyses of tmRNA sequences that identified a number of bacterial tmRNAs, in which PK1 was replaced by a single hairpin (Zwieb & Wower, 2000; Gaudin et al., 2002; Sharkady & Williams, 2004; Andersen et al., 2006). In M. pneumoniae, P. marinus, and G. violaceus, the hairpin contained 5 bp. It is also consistent with the later studies carried out by Tanner et al., (2006) and Dulebohn et al., (2007) who demonstrated that PK1 acted in a purely structural role. Mutations in PK1 that retain the pseudoknot structure or replacement of PK1 with stable hairpins yielded tmRNA mutants with nearly wild-type activity levels. Furthermore, it has been proposed that the PK1 is not an essential component of - 140-
Chapter Four
Results & Discussion
tmRNA but plays an important role in stabilizing the structure of tmRNAs with long RNA segments connecting the TLD and MLD and thus preventing formation of alternative structures (Wower et al, 2009) Based on these results, this work raises new questions concerning the translation machinery in E coli, and the mode of action of ssrA gene, how the ribosome chooses the proper codon to resume translation on tmRNA in the absence of PK1, -1 triplet, and MLD, PK2-PK4 all together and what the precise mechanisms behind their supporting in phage growth are. One of the possibilities may be that understanding of ssrA function is based largely on the tRNA-like properties of SsrA RNA and on the structures of tagged protein products. The tRNA-mimic domain is essential for tmRNA function. For example, mutations in the acceptor stem that prevent charging with alanine abrogate known tmRNA biological activities and it also contains the recognition sites for alanyltRNA synthetase, SmpB, and EF-Tu (Moore & sauer, 2007). The TLD-SmpB complex binds to the A and P sites as tmRNA transits the ribosome (Wower et al., 2009). Footprints in the tRNA-like domain of full-length tmRNA with SmpB are remarkably similar than those identified between a molecule encompassing only the tRNA portion and SmpB (Gutmann et al., 2003). This indicates that in the fulllength RNA, the tRNA domain folds independently and its conformation is not affected by the other domains. Specific protections have been mapped in the T- and D-loops of tmRNA, consistent with the binding of SmpB to the elbow region, stabilizing the D-loop in an extended conformation and increasing the angle between the acceptor stem and H5. A single conserved and position-specific G:U base pair in the tRNA acceptor stem is the key identity determinant for aminoacylation of alanine-specific RNAs by AlaRS in vivo (Metzinger et al., 2005), consistent with the interaction between D- and T-loops is an important element in stabilizing the structures of tRNAs, and it likely plays a similar role in tmRNA. - 141-
Chapter Four
Results & Discussion
Nucleotides 16–20 and 334–335 of tmRNA are important for association of charged tmRNA with the ribosome (Withey & Friedman, 2003). The results presented here speculate that several factors may contribute to tagging by SsrA, including stop-codon identity, release-factor activity, and the amino-acid sequence of the nascent peptide. For instance, peptidyl-tRNA hydrolysis is slow for the assumed tag then several rounds of release factor association and dissociation may be required before normal termination of translation. This would allow ssrA multiple opportunities to compete for A-site binding and another possibility is that the amino-acid sequence of the nascent peptide could decrease the affinity of release factors for the A-site could increase the affinity of SsrA for the A-site, or slow hydrolysis of the peptidyl-tRNA bond. Another unexpected result was obtained in NF2 and NF4 constructs; PK1, MLD and PK2-PK4 were deleted and replaced with two domains of protein A gene with UAA and UGA respectively (Table 4.1). Very faint support in phage growth was observed especially in the former one. It had a large decrease in plasmid yield and a decline growth rate of E coli strain carrying NF2 construct were also observed in different antibiotic concentrations. Further study is required concerning two domains with the physiological connection of ssrA gene and helper and lambda phages. Plasmids face many of the same problems as bacterial chromosomes: they must replicate themselves, synthesize appropriate gene products, and segregate at least one copy of the plasmid into each daughter cell at cell division. The plasmid maintenance defect associated with tmRNA could be caused by misregulation of Rep, which is required for plasmid replication (Hong et al., 2007). While there are some variations among strains, most of the mutant strains produced, normalized tmRNA levels near the wild-type level and in the others, the - 142-
Chapter Four
Results & Discussion
trans-translation were decreased but not completely inactivated. In the present study, it is proposed that the nature of the termination codon could affect the efficiency of ribosome recycling because a large reduction of (PFU*10 5/mL) was observed for both phage infection in the mutant strains with UAA termination codon. These results are in consistence with other studies reporting the reduction of tagging when inefficient opal stop codon has been changed into a more efficient ochre stop codon (UGA to UAA) (Ivanona, 2005). The identity of the stop codon can affect SsrA tagging of full-length proteins, with less efficient stop codons leading to higher levels of tagging (Ranquet & Gottesman, 2007). Because termination of translation is a relatively slow process compared to translation elongation, SsrA and protein release factors RF2 probably compete for binding to the A-site while the ribosome idles at an inefficient stop codon (Hayes et al., 2002; Withey & Friedman, 2003). Moreover, the identity of the codons preceding the stop codon was also shown to be important determinant for the probability of tagging occurrence (Ivanona, 2005). The identification of SmpB as an essential participant in ssrA function represents an important step forward that should help to guide future studies of detailed mechanism and biological function in the SmpB–SsrA peptide-tagging system. Therefore, the phage assays for ∆smpB (pTZN4) and ∆smpB∆tmRNA (pTZN5) constructs have been performed. Because of the presence of endogenous copies of smpB gene on bacterial chromosome ∆smpB (pTZN4) construct in +ssrA, E coli strain supports growth of the phage. This result conflicts with other results where deletion of the smpB gene in E.coli prevented SsrA-mediated peptide tagging and mimics other phenotypes of ssrA-deficient strains (Ivanona, 2005). For further confirmation, endogenous gene must be deleted by gene replacement. But the ∆smpB∆tmRNA (pTZN5) construct in ∆ssrA strain produced no plaques because there were no SmpB-tRNA complexes. Similar results have been - 143-
Chapter Four
Results & Discussion
documented by other groups indicating that all known biological activities of tmRNA require SmpB and the formation of the SmpB_SsrA complex appears to be critical for recognition and rescue of stalled ribosomes because in the absence of SmpB protein SsrA does not associate stably with 70 S ribosomes (Dulebohn et al., 2006; Sundermeier & Karzai, 2007; Watts, 2008). For more confirmation of the functionality of the mutated constructs tested in a ∆ssrA strain, phage assay for ∆ssrA/pTZ57R (pTZN3) and PA/ pTZ57R (pTZN2) constructs was carried out (Table 4.1). Both lambda and helper pages could not form plaques because in the absence of ssrA gene there is no recycling of the stalled ribosome. A likely explanation of tmRNA in supporting λ and helper phage growth is that the trans-translation provides the opportunity for input from multiple pathways that impact the ability of these viruses to successfully complete DNA replication. Observations argue for a mode of SsrA functioning related to lambda physiology speculated similar to that proposed by Withey and Friedman, (1999) who proposed that tmRNA acts either directly or indirectly to facilitate removal of Cl protein from its DNA target site. The l0Sa RNA is important for λimmP22 growth apparently only in the presence of what appears to be a maximally effective CI protein. It has been proposed that SsrA RNA also binds the regulatory proteins in vivo, reducing their free concentrations and thereby diminishing their biological activities. This speculation was further supported by regulatory activities of proteins such as P22 C1, Lac repressor, LexA repressor and λCI repressor which are increased in SsrA-defective cells (Retallack et al., 1994; Retallack & Friedman, 1995). The cI gene is transcribed from its own promoter and encodes a repressor protein of 236 amino acids which binds to OR, preventing transcription of cro but
- 144-
Chapter Four
Results & Discussion
allowing transcription of cI, and to OL, preventing transcription of N and the other genes at the left-hand end of the genome (Cann, 2005). Another possibility is the indirect action of SsrA on reducing expression of CII repressor protein through CI. CII protein causes a delay of lytic growth. Most evident is the delay of late gene products, although inhibition of DNA replication can also be observed (Friedman et al., 1984). The Cl protein binds to the λ PRE promoter and activates transcription of the cII gene (Retallack et al., 1994). One important role for CI is the initiation of transcription of cII (Court et al., 2007). The P22 PRE promoter, which overlaps the 5' end of the cI gene, has an unusual – 35 region consisting of the interrupted approximate direct repeat 5'TTGCGAGTGCTTGT (the nucleotides of the approximate direct repeat are underlined). A similar motif is found at the analogous PRE promoter of λ. Binding of the P22 Cl and λ CI proteins to their cognate PRE -35 sequences activates transcription of their associated repressor genes (Retallack et al., 1994). This explanation was particularly consistent with the results of lambda phage assay because they grew lytically. The decision between lytic and lysogenic growth following infection is essence determined by whether or not enough CI repressor gets made fast enough to clamp down on expression of the genes required for lytic growth before the lytic cycle is irreversibly established. If SsrA RNA is acting directly on DNA replication, it likely to affect an unidentified factors or any of the events known to be required for DNA replication in ExAssist helper phage, including replicase protein, assembly and activity of DNA polymerase. It is also possible that SsrA does not act directly, but the absence of SsrA activity results in a stress that prevents phage growth. This stress can be due to the accumulation of stalled ribosomes. Withey and Friedman, (2003) proposed that analyses of the tmRNA requirements for phages other than λimmP22, - 145-
Chapter Four
Results & Discussion
including¸ λ21, λimm21, and Mu, which are dependent on tmRNA activity for growth under certain conditions. They have similarly shown that tmRNA charging, but not tmRNA-directed proteolysis, is the critical function of trans-translation. Clearly, further work is required to distinguish among these possibilities. In addition to lambda and helper phages, coliphages were also used to assess the role of tmRNA in phage growth support. Therefore, coliphages have been isolated from sewage water. Coliphages are viruses that infect E. coli and are indicators of fecal contamination (Ewertt & Paynter, 1980; Sobsey et al., 1995; Sobsey et al., 2004). Based on the obtained results, the role of tmRNA is proposed to be required for supporting growth of coliphages in sewage water (Figure 4.21).
A
B
Figure (4.21): Plaque assay for coliphage isolated from sewage water using E coli MG1655 as a wild-type (A) resulting in the formation of plaques whereas using E coli MG1655/ ∆ssrA (B) didn’t. 4.8. Total RNA isolation and reverse transcription To identify ligated protein A gene and expression profiling of the mutated tmRNA constructs, reverse transcriptase polymerase chain reaction (RT PCR) was performed. This technique has become one of the most widely applied techniques in biomedical research and allows to estimate and detect even very low-abundance - 146-
Chapter Four
Results & Discussion
messages (O’Connell, 2002). Total RNA was routinely used as the template for RT-PCR (Figure 4.22). For obtaining high quality, intact RNA, a non-phenol-based method was the method of choice, based on the ability of glass fiber filters to bind nucleic acids in the presence of chaotropic salts like guanidium (Gerstein, 2001). In order to apply PCR methodology to the study of RNA, the RNA sample must first be reverse-transcribed to cDNA to provide the necessary DNA template for the thermostable polymerase (Figure 4.23). The cDNA synthesis can be primed by asynthetic antisense oligonucleotides (reverse primer of protein A) that hybridize specifically to a chosen region in a particular target RNA. 4.9. Chopping of protein A gene To demonstrate which length of protein A is critical for both tmRNA binding to the ribosome and resumption of translation by bacteriophage assay and in vitro assay, protein A gene was chopped by primers-based deletion. Therefore, a series of primers were designed. So that, a small deletion of a few base-pairs (bp) was created in the target DNA sequence. This enabled sequential deletion, 8, 16, 24, 32 amino acids, from each target (NF8, NF9, NF10, NF11) with two different termination codon UAA and UGA (Figure 4.24-25).
- 147-
Chapter Four
Results & Discussion 1 NF1
3 NF3
2 NF2
4 NF4
6 NF7
5 NF5
23S 16S
5S
A 1 NF8
2 NF9
3 NF10
4 NF11
23S
1 pTZN1
2 pTZN2
16S
5S B
C
Figure (4.22): Total RNA isolation (A: Lanes 1-6): total RNA isolation from E coli carrying NF1, NF2, NF3, NF4, NF5, NF7 constructs respectively. (B: Lanes 1-4): total RNA isolation from E coli carrying NF8, NF9, NF10, NF11 costructs respectively. (C: lanes 1 and 2) represent RNA isolation from E coli carrying pTZN1 and pTZN2 plasmid respectively.
- 148-
Chapter Four
Results & Discussion
Figure (2.23): cDNA PCR amplification of the tmRNA transcripts from the strains using primer pair (OP-1F, OP-1R). Lane M1: 1Kb DNA ladder Lane M2: 100bp DNA ladder Lanes 1-8,10, and 11 represent cDNA PCR amplification of the tmRNA transcript from E. coli carrying NF2, NF4, NF8, NF11, NF1, NF3, NF5, NF7, NF9, NF10 constructs respectively. Lanes 9 represent cDNA PCR amplification of the tmRNA transcript from E. coli carrying pTZN1 construct as a positive and lane 12 represent a negative control (E coli MG1655/ ∆ssrA).
- 149-
Chapter Four
Results & Discussion
Figure (4.24): Colony PCR for chopping of a fragment encoding domain one of the D
protein A in constructs (NF8, NF9, NF10, NF11) by using primers with either UAA or UGA stop codon. (A) PCR based deletion of 24 bp encoding 8 amino acids from NF8 (Lanes 1 and 5), NF9 (Lanes 2 and 6), NF9 (Lanes 3and 7), and NF11 (Lanes 4 and 8). Lane M: 1Kb DNA ladder (B) PCR based deletion of 48 bp encoding 16 amino acids from NF8 (Lanes 1 and 5), NF9 (Lanes 2 and 6), NF9 (Lanes 3and 7), and NF11 (Lanes 4 and 8). Lane M: 1Kb DNA ladder (C) PCR based deletion of 72 bp encoding 24 amino acids from NF8 (Lanes 1 and 5), NF9 (Lanes 2 and 6), NF9 (Lanes 3and 7), and NF11 (Lanes 4 and 8). Lane M: 1Kb DNA ladder (D) PCR based deletion of a 96 bp encoding 32 amino acids from NF8 (Lanes 1 and 5), NF9 (Lanes 2 and 6), NF9 (Lanes 3and 7), and NF11 (Lanes 4 and 8). Lane M: 1Kb DNA ladder - 150-
Chapter Four
Results & Discussion
M
C
1
2
3
4
Figure (4.25): Colony PCR amplification of protein A (domain one) after chopping Lane M: 100 bp DNA ladder Colony PCR amplification of the fragment encoding protein A (domain one) after chopping generating 161bp, 137bp, 113bp, 89bp, after deletion of 24 bp (Lane 1), 48 pb (Lane 2), 72 bp (Lane 3), 96 bp (Lane 4) respectively .Lane C represent protein A (domain one) (185 bp as control)
To determine the state of expression in mutated strains and to study the phages genes concerning their requirement for ssrA RNA, SDS-PAGE was performed for the proteins which were extracted from mutant strains before and after infection with bacteriophage. Unfortunately, due to technical issues, proteins were not quite separated.
- 151-
Conclusions & Recommendations
CONCLUSIONS: In conclusion, a large body of evidence from our current work supports our claim that: - Like for lambda immp22, tmRNA supports the growth of both lambda and helper phages. - The tmRNA parts, PK1, PK2-PK4, and MLD play an important role in the structural stability of tmRNA but not in tagging process and ribosomal cycling. - Generally, tmRNA with UGA stop codon supports phage growth more efficiently than with UAA stop codon. - Supporting phage growth is independent of translating the tmRNA resume codon in its open reading frame. - TLD was the essential part of tmRNA in supporting phage growth whereas resume codon, -1 triplet and PK1 were not.
- 152-
Conclusions & Recommendations
RECOMMENDATIONS: From the present work, the followings are recommended: - Monitoring tagging activity of mutant tmRNAs in vivo and in vitro using SDS-polyacrylamide gels followed by Western blotting. - It is necessary to determine whether mutant tmRNAs are stably expressed using Northern blot analysis - It is recommended to study the precise molecular mechanisms of how the ribosome chooses the proper codon to resume translation on tmRNA in the absence of PK1, -1 triplet, and MLD, PK2-PK4 concerning supporting lambda helper phages growth. - Investigating the role of host ssrA gene on RNA phage growth. - Studying protein profile of the host with mutated-tmRNA before and after lambda or helper phage infection and determining the role of phage proteins as well. - It is recommended to explore why ribosome recycling is essential for phage growth but degradation of tmRNA-tagged proteins is not essential. - Using proteomic approaches to study the chromosomal and phage proteins that may interact with the trans-translation during the bacteriophage infection.
- 153-
References
REFERENCES -
Abdulkarim, F.; Liligas M. L.; Hughes, D., (1994). Mutation to Kirromycin resistance occurs in the interface of domain I and III of EF-Tu. GTP. FEBS Lett. 352:118-122.
-
Abo, T.; Inada, T.; Ogawa, K.; Aiba, H., (2000). SsrA-mediated tagging and proteolysis of LacI and its role in the regulation of lac operon. EMBO J. 19, 3762–3769.
-
Ackers, G. K.; Johnsontt, A. D.; Shea, M. A., (1982). Quantitative model for gene regulation by λ phage repressor (gene regulation/repressors and operators/cooperative interaction/thermodynamic model). NatL Acad. Sci. 79: 1129-1133.
-
Agrawal, R. K.; Sharma, M. R.; Kiel, M. C.; Hirokawa G.; Booth, T. M.; Spahn, C. M. T.; Grassucci, R. A.; Kaji, A.; Frank, J.,(2004). Visualization of ribosome-recycling factor on the Escherichia coli 70S ribosome: Functional implications. Proc Natl Acad Sci. 101(24): 8900–8905.
-
Agrawal, S., (2008). Techniques in Molecular Biology. International Book. ISBN : 81-8189-152-X
-
Alexander, S. T.; Strete, D.; Niles, M. J., (2004). Laboratory Exercises in Organismal
and
Molecular
Microbiology.
Cold
spring
harbor
Laboratory press. -
Andersen, E. S.; Rosenblad, M. A.; Larsen, N.; Westergaard, J. C.; Burks, J.; Wower, I. K.; Wower, J.; Gorodkin, J.; Samuelsson, T.; Zwieb, C., (2006) .The tmRDB and SRPDB resources. Nucleic Acids Res. 34:163– 168. - 154-
References
-
Asano, K.; Kurita, D.; Takada, K.; Konno, T.; Muto, A.; Himeno, H., (2005).Competition between trans-translation and termination or elongation of translation. Nucleic Acids Research, 33(17): 5544–5552.
-
Ausubel, F. M.; Brent, R.; Kingston, R. E.; Moore, D. D.; Smith, J. A.; Seidman, J. D.; Struhl, K.,(1987).current protocols in molecular biology.John wiley and sons. Inc, New York.
-
Ball, C. A.; Johnson, R. C., (1991). Efficient Excision of Phage from the Escherichia coli Chromosome Requires the Fis Protein. Journal of Bacteriology,173(13: 4027-4031).
-
Bandyopadhyay, K.; Parua, P. K.; Datta, A. B.; Parrack, P., (2010). Escherichia coli HflK and HflC can individually inhibit the HflB (FtsH)-mediated proteolysis of lambdaCII in vitro. Arch Biochem Biophys. 15;501 (2):239-43.
-
Banuett, F.; Hoyt, M. A.; McFarlane, L.; Echols, H.; Herskowitz, I., (1986). hflB, a new Escherichia coli locus regulating lysogeny and the level of bacteriophage lambda cII protein. J. Mol. Biol. 187:213–224.
-
Barends, S.; Bjork, K.; Gultyaev, A. P.; de Smita, M. H.; Pleija, C. W. A.; Kraal, B.,(2002). Functional evidence for D- and T-loop interactions in tmRNA. FEBS Letts. 514:78-83.
-
Barends, S.; Wower, J.; Kraal, B., (2000). Kinetic Parameters for tmRNA Binding to Alanyl-tRNA Synthetase and Elongation Factor Tu from Escherichia coli. Biochemistry, 39 (10), 2652-2658.
-
Bartlett, J. M. S.; Stirling, D., (2003).PCR protocols. Human press.2nd edition; (226). - 155-
References
-
Becker, A.; Murialdo, H., (1990). Bacteriophage λ DNA: the Beginning of the End . Journal of Bacteriology, 172(6): 2819-2824.
-
Berg, J. M.; Tymoczko, J. L.; Stryer, L., (2002). Biochemistry. 5th edition.
-
Birge, Edward A., (2006). Bacterial and Bacteriophage. Genetics. 5th edition.
-
Björnsson, A.; Mottagui-Tabar, S.; Issaksson, L. A.,(1997). The analysis of translational activity using a reporter gene constructed from repeats of an antibody-binding domain from protein A. Ph.D thesis. Stockholm Universty.
-
Bloor, A. E.; Cranenburgh, R. M., (2006). An Efficient Method of Selectable Marker Gene Excision by Xer Recombination for Gene Replacement in Bacterial Chromosomes. Applied and Environmental Microbiology, 72(4):2520-2525.
-
Bohn, C.; Binet, E.; Bouloe, P., (2002). Screening for stabilization of proteins with a trans-translation signature in Escherichia coli selects for inactivation of the CIpXP protease. Mol. Genet. Genomics. 266:827-831.
-
Burks, J.; Zwieb, C.; Müller, F.; Wower, I.; Wower, J., (2005). Comparative 3-D Modeling of tmRNA. BMC Molecular Biology, 6:14 (10.1186/14712199-6-14)
-
Burton, R.; Baker, T. A.; Sauer, R. T., (2003). Energy-dependent degradation: Linkage between ClpX-catalyzed nucleotide hydrolysis and proteinsubstrate processing. Protein Science 12: 893–902.
-
Calendar, Richard. (2006). Bacteriophages. 2nd edition.
-
Cann, Alan J., (2005). Principles of Molecular Virology. 4th edition. Elsevier Inc.
- 156-
References
-
Carpousis, A. J., (2002). The Escherichia coli RNA degradosome: structure, function and relationship in other ribonucleolytic multienzyme complexes. Biochem. Soc.Trans. 30:150–55.
-
Casali, N.; Preston, A., (2003). E coli plasmid vector/Method and application. Human Press; 235.
-
Chen, B.; Janes, H. W., (2002). PCR Cloning protocols. Human press Inc.2nd edition (192).
-
Chibani-Chennoufi, S.; Bruttin, A.; Dillmann, M.; Brüssow, H., (2004). PhageHost Interaction: an Ecological Perspective. Journal of bacteriology. 186(12): 3677–3686.
-
Choy, J. S.; Aung, L. L.; Karzai, A.W., (2007). Lon Protease Degrades Transfer-Messenger RNA-Tagged Proteins. Journal of Bacteriology, 189(18): 6564–6571).
-
Clark, J. M., (1988) Novel non-template nucleotide addition reactions catalyzed by
prokaryotic and eucaryotic DNA polymerases. Nucleic Acids Res.
16, 9677–9686. -
Clokie, M. R. J.; Kropinski, A. M., (2009).Bacteriophages method and protocols. Human press. 2nd volume.
-
Court, D L., Oppenheim A. B., Adhya S. L., (2007). A New Look at Bacteriophage λ Genetic Networks. Journal of Bacteriology, 189(2): 298–304.
-
Court, D. L.; Patterson, T. A.; Baker, T.; Costantino, N.; Mao, X.; Friedman, D. I.,
(1995).
Structural
and
- 157-
functional
analyses
of
the
References
transcriptiontranslation proteins NusB and NusE. J. Bacteriol. 177:2589–2591. -
Cowell, I. G.; Austin, C. A., (1997). cDNA library protocol. Science, 53-55.
-
Crandall, J.; Rodriguez-Lopez, M.; Pfeiffer, M.; Mortensen, B.; Buskirk, A., (2010). rRNA mutations that inhibit transfer-messenger RNA activity on stalled ribosomes. J. Bacteriol. 192(2):553-9
-
Datta, I.; Sau, S.; Sil, A. K.; Mandal, N. C., (2005). The bacteriophage lambda DNA replication protein P inhibits the oriC DNA- and ATP-binding functions of the DNA replication initiator protein DnaA of Escherichia coli. J. Biochem. Mol. Biol. 31; 38 (1):97-103.
-
de la Cruz, J.; Vioque, A., (2001). Increased sensitivity to protein synthesis inhibitors in cells lacking tmRNA. RNA. 7:1708–1716.
-
Death, A.; Notley, L.; Ferenci, T., (1993). Derepression of LamB protein facilitates
outer
membrane
permeation
of
carbohydrates
into
Escherichia coli under conditions of nutrient stress. J. Bacteriol. 175 (5):1475-83. -
Dewey, J. S.; Savva, C. G.; White, R. L.; Vitha, S.; Holzenburg, A.; Young, R., (2010). Micron-scale holes terminate the phage infection cycle. Proc. Natl. Acad. Sci. U S A. 2;107 (5):2219-23.
-
Dodd, I. B.; Shearwin, K. E.; Perkins, A. J.; Burr, T.; Hochschild, A.; Egan, J. B., (2004). Cooperativity in long-range gene regulation by the λ CI repressor. Genes Dev. 18:344–354.
- 158-
References
-
Dodd, I. B.; Perkins, A. J.; Tsemitsidis, D.; Egan, J. B.,(2001). Octamerization of λ CI repressor is needed for effective repression of P(RM) and efficient switching from lysogeny. Genes Dev. 15:3013–3022.
-
Dodson, M.; Echols, H.; Wicknert, S.; Alfanot, C.; Mensa-wilmott, K.; Gomes, B.; Lebowitzt, J.; Robertso, J. D.; Mcmackent, R., (1986). Specialized nucleoprotein structures at the origin of replication of bacteriophage λ: Localized unwinding of duplex DNA by a six-protein reaction (initiation
of
DNA
replication/DNA-protein
interaction/electron
microscopy. Proc. Nati. Acad. Sci. USA. 83:7638-7642. -
Dougan, D. A.; Weber-Ban, E.; Bukau, B., (2003).Targeted delivery of an ssrA tagged substrate by the adaptor protein SspB to its cognate AAA+ protein ClpX. Mol. Cell. 12 (2): 37380.
-
Drider, D.; DiChiara, J. M.; Wei, J.; Sharp, J. S.; Bechhofer, D. H., (2002). Endonuclease cleavage of messenger RNA in Bacillus subtilis. Mol. Microbiol. 43: 1319–1329.
-
Dulbecco, R.; Vogt, M., (1953). Some problems of animal virology as studied by the plaque technique. Cold Spring Harbor Symp. Quant. Biol. 18: 273279.
-
Dulebohn, D. P.; Cho, H. J.; Karzai, A. W., (2006). Role of Conserved Surface Amino Acids in Binding of SmpB Protein to SsrA RNA. Journal of biological chemistry. 281(39): 28536–28545.
-
Dulebohn, D.; Choy, J.; Sundermeier, T.; Okan, N.; Karzai, A. W., (2007).TransTranslation: The tmRNA-Mediated Surveillance Mechanism for Ribosome Rescue, Directed Protein Degradation, and Nonstop mRNA Decay. Biochemistry, 46(16) - 159-
References
-
Emmerson, J., R.; Gally, D. L.; Roe, A. J., (2006). Generation of gene deletions and gene replacements in Escherichia coli O157:H7 using a temperature sensitive allelic exchange system. PMC .8: 153–162.
-
Ewertt, D.; Paynter, M. J. B., (1980). Enumeration of Bacteriophages and Host Bacteria in Sewage and the Activated-Sludge Treatment Process. Applied and Environmental Microbiology, 39(3:576-583).
-
Farrell, C. M.; Baker, T. A.; Sauer, R. T., (2007). Altered specificity of a AAA+ protease. Mol. Cell. 25(1): 161–166.
-
Felden, B.; Hanawa, K.; Atkins, J. F.; Himeno, H.; Muto, A.; Gesteland, R. F.; McCloskey J. A.; Crain, P. F.,(1998). Presence and location of modified nucleotides in Escherichia coli tmRNA: structural mimicry with tRNA acceptor branches. EMBO. 17(11): 3188–3196.
-
Felden, B.; Himeno, H.; Muto, A.; Atkins, J. F.; Gesteland, R. F.,(1996). Structural organization of Escherichia coli tmRNA. Biochimie. 78: 979–983.
-
Felden, B.; Massire, M.; Westhof, E.; Atkins, J. F.; Gesteland, R. G.,(2001). Phylogenetic analysis of tmRNA genes within a bacterial subgroup reveals a specific structural signature. Nucleic Acids Research, 29(7): 1602-1607.
-
Felden,B.; Himeno, H.; Muto, A.; McCutcheon, J. P.; Atkins, J. F.; Gesteland, R. F.,(1997). Probing the structure of the Escherichia coli 10Sa RNA (tmRNA). RNA. (3): 89-103.
-
Flynn, J. M.; Levchenko, I.; Sauer, R. T.; Baker, T. A., (2004). Modulating substrate choice: the SspB adaptor delivers a regulator of the - 160-
References
extracytoplasmic-stress response to the AAA+ protease ClpXP for degradation. Gene and Development, 18: 2292-2301. -
Fogg, P. C. M.; Allison , H. E.; Saunders, J. R.; McCarthy , A. J.,(2010). Bacteriophage Lambda: a Paradigm Revisited. 48(13: 6876-6879).
-
Friedman, D. I.; Court, D. L., (2001). Bacteriophage lambda: alive and well and still doing its thing. Curr. Opin. Microbiol. 4:201–207.
-
Friedman, D. I.; Olson, E. R.; Georgopoulos, C.; Tilly, K.; Herskowitz, I.; Banuett,
F.;
(1984).
Interactions
of Bacteriophage
and
Host
Macromolecules in the Growth of Bacteriophage λ . American Society for Microbiology, 48(4):299-325. -
Fujihara, A.; Tomatsu, H.; Inagaki, S.; Tadaki, T.; Ushida, C.; Himeno, H.; Muto, A., (2002). Detection of tmRNA-mediated trans–translation products in Bacillus subtilis. Genes to Cells, 7, 343–350.
-
Gabig, M.; Obuchowski, M.; Wegrzyn, A.; Szalewska-Pałasz, A.; Thomas, M. S.; Wegrzyn, G., (1998). Excess production of phage lambda delayed early proteins under conditions supporting high Escherichia coli growth rates. Microbiology, 144 (Pt 8):2217-24.
-
Gaudin, C.; Zhou, X.; Williams, K. P.; Felden, B.,(2002).Two-piece tmRNA in cyanobacteria and its structural analysis. Nucleic Acids Res. 30:2018–24.
-
Gaytan, p.; yanez, J.; grande, R.; Morett, E.; Soberon, X.,(2005). Improving random mutagenesis by purification of the oligonucleotide variants. Combinational Chemistry and High Throughput Screening, 8(6: 537544).
- 161-
References
-
Gerstein, A. S.,(2001). Molecular Biology Problem Solver: A Laboratory Guide. Wiley-Liss, Inc. 0-471-37972-7.
-
Gillet, R.; Felden, B.,(2001). Transfer RNAAla recognizes transfer-messenger RNA with specificity; a functional complex prior to entering the ribosome?. EMBO. 20(11):2966-2976.
-
Glinkowska, M.; Wegrzyn, A.; Wegrzyn, G., (1999). Replication of bacteriophage lambda in the Escherichia coli dnaA Deltarac hosts. Genetics, 151(4):1633-4.
-
Gottesman, M. E.; yarmonlisky, M. B.,(1968). The Integration and Excision of the
Bacteriophage Lambda Genome. Cold Spring Harb. Symp. Quant. Biol. 33: 735-747. -
Gottesman, S.; Roche, E.; Zhou,Y.; Sauer, R.T., (1998). The ClpXP and ClpAP proteases degrade proteins with carboxy-terminal peptide tails added by the SsrA-tagging system. Gene and Development, (12):1338–1347.
-
Green, R.; Noller, H. F., (1997). Ribosomes and translation. Annu. Rev. Biochem. 66, 679–716.
-
Griffiths, A. J. F.; Miller, J. H.; Suzuki, D. T.; Lewontin, R. C.; Gelbart. W. M., (2000). An Introduction to Genetic Analysis. 7th Edition. New York: W. H. Freeman.
-
Gualerzi, C. O.; Pon, C. L., (1990). Initiation of mRNA translation in prokaryotes. Biochem. 29, 5881–5889.
-
Gur, E.; Sauer, R. T., (2008). Evolution of the ssrA degradation tag in Mycoplasma: Specificity switch to a different protease. PNAS. 105(42): 16113–16118. - 162-
References
-
Gutman, B. S.; Kutter, E. M., (2002). Bacteriophage genetics. Modern molecular genetics. 2th edition.
-
Gutmann, S. M., (2004). Structure of the transfer-RNA Domain of tmRNA in complex with SmpB. Ph. D. Thesis, Swiss Federal Institute of Technology Zurich. Ramalinsburg BL-Switzerland.
-
Gutmann, S.; Haebel, P. W.; Metzinger, L.; Sutter, M.; Felden, B.; Ban, N., (2003) Crystal structure of the transfer-RNA domain of transfermessenger RNA in complex with SmpB. Nature, 424, 5503–5509.
-
Hallier, M.; Ivanova, N.; Rametti, A.; Pavlov, M.; Ehrenberg, M.; Felden, B., (2004) Pre-binding of small protein B to a stalled ribosome triggers trans-translation. J. Biol. Chem. 279, 25978–25985.
-
Hamilton, C. M.; Aldea, M.; Washburn, B. K.; Babitzke, P.; Kushner, S. R., (1989). New method for generating deletions and gene replacements in Escherichia coli. J. Bacteriol. 171:4617–4622.
-
Hanawa-Suetsugu, K.; Bordeau,V.; Himeno, H.; Muto, A.; Felden, B., (2001). Importance of the conserved nucleotides around the tRNA-like structure of Escherichia coli transfer-messenger RNA for protein tagging. Nucleic Acids Res. 29:4663–73.
-
Hatfull, G. F.; Pedulla, M. L.; Jacobs-Sera, D.; Cichon, P. M.; Foley, A.; Ford, M. E.; Gonda, R. M.; Houtz, J. M.; Hryckowian, A. J.; Kelchner, V. A.; Namburi, S.; Pajcini, K . V.; Popovich, M. G.; Schleicher, D. T.; Simanek, B. Z.; Smith, A. L.; Zdanowicz, G. M.; Kumar, V.; Peebles, C. L.; Jacobs, W. R; Lawrence, J. G.; Hendrix, R. W., (2006). Exploring the Mycobacteriophage Metaproteome: Phage Genomics as an
- 163-
References
Educational
Platform.
PloSGenet.
2(6):e92.doi:10.1371/journal.pgen.0020092. -
Hayes, C. S; Bose, B.; Sauer, R. T., (2002). Proline Residues at the C Terminus of Nascent Chains Induce SsrA Tagging during Translation Termination. Journal of Biological Chemistry, 37(227:33825-33832).
-
Hendrix, R. W.; Duda, R. L., (1992). Bacteriophage lambda PaPa: not the mother of all lambda phages. Science. 13; 258 (5085):1145-8.
-
Hendrix, Roger W., (2002). Bacteriophage lambda and its relatives. Modern Microbial Genetics. 2th edition.
-
Herskowitz, I.; Hagen, D., (1980). The lysis-lysogeny decision of phage λ explicit programming and responsiveness. Annu. Rev. Genet. 14:399– 445.
-
Hochschild, A.; Lewis, M., (2009). The bacteriophage λ CI protein finds an asymmetric solution. Curr. Opin. Struct. Biol. 19(1): 79–86.
-
Hong, S.; Lessner, F. H.; Mahen, E. M.; Keiler, K. C.,(2007).Proteomic identification of tmRNA substrates. PNAS. 104(43): 17128–17133.
-
Hoopes, B. C.; McClure, W. R., (1985). A cII-dependent promoter is located within the Q. gene of bacteriophage λ. Proc. Natl. Acad. Sci. USA. 82:3134–3138.
-
Hoyt, M. A.; Knight, D. M.; Das, A.; Miller, H. I.; Echols, H., (1982). Control of phage λ development by stability and synthesis of cII protein: role of the viral cIII and host hflA, himA and himD genes. Cell, 31:565–573.
- 164-
References
-
Huang, C.; Wolfgang, M. C.; Withey, J.; Koomey, M.; Friedman D I.(2000).Charged tmRNA but not tmRNA-mediated proteolysis is essential for Neisseria gonorrhoeae viability. EMBO J. 19(5):1098-1107.
-
Ivanova, N., (2005). Finding the unknown in trans-translation. Ph. D. Thesis, Uppsala University. Uppsala- Sweden.
-
Ivanova, N.; Pavlov, M. Y.; Bouakaz, E.; Ehrenberg, M.; Schiavone, L. H.,(2005). Mapping the interaction of SmpB with ribosomes by footprinting of ribosomal RNA. Nucleic Acids Research, 33(11): 3529– 3539.
-
Ivanova, P. V.; Zvereva, M. I.; Shpanchenko, O. V.; Dontsova, O. A.; Bogdanov, A.A.; Aglyamova, G. V.; Lim, V. I.; Teraoka, Y.; Nierhaus, K.H., (2002).How does tmRNA move through the ribosome?. FEBS Lett. 514:55–59.
-
Jacob, Y.; Seif, E.; paquet, P.; lang, B. F., (2004). Loss of the mRNA-like region in mitochondrial tmRNAs of jakobids. RNA. 10:605–614.
-
Janosi, L.; Shimizu, I; Kajit, A., (1994). Ribosome recycling factor (ribosome releasing factor) is essential for bacterial growth. Proc. Natl. Acad. Sci. (91):4249-4253.
-
Johnson, A. D.; Pabo, C. O.; Sauer, R. T., (1980). Bacteriophage λ repressor and cro protein: interactions with operator DNA. Methods Enzymol. 65: 839–856.
-
Julio, S. M.; Heithoff, D. M.; Mahan, M. J., (2000). ssrA (tmRNA) Plays a Role in Salmonella enterica Serovar Typhimurium Pathogenesis. 6(182): 1558–1563. - 165-
References
-
Kaplinski, L.; Scheler, O.; Parkel, S.; Palta, P.; Toome, K.; Kurg, A.; Remm, M., (2010). Detection of tmRNA molecules on microarrays at low temperatures using helper oligonucleotides. BMC Biotechnology, 10(34):1472-6750.
-
Karlsson, F.; Malmborg-Hager, A.; Albrekt, A.; Borrebaeck, C. A. K., (2005). Genome-wide comparison of phage M13-infected vs. uninfected Escherichia coli . J. Microbiol. 51: 29–35.
-
Karzai, A. W.; Roche, E. D.; Sauer, R. T., (2000). The SsrA–SmpB system for protein tagging, directed degradation and ribosome rescue. Nature Structural Biology, (7) 449 – 455.
-
Karzai, W. A.; Susskind, M. M.; Sauer, R. T., (1999). SmpB, a unique RNAbinding protein essential for the peptide-tagging activity of SsrA (tmRNA). EMBO J. 18(13): 3793–3799.
-
Keiler K. C., Shapiro, L; Williams, K. P., (2000). tmRNAs that encode proteolysis-inducing tags are found in all known bacterial genomes: A two-piece tmRNA functions in Caulobacter. Proc. Natl. Acad. Sci. USA 97:7778–83.
-
Keiler, K.C., (2008). Biology of trans-translation. Annu. Rev. Microbiol. 62:13351.
-
Keiler, K.C.; Waller, P. R. H.; Sauer, R. T., (1996). Role of peptide tagging system in degradation of protein synthesized from messenger RNA. Science, 271, 990–993.
- 166-
References
-
Kelley, S. T.; Harris, J. K; Pace, N. R., (2001). Evaluation and refinement of tmRNA structure using gene sequences from natural microbial communities. RNA. (7): 1310-1316.
-
Khudyakov, Y. E.; Fields, H. A., (2003). Artificial DNA methods and applications. CRC press.
-
Kobiler, O.; Rokney, A.; Friedman, N.; Court, D. L.; Stavans, J.; Oppenheim, A. B.,(2005). Quantitative kinetic analysis of the bacteriophage λ genetic network. Proc. Natl. Acad. Sci. USA. 102:5310–5311.
-
Komine, Y.; Kitabatake, M.; Inokuchi, H., (1996). l0 Sa RNA is associated with 70S ribosome particles in Escherichia coli. J. Biochem. 119(3):4634670.
-
Komine, Y.; Kitabatake, M.; Yokogawa, T.; Nishikawa, K.; Inokuchi, H., (1994). A tRNA like structure is present in 10Sa RNA, a small stable RNA from Escherichia coli. Proc. Natl. Acad. Sci. USA. 91:9223–9227.
-
Komine, Y; Inokuchi, H., (1991). Physical map locations of the genes that encode small stable RNAs in Escherichia coli. J. Bacteriol.173:5252.
-
Konno, T.; Takahashi, T.; Kurita, D.; Muto, A.; Himeno, H., (2004). A minimum structure of aminoglycosides that causes an initiation shift of transtranslation. Nucleic Acids Research, 32(14): 4119–4126.
-
Koolman, J.; Roehm, K. H.;(2005). Color Atlas of Biochemistry. 2nd edition.
-
Kurita, D.; Konno, T.; Takada, K.; Muto, A.; Himeno, H., (2007b). Molecular mechanism of transtranslation. Nucleic acid symposium, 51:43-44.
- 167-
References
-
Kurita, D.; Sasaki, R.; Muto, A.; Himeno, H., (2007a). Interaction of SmpB with ribosome from directed hydroxyl radical probing. Nucleic acid research, 35(21):7248-7255.
-
Lacks, Sanford A.,(1980). Purification and properties of the complementary endonucleases Dpn I and Dpn II. Methods in Enzymology, 65(1):138146.
-
Landy A.; Ross, W.,(1977). Viral Integration and Excision: Structure of the Lambda att Sites. Science, 197(4309): 1147-1160.
-
Laslett, D.; Canback, B.; Andersson, S.,(2002). BRUCE: a program for the detection of transfer-messenger RNA genes in nucleotide sequences. Nucleic acid research, 30(15):3449-3453.
-
Lee, S.; Ishii, M.; Tadaki, T.; Muto, A.; Himeno, H., (2001). Determinants on tmRNA for initiating efficient and precise trans-translation: Some mutations upstream of the tag-encoding sequence of Escherichia coli tmRNA shift the initiation point of trans-translation in vitro. RNA Society, 7:999–1012.
-
Lessner, F. H.; Venters, B. J.; and Keiler, K. C., (2007). Proteolytic Adaptor for Transfer-Messenger RNA-Tagged Proteins from α-Proteobacteria. Journal of Bacteriology, 189(1:272-275).
-
Levchenko, I.; Seidel, M.; Sauer, R. T.; Baker, T. A., (2000). A specificity enhancing factor for the ClpXP degradation machine. Science, 289:2354–2356.
- 168-
References
-
Li, X.; Hirano, R.; Tagami, H.; Aiba, H.,(2006). Protein tagging at rare codons is caused by tmRNA action at the 3′ end of nonstop mRNA generated in response to ribosome stalling. RNA. (12): 248-255.
-
Lim, V. I.; Garber, M. B., (2005). Analysis of recognition of transfer-messenger RNA by the ribosomal decoding center. J. Mol. Biol. 346:395–398.
-
Lin-Chao, S.; Wei, C.; Lin, Y., (1999). RNase E is required for the maturation of ssrA RNA and normal ssrA RNA peptide-tagging activity. PNAS. 22(96:12406-12411).
-
Link, A. J.; Phillips, D.; Church G. M., (1997). Methods for Generating Precise Deletions and Insertions in the Genome of Wild-Type Escherichia coli: Application to Open Reading Frame Characterization. Journal of Bacteriology, 179(20):6228-6237.
-
Little, J. W., (2006). Gene Regulatory Circuitry of Phage Lambda.
-
Loomis, W. P.; Koo, J. T.; Cheung, T. P.; Moseley, S. L., (2001). A tripeptide sequence within the nascent DaaP protein is required for mRNA processing of a fimbrial operon in Escherichia coli. Mol. Microbiol. 39: 693–707.
-
Lubkowski, J.; Hennecke, F.; Plückthun, A.; Wlodawer, A.,(1999). Filamentous phage infection: crystal structure of g3p in complex with its coreceptor, the C-terminal domain of TolA . Elsevier Science. 7:711–722.
-
Luidalepp, H.; Hallier, M.; Felden, B.; Tenson, T., (2005). tmRNA decreases the bactericidal activity of aminoglycosides and the susceptibility to inhitors of cell wall synthesis. RNA Biology, 2(2):70-74.
- 169-
References
-
Marshall-Batty, K. R.; Nakai, H.,(2003). trans-targeting of the Phage Mu Repressor is Promoted by Conformational Changes That Expose Its ClpX Recognition Determinant. The Journal of Biological Chemistry, 278(3): 1612–1617.
-
Mason, S. W.; Greenblatt, J., (1991). Assembly of transcription elongation complexes containing the N protein of phage λ and the Escherichia coli elongation factors NusA, NusB, NusG, and S10. Genes Dev. 5:1504– 1512.
-
Mathews, C. K.; Van Hold, K. E.; Ahern, K. G., (1999). Biochemistry.3rd edition.
-
Maynard, N. D.; Birch, E. W.; Sanghvi, J. C.; Chen, L.; Gutschow, M. V.; Covert, M. W., (2010). A forward-genetic screen and dynamic analysis of lambda phage host-dependencies reveals an extensive interaction network and a new anti-viral strategy. PLoS Genet. 8; 6(7):e1001017.
-
McGinness, K. E.; Sauer, R. S., (2004). Ribosomal protein S1 binds mRNA and tmRNA similarly but plays distinct roles in translation of these molecules. PNAS. 101(37): 13454–13459.
-
Mehta, P.; Richards, J.; Karzai, A. W., (2006). tmRNA determinants required for facilitating nonstop mRNA decay. RNA. (12):2187–2198.
-
Merlin, C.; McAteer, S.; Masters, M., (2002). Tools for Characterization of Escherichia coli Genes of Unknown Function. Journal of Bacteriology, 184(16): 4573–4581.
-
Metzinger, L.; Hallier, M.; Felden, B., (2005). Independent binding sites of small protein B onto transfer-messenger RNA during trans-translation. 33 (8): 2384–2394. - 170-
References
-
Miller, J. H., (1992). A short course in bacterial genetics. vol (1).
-
Miller, M. R.; Healey, D. H.; Robison, T. G.; Dewey, J .D; Buskirk, A. R., (2008). The role of upstream sequences in selecting the reading frame on tmRNA. BMC Biol. 6:29.
-
Moore, S., D.; Sauer, R. T., (2007). The tmRNA System for Translational Surveillance and Ribosome Rescue. Annu. Rev. Biochem. 76:101–24.
-
Mullen, L. M.; Nair, S. P.; Ward, J. M.; Rycroft, A. N.; Henderson, B.,(2006). Phage display in the study of infectious diseases. TRENDS in Microbiology. 14(3):141-147.
-
Murphy, K. C., (1998). Use of Bacteriophage λ Recombination Functions To Promote Gene Replacement in Escherichia coli. J. Bacteriol. 180(8): 2063–2071.
-
Muto, A.; Ushida, C.; Himeno, H., (1998). A bacterial RNA that functions as both a tRNA an mRNA. Trends Biochem Sci. 23:25–29.
-
Nakamura, Y.; Ito, K.,(1998).How protein reads the stop codon and terminates translation. Genes to Cells, 3(5: 265–278).
-
Nameki, N.; Chattopadhyay, P.; Himeno, H.; Muto, A.; Kawai ,G.,(1999a). An NMR and mutational analysis of an RNA pseudoknot of E. coli tmRNA involved in trans –translation. Nucleic Acids Res. (27): 3667–3675.
-
Nameki, N.; Felden, B.; Atkins, J. F.; Gesteland, R. F.; Himeno, H.; Muto, A.,(1999b). Functional and structural analysis of a pseudoknot upstream of the tag-encoded sequence in E. coli tmRNA. J Mol Biol . 286:733– 744.
- 171-
References
-
Nameki, N.; Tadaki, T.; Muto, A.; Himeno, H., (2000). Three of four pseudoknots in tmRNA are interchangeable and are substitutable with single-stranded RNAs. FEBS Lett. 470:345–349.
-
Nonin-Lecomte, S.; Felden, B.; Dardel, F., (2006). NMR structure of the A. aeolicus tmRNA pseudoknot PK1: new insights into the recoding event of the ribosomal trans-translation. Nucleic Acids Research, 34:18471853.
-
Novoa, P. G.; Williams, K. P., (2004). The tmRNA website: reductive evolution of tmRNA in plastids and other endosymbionts. (32)104-108.
-
O’ Connell, J., (2002). RT-PCR Protocols. Human Press
-
O’Connor, M., (2007). Minimal translation of the tmRNA tag-coding region is required for ribosome release. Elsevier. 357(1):276-281.
-
Ogle, J. M.; Ramakrishnan, V., (2005) Structural insights into translational fidelity. Annu. Rev. Biochem. 74, 129–177
-
Oh, B. K.; Apirion, D., (1991) 10Sa RNA, a small stable RNA of Escherichia coli, is functional. Mol. Gen. Genet. 229, 52–56. Retallack, D.M. & Friedman, D.I. (1995) A role for a small stable RNA in modulating the activity of DNA-binding proteins. Cell, 83, 227–235.
-
Oh, B.; Chauhan, B. K.; Isono, K.; Apirion, D., (1990). Location of a Gene (ssrA) for a Small, Stable RNA (lOSa RNA) in the Escherichia coli Chromosome. Journal of Bacteriology, P: 4708-4709.
-
Okan, N. A.; Bliska, J. B.; Karzai, A. W., (2006). A Role for the SmpB-SsrA system in Yersinia pseudotuberculosis pathogenesis. PLoS Pathog. 2, 50-62. - 172-
References
-
Oppenheim, A. B.; Kobiler, O.; Stavans, J.; Court, D. L., Adhya, S. L., (2005). Switches in bacteriophage λ development. Annu. Rev. Genet. 102:4470– 4475.
-
Osterhout, R. E.; Figueroa, I. A.; Keasling, J.D.; Arkin, A. P., (2007). Global analysis of host response to induction of a latent bacteriophage. BMC Microbiol. 31; 7:82.
-
Panis, G. ; Duverger, Y.; Courvoisier-Dezord, E. ; Champ, S. ; Talla, E. ; Ansaldi, M., (2010). Tight regulation of the intS gene of the KplE1 prophage: a new paradigm for integrase gene regulation. PLoS Genet. 7; 6 (10). pii: e1001149.
-
Pavlov, M. Y.; Antoun, A.;
Lovmar, M.; Ehrenberg, M., (2008).
Complementary roles of initiation factor 1 and ribosome recycling factor in 70S ribosome splitting. EMBO J. 27, 1706 – 1717. -
Pavlov, M. Y.; Freistroffer, D. V., (1997). Fast recycling of Escherichia coli ribosomes requires both ribosome recycling factor (RRF) and release factor RF3. EMBO J. 16 (13: 4134–4141).
-
Pedersen, K.; Zavialov, A.V.; Pavlov, M.Y.; Elf, J.; Gerdes, K.; Ehrenberg, M., (2003). The bacterial toxin RelE displays codon-specific cleavage of mRNAs in the ribosomal A site. Cell, (112): 131–140.
-
Petry, S.; Brodersen, D. E.; IV, F. V. M.; Dunham, C. M.; Selmer, M.; Tarry, M. J .; Kelley, A. C.; Ramakrishnan, V.,(2005). Crystal Structures of the Ribosome in Complex with Release Factors RF1 and RF2 Bound to a Cognate Stop Codon. Cell,123, 1255–1266.
- 173-
References
-
Primrose, S. B.; Twyman, R. M.; Old, R. W., (2001). Principles of Gene Manipulation. Blackwell science. 6th edition.
-
Ptashne, M., (2004). Genetic switch: phage lambda revisited, 2nd edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
-
Ramakrishnan, V., (2002). Ribosome Structure Review and the Mechanism of Translation. Cell press,108:557-572.
-
Ramakrishnan, V.; Moore, P. B., (2001). Atomic structures at last : the ribosome in 2000. Elsevier science.11:144-154.
-
Ranquet, C.; Geiselmann, J.; Toussaint, A., (2001). The tRNA function of SsrA contributes to controlling repression of bacteriophage Mu prophage. PNAS. 98(18): 10220–10225.
-
Ranquet, C.; Gottesman, S., (2007). Translational Regulation of the Escherichia coli Stress Factor RpoS: a Role for SsrA and Lon. Journal of Bacteriology, 13(189): 4872–4879.
-
Ray, B.; Apirion, D., (1979). Characterization of 10S RNA a new stable RNA molecule from Escherichia coli. Mol. Gen.Genet. 174:25-32.
-
Retallack, D. M.; Johnson, L. L.; Friedman, D. I., (1994). Role for 10Sa RNA in the growth of lambda imm P22 hybrid phage. J. Bacteriol. 176, 2082– 2089.
-
Retallack, D. M.; Friedman, D. I., (1995). "A role for a small stable RNA in modulating the activity of DNAbinding proteins. Cell, 83(2): 22735.
-
Rivera, M. J.; Smits, M. A.; Quint, W.; Schoenmakers, J. G. G.; Konings, R. N. H., (1978). Expression of bacteriophage M13 DNA in vivo. Localization of the transcription initiation and termination signal of the - 174-
References
mRNA coding for the major capsid protein. Nucleic Acids Research, 5(8). -
Roberts, J. W., (1993). RNA and protein elements of E. coli and lambda transcription antitermination complexes. Cell, 72:653–655.
-
Roberts, J. W.; Yarnell, W.; Bartlett, B.; Guo, J.; Marr, M.; Ko, D. C.; Sun, H.; Roberts, C. W., (1998). Antitermination by bacteriophage lambda Q protein. Cold Spring Harbor Symp. Quant. Biol. 63:319–325.
-
Roche, E. D.; Sauer, R. S., (2001). Identification of Endogenous SsrA-tagged Proteins Reveals Tagging at Positions Corresponding to Stop Codons. Journal of Biological Chemistry, 276(30): 28509–28515.
-
Roche, E. D.; Sauer, R. T., (1999). SsrA-mediated peptide tagging caused by rare codons and tRNA scarcity. EMBO J.18:4579–4589.
-
Rosenberg, M.; Court, D. L.; Shimatake, H.; Brady, C.; and Wulff, D. L., (1978). The relationship between function and DNA sequence in an intercistronic regulatory region in phage lambda. Nature, 272:414–423.
-
Rosenberg, M.; Court, D., (1979). Regulatory sequences involved
in the
promotion and termination of RNA transcription. Annu. Rev. Genet. 13: 319–353. -
Rudinger-thirion, J.; Giegé, R.; Felden, B., (1999). Aminoacylated tmRNA from Escherichia coli. RNA. (5):989–992.
-
Russel, M.; Kazmierczak, B.,(1993). Analysis of the Structure and Subcellular Location of Filamentous Phage pIV. Journal of Bacteriology, 175(13): 3998-4007.
-
Russet, M., (1991). Filamentous phage assembly. Mol. Microbiol. 5:1607-1613. - 175-
References
-
Saguy, M.; Gillet, R.; Skorski, P.; Denmat, S. H.; Felden, B., (2007). Ribosomal protein S1 influences trans-translation in vitro and in vivo. Nucleic Acid Research. 35(7):2368-2376.
-
Sambrook, J.; Fritch, E. F.;
Maniatis, T., (1989), Molecular Cloning: a
laboratory manual. 2nd edition. Cold spring harbor Laboratory press, NY. -
Schaechter, Moselio., (2004). The Desk Encyclopedia of Micobiology. Elsevier.
-
Schindler, D.; Echols, H., (1981). Retroregulation of the int gene of bacteriophage λ: control of translation completion. Proc. Natl. Acad. Sci. USA. 78:4475–4479.
-
Schmeissner, U.; Court, D.; McKenney, K.; Rosenberg, M., (1981). Positively activated transcription of lambda integrase gene initiates with UTP in vivo. Nature, 292:173–175.
-
Schönhuber1, W; Bourhis, G. L.; Tremblay, J.; Amann, R.; Kulakauskas, S., (2001). Utilization of tmRNA sequences for bacterial identification. BMC Microbiology, 20:1471-1480.
-
Selmer, M.; Dunham, C. M.; IV, F. V. M.; Weixlbaumer, A.; Petry, P.; Kelley, A. C.; Weir, J. R.; Ramakrishnan, V., (2006). Structure of the 70S Ribosome Complexed with mRNA and tRNA. Science, 313(29)
-
Sharkady, S. M.; Williams, K. P.,(2004). A third lineage with two-piece tmRNA. Nucleic Acids Research, 15 (32):161-166.
-
Shimizu, Y.; Ueda, T., (2006). SmpB triggers GTP hydrolysis of elongation factor Tu on ribosomes by compensating for the lack of codonanticodon interaction during trans-translation initiation. J. Biol. Chem. 281:15987–15996. - 176-
References
-
Singh, N. S.; Varshney, U., (2004). A physiological connection between tmRNA and peptidyl-tRNA hydrolase functions in Escherichia coli. Nucleic Acids Res. 32(20): 6028–6037.
-
Skorski, P.; Proux, F.; Cheraiti, C.; Dreyfus, M.; Hermann-Le Denmat, S., (2007). The Deleterious Effect of an Insertion Sequence Removing the Last Twenty Percent of the Essential Escherichia coli rpsA Gene is Due to mRNA Destabilization, not Protein Truncation. Journal of Bacteriology, 189(17: 6205–6212).
-
Sobsey, M. D.; Battigelli, D. A.; Handzel, T. R.; Schwab, K. J., (1995). Malespecific Coliphages as Indicators of Viral Contamination of Drinking Water. American Water Works Association Research Foundation, Denver, Co.
-
Sobsey, M. D.; Yates, M. V.; Hsu, F. C.; Lovelace, G.; Battigelli, D.; Margolin, A.; Pillai, S. D.; Nwachuku, N., (2004). Development and evaluation of methods to detect coliphages in large volumes of water. Water Sci Technol. 50(1):211-7.
-
Staley, J. T.; Gunsalus, R. P.; Lory, S.; Perry, J. J., (2007). Microbial Life. 2nd Edition. 391-395.
-
Stengele, I.; Bross, P.; Garces, X.; Giray, J.; Rasched, I., (1990). Dissection of functional domains in phage fd adsorption protein. Discrimination between attachment and penetration sites. J. Mol. Biol. 212, 143-149.
-
Subbarao, M. N.; Apirion, D.; (1989).Aprecursor for a small stable RNA (10Sa RNA) of Escherichia coli. Mol. Gen. Genet. 217:499–504.
- 177-
References
-
Sundermeier, T. R.; Dulebohn, D. P.; Cho, H. J.; Karzai, A. W., (2005).A previously uncharacterized role for small protein B (SmpB) in transfer messenger RNA-mediated trans-translation. 102(7): 2316–2321.
-
Sundermeier, T. R.; Karzai, A. W., (2007). Functional SmpB-Ribosome Interactions Require tmRNA. Journal of Biological Chemistry, 48(282): 34779–34786).
-
Sunohara, T., Jojima, K., Yamamoto,Y., Inada,T. and Aiba, H.(2004). Nascentpeptide-mediated ribosome stalling at a stop codon induces mRNA cleavage resulting in nonstopmRNA that is recognized by tmRNA. 10:378–386.
-
Svenningsen, S. L.; Costantino, N.; Court, D. L.; Adhya, S., (2005). On the role of Cro in lambda prophage induction. Proc. Natl. Acad. Sci. USA. 102:4465–4469.
-
Takada, K.; Hanawa, K.; Lee, S. G.; Himeno, H.; Muto, A., (2002). The structure and function of tmRNA. Nucleic Acid Research, (2):65-66.
-
Takada,K.;Takemoto,C.;Kawazoe,M.;Konno,T.;Matsuta,N.;Kurita,D.;Asano,K.; Shirouzu,M.;Yokoyama,S.;Mutoa,A.; Hymino, H., (2005) . Fumctional analysis of factors involved in trans-translation. Nucleic Acid Symposium.(49):101-102.
-
Takahashi, T.; Konno, T.; Muto, A.; Himeno, H., (2003) Various effects of paromomycin on tmRNA-directed trans-translation. Journal of Biology Chemistry. 273(30:27672-27680)
- 178-
References
-
Tanner, D. R.; Dewey, J. D.; Miller, M. R.; Buskirk, A. R.,(2006). Genetic Analysis of the Structure and Function of tmRNA Pseudoknot 1. The Journal of Biological Chemistry, 281:10561-10566.
-
Tey, B. T.; Ooi1, S. T.; Yong, K. C.; Ng, M. Y. T.; Ling, T. C.; Tan, W. S., (2009). Production of fusion m13 phage bearing the di-sulphide constrained peptide sequence (C-WSFFSNI-C) that interacts with hepatitis B core antigen. African Journal of Biotechnology, 8 (2): 268273.
-
Tomoyasu, T.; Yamanaka, K.; Murata, K.; Suzaki, T.; Bouloc, P.; Kato, A.; Niki, H.; Hiraga, S.; Ogura, T., (1993). Topology and subcellular localization of FtsH protein in Escherichia coli. J. Bacteriol. 175:1352–1357.
-
Trimble, M. J.; Minnicus,A.; Williams, K. P., (2004). tRNA slippage at the tmRNA resume codon. RNA. (10):805–812.
-
Tu, G.; Reid, G. E.; Zhang, J.; Mortiz, R. L.; Simpson, R. J ., (1995). C-terminal extension of truncated recombinant proteins in Escherichia coli with 10Sa RNA decapeptide. The Journal of Biological Chemistry, 16(270): 9322-9326.
-
Ueda, K.; Yamamoto,Y.; Ogawa, K.; Abo, T.; Inokuchi, H.; Aiba, H.,(2002). Bacterial SsrA system plays a role in coping with unwanted translational read through caused by suppressor tRNAs. Genes to Cells, (7): 509–519.
-
Ushida, C.; Himeno, H.; Watanabe, T.; Muto, A., (1994). tRNA-like structures in 10Sa RNAs of Mycoplasma capricolum and Bacillus subtilis. Nucleic Acids Res. 22:3392–3396.
- 179-
References
-
Valle, M.; Gillet, R.; Kaur, S.; Henne, A.; Ramakrishnan, V.; Frank, J., (2003). Visualizing tmRNA entry into a stalled ribosome. Science, 4(300):12730.
-
Wagner, P. L.; Waldor, K. M., (2002). Bacteriophage Control of Bacterial Virulence. American Society for Microbiology, 70(8): 3985–3993 .
-
Ward, A., (2002). Genomic Imprinting /Methods and Protocols. Humana Press Inc.
-
Watts, T. C., (2008). Genetic analysis of the role of SmpB in determining frame on tmRNA. MSC thesis.
-
Webster, R. E., (1991). The tol gene products and the import of macromolecules into Escherichia coli. Mol. Microbiol. 5, 1005-1011.
-
Weissensteiner, T.; Griffin, H. G.; Griffin, A., (2004). PCR technology current Innovations. CRC Press LLC .
-
Weixlbaumer, A.; Jin, H.; Neubauer, C.; Voorhees, R. M.; Petry, S.; Kelley, A. C.; Ramakrishnan,V., (2008). Insights into Translational Termination from the Structure of RF2 Bound to the Ribosome. Science, 322(7).
-
Wheeler, D.; Church, D.; Federhen, S.; Lash, A.; Madden, T.; Pontius, J.; Schuler, G.; Schriml, L.; Sequeira, E.; Tatusova, T. and Wagner, L., (2003). Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 31(1):28-33.
-
Williams, K. P.; Martindalea, K. A.; Bartel, D. B., (1999). Resuming translation on tmRNA: a unique mode of determining a reading frame. EMBO. (18):5423-5433.
- 180-
References
-
Williams, M. D.; Ouyang, T. X.; Flickinger, M. C., (1994). "Starvation induced expression of SspA and SspB: the effects of a null mutation in sspA on Escherichia coli protein synthesis and survival during growth and prolonged starvation. Mol. Microbiol. 11(6): 102943.
-
Withey, J. H.; Friedman, D. I.,(2003). A salvage pathway for protein synthesis: tmrna and trans-translation. Annu. Rev. Microbiol. 57:101–23.
-
Withey, J.; Friedman, D., (1999). Analysis of the Role of trans-Translation in the Requirement of tmRNA for λimmP22 Growth in Escherichia coli. Journal of Bacteriology, 181(7): 2148–2157.
-
Womble, D., (2000). "GCG: The Wisconsin Package of sequence analysis programs. Methods Mol. Biol. 132: 3-22.
-
Wower, I. K.; Zwieb, C. K.; Wower, J., (2009). Escherichia coli tmRNA lacking pseudoknot 1 tags truncated proteins in vivo and in vitro. RNA. 15(1): 128–137.
-
Wower, I. K.; Zwieb, C. W.; Guven, S. A.; Wower, J., (2000). Binding and cross-linking of tmRNA to ribosomal protein S1, on and off the Escherichia coli ribosome. EMBO J. (19):6612–21.
-
Wower, I. K.; Zwieb, C.; Wower, J., (2004). Contributions of Pseudoknots and Protein SmpB to the Structure and Function of tmRNA in transTranslation. Journal of Biological Chemistry. 279 (52): 54202–54209.
-
Wower, I. K.; Zwieb, C.; Wower, J., (2005). Transfer-messenger RNA unfolds as it transits the ribosome. RNA Journal, 11:668–673.
- 181-
References
-
Wower, J.; Wower, I. K.; Kraal, B.; Zwieb, C. W., (2001). Quality Control of the Elongation Step of Protein Synthesis by tmRNP. The American society for Nutritional Science, 131:2978-2982.
-
Wower, J.; Wower, I. W.; Zwieb, C., (2008). Making the jump: new insights into the mechanism of trans-translation. Journal of Biology. 7: (17).
-
Zinder, N. D.; Horiuchi, K., (1985). Multiregulatory Element of Filamentous Bacteriophages. American Society for Microbiology, 49(2):101-106.
-
Zwieb, C.; Wower, J., (2000). tmRDB (tmRNA database). Nucleic Acids Res. 28:169–170.
- 182-
Appendices
Appendix 1: Tools and Apparatus. Name
Company
Country
Autoclave Napco 8000-Dse
Thermo
U.S.A.
Concentrator
Eppendorf 5301
Germany
Table Centerfuge
Eppendorf 5417c
Germany
Pxe Thermal Cycler (PCR)
Thermo
U.S.A.
Microwave Oven Refrigerator Centrifuge CENTRACL 3R
General Thermo
U.S.A. U.S.A.
Electrophoresis Unit
Owi B1A
U.S.A.
Electrophoresis Power Supply
Fisher Scientific
U.S.A.
Incubator
Barnstead International
Switzerland
Light Microscope
Olympus Optical Co. LTD,
Japan
Different Micropipettes
Eppendorf
Germany
Vortex Mixer
52BF
U.S.A.
Dual Channel Ph/Ion/Conductivity Meter
XL50 Accumet
Singapore
Oven
Barnstead International
Switzerland
Magnetic Starrier
Fisher Scientific
U.S.A
Sensitive Balance
Ohaus
Switzerland
Shaker Water Bath Spectrophotometer (Spectroscan 50) Ultra Violet Transilluminator
Barnstead International Biotech Engineering Management Co. Ltd. Spectroline
Switzerland U.K
Ultra Violet Fluorescence Analysis Cabinet CC-80
Spectroline
U.S.A
Cabinet Cold Isotemp Plus Refrigerator
Fisher Scientific
U.S.A
Water Bath ISOTEMP 128
Fisher Scientific
U.S.A
Deep Freezer
REVCO
U.S.A
Millipore
Milli-DI
France
Limner Hood
Fisher Hamilton
U.S.A
Ice Maker
Scotsman
Italy
Computerized Digital Camera
Cannon
China
Micropipettes (Different Sizes); (0.1µl -10 Ml)
Eppendorf
Germany
Micropipette Tips (Different Sizes)
Eppendorf
Germany
- i-
U.S.A
Appendices Collection Tubes (1.5, 2)Ml
Eppendorf
Germany
PCR Tubes; (0.5, 0.2)Ml
Eppendorf
Germany
Falcon Tube (50ml)
Eppendorf
Germany
Shaker Water Bath
Lab Tech
Germany
Centrifuge
SIGMA
Germany
Dry Block Heater
Lab Tech
Germany
Water Bath
Lab Tech
Germany
Power Sonic 405 Water Bath
Lab Tech
Germany
Low Temp.BOD Incubater/LBI-250E
Lab Tech
Germany
Fume Hood
Lab Tech
Germany
Thermocycler Gradient (PCR)
Eppendorf
Germany
Acutoclave
Systec
Germany
Limner Hood
Thermo
Germany
- ii-
Appendices
Appendix 2: Chemicals and Materials Chemicals and Materials
Company
Chemicals Calcium chloride, Sodium chloride, Sodium hydroxide, Magnisium Chloride, Tris base, Boric acid, ethylene Diamine Tetra acetic acid (EDTA), Agarose, Agar
SIGMA
Glycerol, Ethanol
ACROS
Sugars and Amino acid Yeast extract
ACROS
Trypton
BD
Sucrose
Difco
Glucose
Difco
Dyes Loading Dye
Fermentas
Ethidium bromide
SIGMA
Bromophenol blue
Fluka
Xylene cyanol
Fluka
Other Materials dNTPs(dATP, dCTP, dGTP and dTTP)
NEB
DNA Ladders (100bp, 1kb and 100bp plus )
Fermentas,NEB
Ampicillin, chloramphenicol
SIGMA
ulraPURE Distilled Water DNAse, RNAse Free
Fermentas
- iii-
Appendices
Appendix 3: Sequencing and Alignment Sequence region of ssrA gene, smpB and their flanking regions can be retrived using the nucleotide sequence search program on the Entrez Browser Website provided by the National Center for Biotechnology Information (NCBI). The sequence of the chromosomal region that contains smpB (red) and gene for tmRNA (yellow), and uncoloured area include sequences of the flanking regions.
3481 3541 3601 3661 3721 3781 3841 3901 3961 4021 4081 4141 4201 4261 4321 4381 4441 4501 4561 4621 4681 4741 4801 4861 4921 4981 5041 5101 5161 5221 5281
ggttgcgggt tctgcccagg aagactgaac tccggctaat atcctgctgt gagccttgtc acgacgctta aagcgcgccc ggctgggaag ctgcgtgacg acgcatgtgg gactcattgt tggaaaaatg aaacgttcag gcccaccgtt gcggcgcgaa cttaatcgaa gctggtcatg attcgacggg ccgcaaaaaa agccctctct agatcgcgtg agtggcgtgt gaggatgtag cggtgattac gcttttttgt ttttaggccc gggagactcc aaacctaaag tccagtggca aaacagagct
agtaaacgtt agtggactcc gtcattcact ctgaggcata aaaaaaaacg ccccgcagga tgacgaagaa gtcacgaata ttaaatccct gagaggcatt tgtgcgatcc acggtcgcgt cctggtgcaa atatcaaaga aaacctgcac tgaacatctt taaaaatcag gcgctcataa atttgcgaaa tagtcgcaaa ccctagcctc gaagccctgc ccgtccgcag gaatttcgga cagagtcatc gccctcaatt attgataggc ccatggcaag atgccgatta gtaagctttg tcggtgccta
ttgctgatcc agaatccgac aactgataca acaatttcca ctatcccggc ttgatatggg aaaagcacat ctttatcgaa gcgcgcagga tctgtttggc tacccgtacc caatcgagaa agtgaaaatc gcgcgaatgg tccaattatt attggctatc gctacatggg atctggtata cccaaggtgc cgacgaaaac cgctcttagg ctggggttga ctggcaagcg cgcgggttca cgatgaagtc tgtcccgcga ccaacgaaaa aaaaaccaag ccagctttat gcaattccgt tcctgccgtc
t actttggtta ctggtcaact cagccttaga gacatctacc gccgcagtca ttccggtaca acccggcaaa aactgaggat tttgctccgc gctgtagggt accagtgcgg tcaacaaaaa tccaacaaat aatatcattt gctgggtaac atcgggttca tgctaagata gtgttttcga tttcagatta ccgatgattc aaacctggtt cagcgaccat cgcgcttaac gaagagttcg aagcgggact tgccctgcaa aaagccaata tcagcgacag ctacgtcctt gctaacatca cgccaatggc cgtggcctcc cgcaagttac ttctcaacca gcgcgaactg ggctataccg tagtggcgct ctccctgtac ggcgtcgcca aaggtaagaa acagcacgat caggtggata aagcacgtat catgaaaaac gaccagttcc tcaccgcgcc tccctctccg acatccgaca caaatgttgc catcccattg tgctaaatct ttaacgataa cgccattgag cttaccttta cacattgggg ctgattctgg atgccgaggg gcggttggcc tcgtaaaaag tacgctttag cagcttaata acctgcttag acggggatca agagaggtca aacccaaaag agcgttaaaa cttaatcagg ctagtttgtt aatgtaaaga ctgactaagc atgtagtacc actcccgcca gctccaccaa aattctccat ctaagagccc gcacggcgca agccctgcgg agtccgaaga gaactaatta aatccgaacc gctctattgt ttacgttggg cctaaacgca ccgttaactg atacggaaat caaagccgcc gacggtgacg ggcttactct gttaatcaag tactatcggc ctttgaccaa gcagcgaacc tcgctttctg atgcacgtaa actcagagcc
5341 gaatctaaag ttttattggc gaaagacatt gatcctcagg aacatca
- iv-
Appendices
Appendix 3: Sequence 3 domain protein A TTGACAATTA ATCATCCGGC ACAGGAAACA
TCGTATAATG
TGTGGAATTG TGAGCGGATA ACAATTTCAC
GACCATGGAA TTGCAACACG ATGAAGCTGT AGACAACAAA TTCAACAAAG AACAACAAAA CGCGTTCTAT GAGATCTTAC ATTTACCTAA AAAGATGACC
CTTAAACGAA GAACAACGAA ACGCCTTCAT CCAAAGTTTA
CAAGCCAAAG CGCTAACCTT AAGTAGACAA
TTAGCAGAAG CTAAAAAGCT AAATGATGCT CAGGCGCCGA
CAAATTCAAC AAAGAACAAC AAAACGCGTT CGAAGAACAA CGAAACGCCT TCATCCAAAG TTTAAAAGAT GAAGCTAAAA
CTATGAGATC TTACATTTAC
CTAACTTAAA
GACCCAAGCC AAAGCGCTAA CCTTTTAGCA
AGCTAAATGA TGCTCAGGCG CCGAAAGTAG ACGCGAATTC CCATATGTTC TTCGAAGACA GCTAGTGTAC TAGTCGATCC GTAGACAACA AATTCAACAA AGAACAACAA AACGCGTTCT ATGAGATCTT ACATTTACCT AACTTAAACG AAGAACAACG AAACGCCTTC ATCCAAAGTT TAAAAGATGA CCCAAGCCAA AGCGCTAACC TTTTAGCAGA AGCTAAAAAG CTAAATGATG CTCAGGCGCC GAAAGTAGAC CTGCAGCCAA GCTTAAGTAA GTAAGCCGCC AGTTCCGCTG GCGGCATTTT TTTTGATATC ATCGAT
pTZN1
Score = 3502 bits (1896), Expect = 0.0 Identities = 1914/1928 (99%), Gaps = 0/1928 (0%) Strand=Plus/Plus Query
1
Sbjct
1
TACTTTGGTTACTGGTCAACTGGTTGCGGGTAGTAAACGTTTTGCTGATCCCAGCCTTAG ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| TACTTTGGTTACTGGTCGACTGGTTGCGGGTAGTAAACGTTTTGCTGATCCCAGCCTTAG
- v-
60 60
Appendices Query
61
Sbjct
61
Query
121
Sbjct
121
Query
181
Sbjct
181
Query
241
Sbjct
241
Query
301
Sbjct
301
Query
361
Sbjct
361
Query
421
Sbjct
421
Query
481
Sbjct
481
Query
541
Sbjct
541
Query
601
Sbjct
601
Query
661
Sbjct
661
Query
721
Sbjct
721
Query
781
Sbjct
781
Query
841
Sbjct
841
AGACATCTACCGCCGCAGTCATCTGCCCAGGAGTGGACTCCAGAATCCGACTTCCGGTAC ||||||||||||||||||||||||| |||||| || |||||||||| |||||||||||| NGACATCTACCGCCGCAGTCATCTGCACAGGAGCGGNCTCCAGAATCGGACTTCCGGTAC
120
AACCCGGCAAAAACTGAGGATAAGACTGAACGTCATTCACTAACTGATACATTTGCTCCG ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| AACCCGGCAAAAACTGAGGATAAGACTGAACNNCATTCACTAACTGATACATTTGCTCCG
180
CGCTGTAGGGTACCAGTGCGGTCCGGCTAATCTGAGGCATAACAATTTCCATCAACAAAA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CGCTGTAGGGTACCAGTGCGGTCCGGCTAATCTGAGGCATAACAATTTCCATCAACAAAA
240
ATCCAACAAATAATATCATTTATCCTGCTGTAAAAAAAACGCTATCCCGGCGCTGGGTAA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ATCCAACAAATAATATCATTTATCCTGCTGTAAAAAAAACGCTATCCCGGCGCTGGGTAA
300
CATCGGGTTCATGCTAAGATAGAGCCTTGTCCCCCGCAGGATTGATATGGGGTGTTTTCG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CATCGGGTTCATGCTAAGATAGAGCCTTGTCCCCCGCAGGATTGATATGGGGTGTTTTCG
360
ATTTCAGATTACCGATGATTCACGACGCTTATGACGAAGAAAAAAGCACATAAACCTGGT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ATTTCAGATTACCGATGATTCACGACGCTTATGACGAAGAAAAAAGCACATAAACCTGGT
420
TCAGCGACCATCGCGCTTAACAAGCGCGCCCGTCACGAATACTTTATCGAAGAAGAGTTC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TCAGCGACCATCGCGCTTAACAAGCGCGCCCGTCACGAATACTTTATCGAAGAAGAGTTC
480
GAAGCGGGACTTGCCCTGCAAGGCTGGGAAGTTAAATCCCTGCGCGCAGGAAAAGCCAAT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GAAGCGGGACTTGCCCTGCAAGGCTGGGAAGTTAAATCCCTGCGCGCAGGAAAAGCCAAT
540
ATCAGCGACAGCTACGTCCTTCTGCGTGACGGAGAGGCATTTCTGTTTGGCGCTAACATC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ATCAGCGACAGCTACGTCCTTCTGCGTGACGGAGAGGCATTTCTGTTTGGCGCTAACATC
600
ACGCCAATGGCCGTGGCCTCCACGCATGTGGTGTGCGATCCTACCCGTACCCGCAAGTTA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ACGCCAATGGCCGTGGCCTCCACGCATGTGGTGTGCGATCCTACCCGTACCCGCAAGTTA
660
CTTCTCAACCAGCGCGAACTGGACTCATTGTACGGTCGCGTCAATCGAGAAGGCTATACC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTTCTCAACCAGCGCGAACTGGACTCATTGTACGGTCGCGTCAATCGAGAAGGCTATACC
720
GTAGTGGCGCTCTCCCTGTACTGGAAAAATGCCTGGTGCAAAGTGAAAATCGGCGTCGCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GTAGTGGCGCTCTCCCTGTACTGGAAAAATGCCTGGTGCAAAGTGAAAATCGGCGTCGCC
780
AAAGGTAAGAAACAGCACGATAAACGTTCAGATATCAAAGAGCGCGAATGGCAGGTGGAT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AAAGGTAAGAAACAGCACGATAAACGTTCAGATATCAAAGAGCGCGAATGGCAGGTGGAT
840
AAAGCACGTATCATGAAAAACGCCCACCGTTAAACCTGCACTCCAATTATTGACCAGTTC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AAAGCACGTATCATGAAAAACGCCCACCGTTAAACCTGCACTCCAATTATTGACCAGTTC
900
- vi-
120
180
240
300
360
420
480
540
600
660
720
780
840
900
Appendices Query
901
Sbjct
901
Query 961 Sbjct 961 Query 1021 Sbjct 1021 Query 1081 Sbjct 1081 Query 1141 Sbjct 1141 Query 1201 Sbjct 1201 Query 1261 Sbjct 1261 Query 1321 Sbjct 1321 Query 1381 Sbjct 1381 Query 1441 Sbjct 1441 Query 1501 Sbjct 1501 Query 1561 Sbjct 1561 Query 1621 Sbjct 1621 Query 1681 Sbjct 1681
CTCACCGCGCCTCCCTCTCCGGCGGCGCGAATGAACATCTTATTGGCTATCACATCCGAC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTCACCGCGCCTCCCTCTCCGGCGGCGCGAATGAACATCTTATTGGCTATCACATCCGAC
960 960
ACAAATGTTGCCATCCCATTGCTTAATCGAATAAAAATCAGGCTACATGGGTGCTAAATC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ACAAATGTTGCCATCCCATTGCTTAATCGAATAAAAATCAGGCTACATGGGTGCTAAATC
1020
TTTAACGATAACGCCATTGAGGCTGGTCATGGCGCTCATAAATCTGGTATACTTACCTTT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TTTAACGATAACGCCATTGAGGCTGGTCATGGCGCTCATAAATCTGGTATACTTACCTTT
1080
ACACATTGGGGCTGATTCTGGATTCGACGGGATTTGCGAAACCCAAGGTGCATGCCGAGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ACACATTGGGGCTGATTCTGGATTCGACGGGATTTGCGAAACCCAAGGTGCATGCCGAGG
1140
GGCGGTTGGCCTCGTAAAAAGCCGCAAAAAATAGTCGCAAACGACGAAAACTACGCTTTA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGCGGTTGGCCTCGTAAAAAGCCGCAAAAAATAGTCGCAAACGACGAAAACTACGCTTTA
1200
GCAGCTTAATAACCTGCTTAGAGCCCTCTCTCCCTAGCCTCCGCTCTTAGGACGGGGATC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCAGCTTAATAACCTGCTTAGAGCCCTCTCTCCCTAGCCTCCGCTCTTAGGACGGGGATC
1260
AAGAGAGGTCAAACCCAAAAGAGATCGCGTGGAAGCCCTGCCTGGGGTTGAAGCGTTAAA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AAGAGAGGTCAAACCCAAAAGAGATCGCGTGGAAGCCCTGCCTGGGGTTGAAGCGTTAAA
1320
ACTTAATCAGGCTAGTTTGTTAGTGGCGTGTCCGTCCGCAGCTGGCAAGCGAATGTAAAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ACTTAATCAGGCTAGTTTGTTAGTGGCGTGTCCGTCCGCAGCTGGCAAGCGAATGTAAAG
1380
ACTGACTAAGCATGTAGTACCGAGGATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ACTGACTAAGCATGTAGTACCGAGGATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCC
1440
AGCTCCACCAAAATTCTCCATCGGTGATTACCAGAGTCATCCGATGAAGTCCTAAGAGCC |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| AGCTCCACCAAAATTCTCCATCGGTGATTACCAGAGTCATCCGATGAAGTGCTAAGAGCC
1500
CGCACGGCGCAAGCCCTGCGGGCTTTTTTGTGCCCTCAATTTGTCCCGCGAAGTCCGAAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CGCACGGCGCAAGCCCTGCGGGCTTTTTTGTGCCCTCAATTTGTCCCGCGAAGTCCGAAG
1560
AGAACTAATTAAATCCGAACCTTTTAGGCCCATTGATAGGCCCAACGAAAAGCTCTATTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AGAACTAATTAAATCCGAACCTTTTAGGCCCATTGATAGGCCCAACGAAAAGCTCTATTG
1620
TTTACGTTGGGCCTAAACGCAGGGAGACTCCCCATGGCAAGAAAAACCAAGCCGTTAACT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TTTACGTTGGGCCTAAACGCAGGGAGACTCCCCATGGCAAGAAAAACCAAGCCGTTAACT
1680
GATACGGAAATCAAAGCCGCCAAACCTAAAGATGCCGATTACCAGCTTTATGACGGTGAC ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| GATACGGAAATCAAAGCCGCCAAACCTAAAGATGCCGATTACCAGCTNTATGACGGTGAC
1740
- vii-
1020
1080
1140
1200
1260
1320
1380
1440
1500
1560
1620
1680
1740
Appendices Query 1741 Sbjct 1741 Query 1801 Sbjct 1801 Query 1861 Sbjct 1861 Query 1921 Sbjct 1921
GGGCTTACTCTGTTAATCAAGTCCAGTGGCAGTAAGCTTTGGCAATTCCGTTACTATCGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGGCTTACTCTGTTAATCAAGTCCAGTGGCAGTAAGCTTTGGCAATTCCGTTACTATCGG
1800
CCTTTGACCAAGCAGCGAACCAAACAGAGCTTCGGTGCCTATCCTGCCGTCTCGCTTTCT ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| CCTTTGACCAAGCAGCGAACCAAACAGAGCTTCGGTGNNTATCCTGCCGTCTCGCTTTCT
1860
GATGCACGTAAACTCAGAGCCGAATCTAAAGTTTTATTGGCGAAAGACATTGATCCTCAG |||||||||||||||||||||||||||||||| ||||||||||||| || ||||||||| GATGCACGTAAACTCAGAGCCGAATCTAAAGTNNTATTGGCGAAAGANATCGATCCTCAG
1920
GAACATCA |||||||| GAACATCA
1800
1860
1920
1928
restriction site
1928
Protein A
Query 1 Sbjct52
GAAGCTGTAGACAACAAATTCAACAAAGAACAACAAAACGCGTTCTATGAGATCTTACA 59 |||||||||||| | |||||||||||||||||||||||||||||||||||||||||| GAAGCTGTAGACTCCGGATTCAACAAAGAACAACAAAACGCGTTCTATGAGATCTTACA 110
Query60
TTTACCTAACTTAAACGAAGAACAACGAAACGCCTTCATCCAAAGTTTAAAAGATGACCC 19 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 111 TTTACCTAACTTAAACGAAGAACAACGAAACGCCTTCATCCAAAGTTTAAAAGATGACCC 170 Query 120 AAGCCAAAGCGCTAACCTTTTAGCAGAAGCTAAAAAGCTAAATGATGCTCAGGCGCCGAA ||||||||||||||||||||||||||||||||||||||||||||||||| | || |||| Sbjct 171 AAGCCAAAGCGCTAACCTTTTAGCAGAAGCTAAAAAGCTAAATGATGCTTAAGCCTCGAG Query 180 AGTAGA |||||| Sbjct 231 AGTAGA
185 Stop codon 236
- viii-
R.site
179 230
Appendices
∆ tmRNA ∆SmpB (pTZN5)
Deleted tmRNA, smpB together Score = 867 bits (469), Expect = 0.0 Identities = 473/475 (99%), Gaps = 0/475 (0%) Strand=Plus/Minus Query 1454 Sbjct 527 Query 1514 Sbjct 467 Query 1574 Sbjct 407 Query 1634 Sbjct 347 Query 1694 Sbjct 287 Query 1754 Sbjct 227 Query 1814 Sbjct 167 Query 1874 Sbjct 107
TTCTCCATCGGTGATTACCAGAGTCATCCGATGAAGTCCTAAGAGCCCGCACGGCGCAAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TTCTCCATCGGTGATTACCAGAGTCATCCGATGAAGTCCTAAGAGCCCGCACGGCGCAAG
1513
CCCTGCGGGCTTTTTTGTGCCCTCAATTTGTCCCGCGAAGTCCGAAGAGAACTAATTAAA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CCCTGCGGGCTTTTTTGTGCCCTCAATTTGTCCCGCGAAGTCCGAAGAGAACTAATTAAA
1573
TCCGAACCTTTTAGGCCCATTGATAGGCCCAACGAAAAGCTCTATTGTTTACGTTGGGCC ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| TCCGAACCTTTTAGGCCCATTGATAGGCCCAACGAAAAGCTCTATTGTTTACGTTAGGCC
1633
TAAACGCAGGGAGACTCCCCATGGCAAGAAAAACCAAGCCGTTAACTGATACGGAAATCA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TAAACGCAGGGAGACTCCCCATGGCAAGAAAAACCAAGCCGTTAACTGATACGGAAATCA
1693
AAGCCGCCAAACCTAAAGATGCCGATTACCAGCTTTATGACGGTGACGGGCTTACTCTGT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AAGCCGCCAAACCTAAAGATGCCGATTACCAGCTTTATGACGGTGACGGGCTTACTCTGT
1753
TAATCAAGTCCAGTGGCAGTAAGCTTTGGCAATTCCGTTACTATCGGCCTTTGACCAAGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TAATCAAGTCCAGTGGCAGTAAGCTTTGGCAATTCCGTTACTATCGGCCTTTGACCAAGC
1813
AGCGAACCAAACAGAGCTTCGGTGCCTATCCTGCCGTCTCGCTTTCTGATGCACGTAAAC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AGCGAACCAAACAGAGCTTCGGTGCCTATCCTGCCGTCTCGCTTTCTGATGCACGTAAAC
1873
TCAGAGCCGAATCTAAAGTTTTATTGGCGAAAGACATTGATCCTCAGGAACATCA ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| TCAGAGCCGAATCTAAAGTTTTATTGGCGAAAGACATGGATCCTCAGGAACATCA
468
408
348
288
228
168
108
1928 53
Score = 704 bits (381), Expect = 0.0 Identities = 386/390 (99%), Gaps = 0/390 (0%) Strand=Plus/Minus Query
1
TACTTTGGTTACTGGTCAACTGGTTGCGGGTAGTAAACGTTTTGCTGATCCCAGCCTTAG
- ix-
60
Appendices Sbjct
915
Query
61
Sbjct
855
Query
121
Sbjct
795
Query
181
Sbjct
735
Query
241
Sbjct
675
Query
301
Sbjct
615
Query
361
Sbjct
555
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || TACTTTGGTTACTGGTCGNCTGGTTGCGGGTAGTAAACGTTTTGCTGATCCCAGCCTNAG
856
AGACATCTACCGCCGCAGTCATCTGCCCAGGAGTGGACTCCAGAATCCGACTTCCGGTAC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AGACATCTACCGCCGCAGTCATCTGCCCAGGAGTGGACTCCAGAATCCGACTTCCGGTAC
120
AACCCGGCAAAAACTGAGGATAAGACTGAACGTCATTCACTAACTGATACATTTGCTCCG |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| AACCCGGCAAAAACTGAGGATAAGNCTGAACGTCATTCACTAACTGATACATTTGCTCCG
180
CGCTGTAGGGTACCAGTGCGGTCCGGCTAATCTGAGGCATAACAATTTCCATCAACAAAA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CGCTGTAGGGTACCAGTGCGGTCCGGCTAATCTGAGGCATAACAATTTCCATCAACAAAA
240
ATCCAACAAATAATATCATTTATCCTGCTGTAAAAAAAACGCTATCCCGGCGCTGGGTAA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ATCCAACAAATAATATCATTTATCCTGCTGTAAAAAAAACGCTATCCCGGCGCTGGGTAA
300
CATCGGGTTCATGCTAAGATAGAGCCTTGTCCCCCGCAGGATTGATATGGGGTGTTTTCG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CATCGGGTTCATGCTAAGATAGAGCCTTGTCCCCCGCAGGATTGATATGGGGTGTTTTCG
360
ATTTCAGATTACCGATGATTCACGACGCTT |||||||||||||||||||||||||||||| ATTTCAGATTACCGATGATTCACGACGCTT
NF 10
- x-
390 526
796
736
676
616
556
Appendices
Deleted tmRNA part, replaced with one domain protein A core = 97.1 bits (52), Expect = 3e-24 Identities = 54/55 (99%), Gaps = 0/55 (0%) Strand=Plus/Plus Query
313
Sbjct
326
ATGTAGTACCGAGGATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCA | |||||||||||||||||| |||||||||||||||||||||||||||||||||||| CTCGAGTACCGAGGATGTAGGAGTTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCA
Score = 86.1 bits (46), Expect = 5e-21 Identities = 49/50 (98%), Gaps = 1/50 (2%) Strand=Plus/Plus Query
1
Sbjct
111
- xi-
376
This gap contains protein A
GGGGCTGATTCTGGATTCGACGGGATTTGCGAAACCCAAGGTGCATGCCGA |||||||||||||||||||||||||||||||||||||||||||||| | || GGGGCTGATTCTGGATTCGACGGGATTTGCGAAACCCAAGGTGCATCCGGA
NF 11
363
52 162
Appendices
Deleted tmRNA part, replaced with one domain protein A Score = 87.9 bits (47), Expect = 1e-21 Identities = 49/50 (98%), Gaps = 0/50 (0%) Strand=Plus/Plus Query
316
Sbjct
233
ACCGAGGATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCA |||| ||||||||||||||||||||||||||||||||||||||||||||| CTCGAGAATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCA
Score = 62.1 bits (33), Expect = 8e-14 Identities = 33/33 (100%), Gaps = 0/33 (0%) This gap contains protein A Strand=Plus/Plus Query
1
Sbjct
34
GGGGCTGATTCTGGATTCGACGGGATTTGCGAAACCCAA ||||||||||||||||||||||||||||||||| || | GGGGCTGATTCTGGATTCGACGGGATTTGCGAATCCGGA
NF 9 - xii-
39 72
363 280
Appendices
Deleted tmRNA part, replaced with one domain protein A Score = 165 bits (89), Expect = 7e-45 Identities = 89/89 (100%), Gaps = 0/89 (0%) Strand=Plus/Plus Query
1
Sbjct
111
Query
61
Sbjct
171
GGGGCTGATTCTGGATTCGACGGGATTTGCGAAACCCAAGGTGCATGCCGAGGGGCGGTT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGGGCTGATTCTGGATTCGACGGGATTTGCGAAACCCAAGGTGCATGCCGAGGGGCGGTT GGCCTCGTAAAAAGCCGCAAAAAATAGTCGCA ||||||||||||||||||||||||||||| GGCCTCGTAAAAAGCCGCAAAAAATAGTCCGG
60 170
92 202
Resume codon (Argnine) Score = 128 bits (69), Expect = 9e-34 Identities = 71/72 (99%), Gaps = 0/72 (0%) Strand=Plus/Plus Query
292
Sbjct
364
Query
352
Sbjct
424
This gap contains protein A
AGACTGACTAAGCATGTAGTACCGAGGATGTAGGAATTTCGGACGCGGGTTCAACTCCCG ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| AGACTGACTAAGCATGTAGTACCGAGGATGTAGGAGTTTCGGACGCGGGTTCAACTCCCG CCAGCTCCACCA |||||||||||| CCAGCTCCACCA
363 435
NF 8 - xiii-
351 423
Appendices
Deleted tmRNA part, replaced with one domain protein A Score = 195 bits (105), Expect = 8e-54 Identities = 105/105 (100%), Gaps = 0/105 (0%) Strand=Plus/Plus Query
1
Sbjct
113
Query
61
Sbjct
173
GGGGCTGATTCTGGATTCGACGGGATTTGCGAAACCCAAGGTGCATGCCGAGGGGCGGTT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGGGCTGATTCTGGATTCGACGGGATTTGCGAAACCCAAGGTGCATGCCGAGGGGCGGTT GGCCTCGTAAAAAGCCGCAAAAAATAGTCGCAAACGACGAAAACTACGCT ||||||||||||||||||||||||||||||||||||||||||||| || GGCCTCGTAAAAAGCCGCAAAAAATAGTCGCAAACGACGAAAACTCCGGA
Serine
60 172
110 222
glycine
This gap contains protein A Score = 128 bits (69), Expect = 9e-34 Identities = 71/72 (99%), Gaps = 0/72 (0%) Strand=Plus/Plus Query
292
Sbjct
383
Query
352
Sbjct
443
AGACTGACTAAGCATGTAGTACCGAGGATGTAGGAATTTCGGACGCGGGTTCAACTCCCG ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| AGACTGACTAAGCATGTAGTACCGAGGATGTAGGAGTTTCGGACGCGGGTTCAACTCCCG CCAGCTCCACCA |||||||||||| CCAGCTCCACCA
363 454
One domain protein A located in the deleted area of NF8, NF9, NF10, NF11 - xiv-
351 442
Appendices
>lcl|23967 Length=170 Score = 278 bits (150), Expect = 3e-79 Identities = 150/150 (100%), Gaps = 0/150 (0%) Strand=Plus/Plus
Query
880
Sbjct
1
Query
940
Sbjct
61
Query
1000
Sbjct
121
TTCAACAAAGAACAACAAAACGCGTTCTATGAGATCTTACATTTACCTAACTTAAACGAA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TTCAACAAAGAACAACAAAACGCGTTCTATGAGATCTTACATTTACCTAACTTAAACGAA
939
GAACAACGAAACGCCTTCATCCAAAGTTTAAAAGATGACCCAAGCCAAAGCGCTAACCTT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GAACAACGAAACGCCTTCATCCAAAGTTTAAAAGATGACCCAAGCCAAAGCGCTAACCTT
999
TTAGCAGAAGCTAAAAAGCTAAATGATGCTCAG |||||||||||||||||||||||||||||| | TTAGCAGAAGCTAAAAAGCTAAATGATGCTTAA
1029 150 Stop codon
Delta tmRNA by gene replacement - xv-
60
120
Appendices
Deleted tmRNA Score = 75.0 bits (40), Expect = 2e-17 Identities = 40/40 (100%), Gaps = 0/40 (0%) Strand=Plus/Plus
Query
1
Sbjct
64
GCTGGTCATGGCGCTCATAAATCTGGTATACTTACCTTTA |||||||||||||||||||||||||||||||||||||||| GCTGGTCATGGCGCTCATAAATCTGGTATACTTACCTTTA
Score = 65.8 bits (35), Expect = 9e-15 Identities = 35/35 (100%), Gaps = 0/35 (0%) Strand=Plus/Plus Query
446
Sbjct
103
AAGTCCTAAGAGCCCGCACGGCGCAAGCCCTGCGG ||||||||||||||||||||||||||||||||||| AAGTCCTAAGAGCCCGCACGGCGCAAGCCCTGCGG
∆ tmRNA/pTZ57R (pTZN3) - xvi-
480 137
40 103
Appendices
Deleted tmRNA Score = 811 bits (439), Expect = 0.0 Identities = 441/442 (99%), Gaps = 0/442 (0%) Strand=Plus/Plus Query 1487 Sbjct 103 Query 1547 Sbjct 163 Query 1607 Sbjct 223 Query 1667 Sbjct 283 Query 1727 Sbjct 343 Query 1787 Sbjct 403 Query 1847 Sbjct 463 Query 1907 Sbjct 523
AAGTCCTAAGAGCCCGCACGGCGCAAGCCCTGCGGGCTTTTTTGTGCCCTCAATTTGTCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AAGTCCTAAGAGCCCGCACGGCGCAAGCCCTGCGGGCTTTTTTGTGCCCTCAATTTGTCC
1546
CGCGAAGTCCGAAGAGAACTAATTAAATCCGAACCTTTTAGGCCCATTGATAGGCCCAAC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CGCGAAGTCCGAAGAGAACTAATTAAATCCGAACCTTTTAGGCCCATTGATAGGCCCAAC
1606
GAAAAGCTCTATTGTTTACGTTGGGCCTAAACGCAGGGAGACTCCCCATGGCAAGAAAAA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GAAAAGCTCTATTGTTTACGTTGGGCCTAAACGCAGGGAGACTCCCCATGGCAAGAAAAA
1666
CCAAGCCGTTAACTGATACGGAAATCAAAGCCGCCAAACCTAAAGATGCCGATTACCAGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CCAAGCCGTTAACTGATACGGAAATCAAAGCCGCCAAACCTAAAGATGCCGATTACCAGC
1726
TTTATGACGGTGACGGGCTTACTCTGTTAATCAAGTCCAGTGGCAGTAAGCTTTGGCAAT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TTTATGACGGTGACGGGCTTACTCTGTTAATCAAGTCCAGTGGCAGTAAGCTTTGGCAAT
1786
TCCGTTACTATCGGCCTTTGACCAAGCAGCGAACCAAACAGAGCTTCGGTGCCTATCCTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TCCGTTACTATCGGCCTTTGACCAAGCAGCGAACCAAACAGAGCTTCGGTGCCTATCCTG
1846
CCGTCTCGCTTTCTGATGCACGTAAACTCAGAGCCGAATCTAAAGTTTTATTGGCGAAAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CCGTCTCGCTTTCTGATGCACGTAAACTCAGAGCCGAATCTAAAGTTTTATTGGCGAAAG
1906
ACATTGATCCTCAGGAACATCA |||| ||||||||||||||||| ACATGGATCCTCAGGAACATCA
162
222
282
342
402
462
522
1928 544
Score = 156 bits (84), Expect = 2e-41 Identities = 84/84 (100%), Gaps = 0/84 (0%) Strand=Plus/Plus Query
98
Sbjct 20 Query 1058 Sbjct 80
TCAGGCTACATGGGTGCTAAATCTTTAACGATAACGCCATTGAGGCTGGTCATGGCGCTC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TCAGGCTACATGGGTGCTAAATCTTTAACGATAACGCCATTGAGGCTGGTCATGGCGCTC ATAAATCTGGTATACTTACCTTTA |||||||||||||||||||||||| ATAAATCTGGTATACTTACCTTTA
1081 103
- xvii-
1057 79
ó–þ©a ó–þ©a@@
اﻟﺨﻼﺻﺔ اﻟﺨﻼﺻﺔ @æà@ âÌ‹Übi@ óÍÜbi@ óÔ‡i@ µmìÜa@ Êïå—m@ óïÝáÈ@ ò†íu@ çbá›ÝÜ@ óîÙi@ óïÜa @ trans-translation@ nÉm Translational I@ ó»ÝÜ@ õŠb ýa@ bîäa@ LmRNA@ ÒÝm@ …bånýa@ Löb‚c@ Þrà@ béîÉm@ ‡Ô@ ônÜa@ pbî‡znÜa @tmRNA@æà@çíÙn¾a@õŒíjîaŠ@ñìíä@@ôåïmì‹i@‡ÕÉà@óaíi@Þ—¥@ trans-Translation@@ .HFrameshifting @NHSmpBI B Í—Üa@µmìÜaì @tmRNA@óÑïÄíÜ@trans-translation@xˆíáåÜa@ça@çbÙàdi@Þè@ßaüÜa@æÈ@óibuýa@óïÜb¨a@óaŠ‡Üa@Ó‡ém @ @@N‹ÍÜa@a‰@ÞjÔ@þáÉnm@@báéäÿ@Helper@ì@Lambda @b–í—‚@L@óïqbÉÜa@í¹@ôÐ@tmRNAß@kÝn¾a@|šíî@ça @µibà@ óÕÝɾa@ Ö bå¾aì@ LsmpB@ µuì@ ssrA@ µu@ æá›nm@ ônÜa@ tmRNA@ óÕåà@ Lóïï÷‹Üa@ Óa‡èýa@ ÞïåÜ @@NóïqbÉÜa@ í¹@ ôÐ@ tmRNA@ öaua@ æà@ öu@ ÞØ@ Šì†@ óaŠ‡ÝÜ@ NpTZ57R@ ‡ïàŒþi@ ¶a@ oäíÝØ@ H1928@ ntI@ pbåï§a @߇jna@tmRNA@óÕåà@æà@Ó쉫@öu@ÞØ@NPCRßa@ôÝÈ@‡ánɾa@Ó‰¨a@ãa‡ƒndi@óïÝÙïè@pa‹Ñ @ò‡È@ôÝÈ@oÝ—y @bvåi@ ônÑïšc@ çbnÝÜa@ UGA@ ìc@ UAA bàc@ öbéäa@ ò‹Ñ’@ ôÝÈ@ ñína@ (One Domain Protein A)@ µ§bi HPK1, MLD, PK2-PK4I@Ó‰¨@oáá–@ò†‡«@pb÷†bi@æà@ò‡È@HSite Directed MutagenesisI@óaíi One @ µ¡@ o܇jna@ óÐì‰a@ @ öauýc@ oäbØ@ Lóïåïvè@ pbøîu@ xbnäý@ ò‡y@ ôÝÈ @ HMLD, PK2- PK4I@ ì @ @NPCR@ßa@óaíi@Âi‹Üa@óïåÕm@ìc@Cassette Mutagenesis@ãa‡ƒndi@Domain Protein A @báïÐ@ôåïmìÜaì@ðqaŠíÜa@ÞïÝznÜa@a‹uÿ@óïÝ©a@ôÐ@tmRNA@óÕå¾@ÂÕÐ@ò‡yaì@ò‹Ñà@óƒä@†íuì@æà@‡ØdnÝÜ @a‰Ùè@ L@ ßa‡jnýa@ óïåÕm@ ãa‡ƒndi@ oЉy@ ó슇¾a@ ôîÙjÜa@ ãííàì‹ÙÜa@ ôÝÈ@ †íuí¾aì@ ñÜa@ tmRNA@ óïÜbÉÐ@ ‡Éi @sï¢@LòŠa‹zÝÜ@‘b¨aì@ÂiŠ@†bɾa@pKO3@‡ïàŒþi@ôÝÈ@ñín¥@oäbØ@óÜþ@ÞØ@E. coli@bîÙjÜ@óîíäbq@pýþ@ojØŠ smpB @ LÓ쉫@ tmRNA@ æà@ Hin vitroI@ ð¨a@ â§a@ xŠb‚@ ߇ɾa@ oïbØ@ ôÝÈ@ ñín±@ |j–c@ ‡ïàŒþjÜa@ a‰è @ @NdÉà@báèþØ@ìc@Ó쉫
- D-
ó–þ©a ó–þ©a@@
@óïvïmac@ LA@ µmìÜa@ oäbØ@ Llíݾa@ µ§bi@ tmRNA@ µ§@ Óì‰a@ ö§a@ Þî‡jm@ óïÝáÈ@ ‡Øüä@ ðÙÜ @ú‹Ô@Àbšc@‡ØdnÜì@@ò‹ïØ@ MG1655@óÜþ@¶a@óÐbšýbi@ójØ‹¾a@pýþÜa@ÞÙÜ@ RT-PCR@ì@ Nested PCR @ójØ‹¾a@pýþÜa@oÉ›‚c@LÚ܈@‡Éi N|ïz—Üa@kÔbÉnÜa@ôÝÈ@bèöaínyc@‡Øc@ñ‰Üaì@ójØ‹¾a@pýþÝÜ@ñ‡ïmíÝØíïåÜa@kmbÉnÜa @ôÝÈ@a†bánÈa@ tmRNA@óÕåà@æà@öu@ÞØ@ýì†@ÞïÝznÜ@Ú܈ì@ Helper ì@ Lambda@ÞjÔ@æà@õì‡ÉÜa@¶a@ójnÙ¾a @.óïqbÉÜa@ói‹¤ @béïÐ@oЉy@Üa@ójØ‹¾a@NF8@óÜþ@a‡È@bà@óïqbÉÜa@í¹@âȇm@oäbØ@ójØ‹¾a@pýþÜa@ÞØ@çdi@w÷bnåÜa@p‹éÄc @One Domain Protein A@ µ¡@ o܇jncì@ ÞàbÙÜbi@ PK2- PK4, MDL ß@ ò‚ýa@ tþrÜa@ óïåïàc@ b¼c @oäbØ@ UGA @Ëíä@æà@ÒÔínÜa@ò‹Ñ’@ôÝÈ@õín±@ tmRNA@çc@p‹éÄc@bàíáÈ@NUAA@Ëíä@æà@ÒÔínÜa@ôÝÈ@ñìb¨a @ @NUAA@Ëíä@æà@ÒÔínÜa@ò‹Ñ’@ôÝÈ@ñín¥@oäbØ@Üa@æà@‹rØc@öíÑØ@ÞÙ“i@óïqbÉÜa@í¹ @ðÜbnÜbiì@L@ trans-translation@ÒÉ›î@@ MLD, PK1,PK2-PK4@Ó‰y@çdi@‡uì@LÚ܈@ôÝÈ@òìþÈ @ôÐ@báéà@aŠì†@kÉÝm@Ú܈@æà@ý‡i@Lóïbc@Ì@öauýa@ë‰è@ça@Ú܉i@óÑ’bØ@óïqbÉÜa@í¹@âȇm@oäbØ@ójØ‹¾a@pýþÜbÐ @ @NtmRNA@óï÷u@óîŠa‹Õna @Šbn¦@ ÒïØ@ NssrA@ ßa@ µu@ ÞáÈ@ ¹ì@ E. coli@ ôÐ@ ó»Üa@ óïÝáÉi@ ÖÝÉnm@ ò‡î‡u@ óÝøc@ ÞáÉÜa@ a‰è@ ‡Øüî @L@ -1 TRIPLET, PK1öauc@ lbïÌ@ôÐ@ tmRNA@óï÷u@ôÝÈ@ó»Üa@Óbåønł@ózïz—Üa@ò‹Ñ“Üa@ãííjîa‹Üa @ @NóïqbÉÜa@íáåÜ@bè†båa@öaŠì@óÕïÔ‡Üa@óï÷§a@pbïÜýa@ðèbàì@Lóîí@PK4-PK2,MLDì
- E-
ón‚íq ón‚íq
ón‚íq ón‚íq @óÜ@ ìbi@ öçóîý@ óàóè@ ôîŠüu@ ô䆋ÙÜûäüØ@ ôÙŽïàïäbÙïà@ óÜ@ óïïnî‹i trans-translation õóû‹q @aì@Lça‹Žï Šòì@ôäa†ý@òíŽïš@ì@ mRNA@ôäbÙ“ÙŽïm@Lòìóåm‹ ŠóióÜ@ôäbØóÜóè@íØòì@ôäbØórüØ@õaŠòŠó@óØ@a†bîØói @oŽî‹Øò†@ ŽôuójŽïu@ trans-Translation@ N³i@ o슆@ Lóäb‚@ üi@ ónîíŽïq@ çüš@ íØòì@ õ†Šì@ ói@ çbØóåïmû‹q@ pbØò† @ãó÷ NoŽî†@ÚŽïq@ HSmpBI@ B@ôåïmû‹q@ò†Šì@ì@ tmRNA@ ò†Šó @óÜ@óØ@òìóÙŽïåmû‹q@ óØìbä@ òŒüjîaŠ@õŒüÜb÷@õóŽîŠóÜ @Žôäaímò†@ tmRNA@ ôäbà‹Ð@ üi@ trans-translation@ ôݎíà@ ü‚b÷@ óØ@ pbØò†@ Žõímìbm@ ó‹q@ ìó÷@ óîòìóåïÜüÙŽïÜ @Helper@ì@Lambda@ôäbØòŠü‚@bîØói@ômójîbmói@LòìómbÙi@çììŠ@tmRNA@ói@Šü‚@bîØói@õó’ó @ôäìíjubmb÷ @ @Nçìa‹åŽïèóäŠbØói@ónóióà@ìó÷@üi@“Žïq@óäbàó÷@õòìó÷@ŠóióÜ @óšìbä@ì@SmpB@ôåïu@LssrA@ôåïu@óØ@tmRNA@õóšìbä@LçbØóïïØòŠó@ó−bàb÷@ói@´“îó @üi @ôÜûŠ@õòìó åïÜüÙŽïÜ@ônóióàói@NpTZ57R@õ‡ïàŒþq@Šó@óîa‹ÙäüÝØ@Lóîa‡Žïm@Hoä1928I@çbïäbØòìa‹aíÜóè @ói@ôîómbéÙŽïq@ôÙŽïäa†Œbi@‡äóš@La†Šü‚@bîØói@õó’ó @ô䆋Ø@ôîn“q@óÜ @tmRNA@õóäb’ói@ìóÜ@ÚŽï’óiŠóè @ôåïàû†@ói@aŠ†Šü @LtmRNA@õóšìbäóÜ@òìa‹@ôØóîóšŠbq@Šóè@Nça‹åŽïéî†ói@HPCR@ói@òìóåî‹I@õóŽîŠ @æŽîí’@ôäa‡Žïq@ŒbiI@õóŽîŠóióØ@ìíióè@UGA@çbî@UAA@ôåŽïè@ôîbmüØ@õóÜŠóq@óØ@A@ôåïmû‹q@ôåïu@õHDomainI PK1,MLD, PK2-I@õòìóåî‹@üi@‡äó¸ójîbm@õHŠ@ óºa‹qI@ŠóÙŽïrnò†@ò†Œbï@Nìíia‹Ø@†bîŒ@õüi@Hìa‹ØónaŠb÷ @ó’ói@@ç@ b’bqL@ ÃòŠ@ìì†@õ†Šó @ôäbåŽïè@ãóèŠói@ìbåŽïq@óÜ@ça‹Ùåîaî†@bïuói@bïu@HMLD,PK2-PK4I@ì@HPK4 @çbî@HCassette MutagenesisI@oŽïbØ@ôäa‡ŽïqŒbi@ôäbåŽïèŠbØóiói@A@ôåïmû‹q@ôÙŽïåîóàû†@ói@çaŠ†Šü @çbØòìa‹ @ói@Œaìbïu@õìa‹åŽïéÙŽïq@õòm@Žíä@óîòíŽï’@ãói@NHPCR Ligation TechniqueI@PCR@ói@´ói@òìóÙŽïq@ôÙïåØóm NHNF1, NF2, NF3, NF4, NF5, NF7, NF8, NF9, NF10, and NF11I@æmìóØ@oò† @üi@ õŠbÙï’@ üi@ a†óØóäb‚@ óÜ@ tmRNA@ õóšìbä@ õìaŠ‡ŽïqŒbi@ ôqüØ@ Ûóî@ béäóm@ ôäìíióèóÜ@ çìíi@ bïå܆@ üi @óïî†í‚@óåïu@LóØbîØói@ôàüüàû‹Ø@Šó@óÜ@ñíŽïØ@õ@ tmRNA@ôØýbš@õòìóån‚Šì†@üi@ì‹maì†@ôåïmû‹q@ö@ôîòìbà - A-
ón‚íq ón‚íq
@ÛóîŠóèóØ@ça‹åŽïéÙŽïq@HE coliI@õ‡äòìbä@õòm@òìóäa‹@ì@òìóåm‹ @æŽîí’@ôÙïåØóm@ói@çbØòìa‹Ø@ŠóóÜ@òìóåïÜüÙŽïÜ @smpB@ Lòìa‹@ õtmRNA@ õHó’ìí’@ ìbä@ õóŽîŠ@ óiI@ ìaŠü @ ônŽïbØ@ óØ@ ìíi@ a‡Žïm@ pKO3@ ôÙŽî‡ïàŒþq@ óäam@ ìóÜ @ @Nòìím‹Üóè@òìóÙŽïq@ôäbïØ솊óè@çbî@òìa‹ Nested @LA@@ôåïmû‹q@LóØòìaîì@óåïu@ói@ tmRNA@õóØòìa‹@ó’ói@õòìóåm‹ @æŽîí’@ôä‡äbróš@üi @ôîbïå܆@ üi@ NçaŠ†@ ãb−ó÷@ ŽßûäüØ@ íØòì@ ”î@ MG1655@ öçbØòìa‹åŽïéÙŽïq@ òm@ ãóuŠó@ üi@ RT-PCR@ ì@ PCR @õìa‹åŽïÙÜ@òìóÙŽïq@òŠbiìì†@õ‡äóiîŠ@óØ@pìóØŠò†@ìa‹Ø@üi@çbïàüåïu@õ‡äóiîŠ@õòìóä‡åŽîí‚@çbØòìa‹åŽïéÙŽïq@òm@L‹mbîŒ @ôÜûŠ@ôåïäaŒ@üi@a‹Ø@Helper@@ì@Lambda@õŠü‚@bîØói@ô’ìím@çbØòìa‹åŽïéÙŽïq@òm@L‹maì†@Nìíi@a‡Žïm@çbîóåïÔónaŠ NHPhage AssayI@Šü‚@bîØói@õòìó䆋ÙïÔbm@ói@´ói@o“qói@tmRNA@ôäbØó’óióÜ@ÚŽï’ói@Šóè @óÜ@ óvŽïi@ çìíi@ Šü‚@ bîØói@ õó’ó @ õn“q@ çbØòìa‹åŽïéÙŽïq@ ãóuŠó@ óØ@ a†@ çbïäb“ïq@ çbØóàb−ó÷@ @ì@ òìóäìíiaŠ†‹@ õìaìóm@ ói PK4-PK2 ì@ MLDóÜ@ ôåïàó÷@ ó’‹m@ Žô@ µàóèaì†@ a‡îbïm@ óØ@ NF8@ õìa‹åŽïéÙŽïq @òm@ Ló−Šó@ õóÙŽïu@ õòìó÷@ Nìíi@ a‡Žïm@ UAA@ ôäbnòì@ õóÜŠóq@ óØ@ A@ ôåïmû‹q@ ôåïu@ ôÙŽïåîóàû†@ ói@ çìíiaŠ†Šü @†‹Ø@çbîŠü‚@bîØói@õó’ó @õn“q@Lìíibàbïm@ TLD@béäóm@ óØ@ NF1, NF3, NF10, NF11,@ôäbØòìa‹åŽïéÙŽïq @NôàŽíŽíjîaŠ@õtrans-translation@õòŠbiŠò†@ììŠ@ómb‚ò†@Žõíä@ôån“îóŽïm@•óàó÷@óØ @UGA@õŠüu@óÜ@çbïäbnòì@õóÜŠóq@çbîóØ@ tmRNA@óØ@õóäaìa‹åŽïéÙŽïq@ìó÷@LçbØóàb®ó÷@ói@´ójn“qói @óÜ@çbïäbnòì@õóÜŠóq@çbîóØ@ tmRNA@óØ@‹m@õóäaìó÷@ìbš@óÜ@çóØò†@Šü‚@bîØói@õó’ó @õn“q@‹m@ìaìóm@ŠûŒ@ò @ @Nò@UAA@õŠüu trans- @ õóû‹q@ MLD@ ì@ PK4-PK2,PK1@ õòìóåî‹@ óØ@ ìíi@ a‹Ù’b÷@ •òìó÷@ LòìóÜ‹mbîŒ @ôióåï›åi@óØ@pìóØŠò†@ì@†‹Ø@çbîŠü‚@bîØói@õó’ó @õn“q@óäaìa‹åŽïéÙŽïq@ìó÷@ómaìóØ@La†óåÙŽïm@õ@ Translation @ @Nóîóè@a†@tmRNA@õŽïu@óÜ@çbïä‹ @ôÙŽïÜûŠ@òìó÷@õ‹ióÜ@LóØóû‹q@üi@çìíióä
- B-
ón‚íq ón‚íq
@õbŽîŠ@ a†@ E coli@ õbîØói@ óÜ@ HtranslationI@ ça‹Žï Šòì@ õŠa†‹Ø@ ói@ pòŠbió@ õŠûŒ@ ô‹q@ ó“ï÷@ ãó÷ @tmRNA@ŠóóÜ@ça‹Žï Šòì@ô䆋َïrnò†@üi@@ìb−í @õóÜŠóq@ãüüjîaŠ@çüš@LóäaìóÜ@Nòìì‡äaˆìŠì@tmRNA@ô䆋؊bØ @óØ@õó‹q@ìó÷@bèòìŠóè@NoŽî‹Žî‰iò‡Üóè@òìóÙŽïq@a†@ PK4 – PK2, MLD, -1 triplet, PK1@ôäìíióä@ômbØ@óÜ @õììŠ@ óÜ@ ômójîbm@ ói@ óî@ ôš@ õ†Šì@ ói@ LòìòŠü‚@ bîØói@ õó’ó @ õn“q@ íî†ìóÜ@ õ†Šó @ ôàïäbÙïà@ oŽïÜò† @ @NpbÙi@ŠóóÜ@çbîŠbØ@óäòŠ@tmRNA@óØ@Šü‚@bîØói@@õóäbåïmŽì‹q@ì@µu@ìó÷@ô䆋Ùäb“ïånò†
- C-
@óÜ@tmRNA@ôÜûŠ@ói@pòŠbió@eíä@ôån“îóŽïm @@a†Šü‚@bîØói@õó’ó @ô䆋Ùîn“q
@ @óØóîóàbä @ @ŠóØìaìóm@ôÙŽï’ói@Ûòì@òìa‹Ø@ôäbáŽïÝ@õüÙäaŒ@óÜ@oäaŒ@ôvŽïÜüØ@ô’óÙ“Žïq@ @ @óÜ@oäaŒ@õŠónbà@õóÝq@ôäbåŽïè@oò†ói@üi@
@ @õ†Šó @ôuŽíÜŽíîbi
çóîý@óÜ
Š†bÕÜa‡jÈ@b–@óàóy@çbïä
@ @@2003@M@ a†@ðuüÜüîbi@óÜ@‘üîŠüÜbØói @ @ôäbáŽïÝ@õüÙäaŒ
ôn’ŠóqŠó@ói
âî‹ÙÜa‡jÈ@Óì‹Èóà@†bèŠóÐN† Šò†ò‡îŠbî@õŠüïÐû‹q
ça‡äójŽîŠ ãòìì†@ôäíäbØ @ @@@@@@@@2710@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@2011
@ò‡äbà@À@tmRNA@Šì†@À@‡î‡u@âéÐ óïqbÉÜa@í¹ @@
@
@@
@ @óÜbŠ @Þïä pbjÝnà@æà@övØ@óïäbáïÝÜa@óÉàbu@À@ãíÝÉÜa@óïÝØ@ݪ@¶g@óà‡Õà@ @ @À@nubà@óuŠ† @ @ðøîu@ðuíÜíîbi @@ @@
@ @ÞjÔ@æà
@ @Š†bÕÜa‡jÈ@b–@ó¼@çbïä @@òbï¨a@ãíÝÈ@À@‘íîŠíÜbÙi
@@2003M@óïäbáïÝÜa@óÉàbu
@@ @ @Óa‹’bi
@ @âî‹ÙÜa‡jÈ@Óì‹Éà@†bè‹Ð@N† @@‡Èbà@ˆbna
@@ @@ @@
@ðäbrÜa@çíäbØ@ @@ @@ @@ @@ @@@@@@@@@@@@@@@@@@@@@@@@@@@@ @ça‡äójŽîŠ @ @@@@@@@@@@@@@@@@2011 @@@@@@@@@@@ @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@ @@ @@@@@@@@@@@@@@@@@@@@@@@@@@@@@2710
