HLA-B51 DETECTION IN PATIENTS WITH RECURRENT APHTHOUS ULCERATION, AN APPROACH FOR THE DIAGNOSIS OF BEHCET’S DISEASE IN SULAIMANI
A Thesis Submitted to the Council of College of Dentistry, University of Sulaimani in Partial Fulfillment of the Requirements for the Degree of Master of Science in Oral Medicine
BY Sabria Salih Faraj B.D.S
Supervised by Professor Nazar G. Talabani Iraq-Sulaimani
2011 A.C.
2711 K.
1432 A.H.
**ِ** ﺑِﺴْﻢِ اﻟﻠﱠﮫِ اﻟﺮﱠﺣْﻤَٰﻦِ اﻟﺮﱠﺣِﯿﻢ ُوَﻟَﻮْ أَﻧﱠﻤَﺎ ﻓِﻲ اﻟْﺄَرْضِ ﻣِﻦْ ﺷَﺠَﺮَةٍ أَﻗْﻠَﺎمٌ وَاﻟْﺒَﺤْﺮ ﯾَﻤُﺪﱡهُ ﻣِﻦْ ﺑَﻌْﺪِهِ ﺳَﺒْﻌَﺔُ أَﺑْﺤُﺮٍ ﻣَﺎ ﻧَﻔِﺪَتْ ﻛَﻠِﻤَﺎتُ اﻟﻠﱠﮫِ ۗ إِنﱠ ٌاﻟﻠﱠﮫَ ﻋَﺰِﯾﺰٌ ﺣَﻜِﯿﻢ (27) ﺳﻮرة ﻟﻘﻤﺎن آﯾﺔ
In the Name of Allâh, the Most Gracious, the Most Merciful. And if all the trees on the earth were pens and the sea (were ink wherewith to write), with seven seas behind it to add to its (supply), yet the Words of Allâh would not be exhausted. Verily, Allâh is All-Mighty, All-Wise
Supervisor’s Declaration I certify that this thesis has been prepared by the postgraduate student Sabria Salih Faraj under my supervision at the Department of Oral Diagnosis and Medicine, College of Dentistry, University of Sulaimani as a partial fulfillment of the requirements for the degree of Master of Science in Oral Medicine.
Supervisor Prof. Dr. Nazar G. Talabani B.D.S., Ph.D
Committee's Certification We, the member of the Examining Committee, certify that we have read this thesis and have examined the postgraduate student Sabria Salih Faraj in its contents and that in our opinion it meets the standard of a thesis for the degree of Master of Science in Oral Medicine.
Signature: Name: Dr. Mohammed Omer Mohammed Assist. Prof. M.B.Ch.B.,D.I.M,F.I.C.M.S. (Med.) Date:
/
/ 2011
(Chairman)
Signature: Name: Dr. Shwan Kamal Rachid
Signature: Name: Dr. Saeed Abdul-latif
Assist. Prof.
Lecturer
B.Sc.,M.Sc.,Ph.D. Date:
/
B.D.S., M.Sc.
/ 2011
Date:
(Member)
/
/ 2011
(Member)
Approval of the Council of the College of Dentistry, University of Sulaimani Dr. Falah A. Hussein B.D.S, H.D.D, F.I.C.M.S (Dean)
Linguistic Evaluation Certification I hereby certify that this thesis has been read and checked by me and after indicating all the grammatical and spelling mistakes, the thesis was given again to the candidate to make the adequate corrections. After the second reading, I found that the candidate corrected the indicated mistakes. Therefore, I certify that this thesis is free from mistakes.
Signature: Name: Kazi Hassan Saleh Date: 30/03/2011 University of Sulaimani / College of Languages/ English Department.
♣ Dedication ♣ ♣ To My Wonderful Mother.... ♣ To Prof. Dr. Nazar Talabani...... ♣ To Children Who Have Lost Their Parents...
♣With My Love And Respect♣
------------------------------------------------------------------------------------- Acknowledgments----
Acknowledgements First of all, I thank God for all the grace and for planting the soul of patience and faith in me to complete this study. I would like to express my appreciation and deepest gratitude to my supervisor Prof. Nazar G.Talabani, for his guidance, advice, and encouragement. I cannot pass an acknowledgment of my great admiration of his professionalism and his sensitivity to the more human side of life in general. My thanks to Ministry of Health and Ministry of High Education. I would like to convey my deep thanks to the Dean of the Collage of Dentistry, University of Sulaimani Dr. Falah A. Hussein. I am deeply indebted to Dr. Muhamad Yussif (Dermatologist) for his scientific support and assistance during the selection of patients. I would like to thank the director and staff in Kurdistan Institute for Strategic Studies and Scientific Researches for allowing me to complete my work there. Special thanks to Mr. Nawzad O. Ahmad (M.Sc. student in molecular biology), Miss. Meryum Saleh (M.Sc. student in clinical biochemistry), and Lecturer Omed KG Ismael (College of Science/ Chemistry Department), Miss. Banaz Omer (Master student in College of Biology), Miss. Bayan Hamma Amen (Master student in College of Biology), Dr. Dler for their enormous support during my work. I would like to thank all instructors and friends who helped me to complete this work and all individuals who helped me in any way throughout my work and study and apologize to them for not being able to mention them by name. ♣ With my love and respect for all ♣ Sabria
I
---------------------------------------------------------------------------------------------------Abstract---
Abstract Back ground: Recurrent oral aphthous ulcer (RAU) is one of the most common recurring and poorly understood mucosal disorder. It is characterized by varying frequency of painful ulcer, which occurs either without any other disorder or it is a symptom of other systemic disorders such as gastrointestinal disorders, haematinic deficiency, or Behcet's disease. Behcet's
disease
(BD)
is
a
multi-systemic
disorder
with
mucocutaneous, ocular, arthritic, vascular, and central nervous system involvement. Mostly, the first symptom is oral RAU or rarely genital ulcer. It affects both sexes at any age but mostly occurs in the third decade of life. The incidence of BD is varying according to geographical areas. The highest incidence of BD is in the populations along the Silk Road stretching to the countries of the Mediterranean regions such as Turkey, and the lowest level in western countries. The exact cause of BD is not clear but many researchers found multiple causative factors for BD, and highly significant association between HLA-B and Behest's disease specially HLA-B51 which has been noticed, and the encoded gen is located on the short arms of chromosome number 6. Aim of the Study: Is to detect HLA-B51gen in the patient with RAU and BD in Sulaimani governorate. Materials and Methods: Methods: 60 persons {31 femal (51.6%) and 29 male (48.3%)} participated in this study, consisted of 40 patients and 20 healthy control who had not any signs and symptoms of BD. The 40 patients were divided into 4 groups. The first group was RAU group consisted of 15 patients (37.5 %) who had only oral RAU. The remained 25 patients were subdivided into 3 subgroups according to the diagnostic criteria of the BD Research Committee of Japan (1987 revision). The second group was suspected BD group consisted of 9 patients (22.5 %) (6F, 3M).The third group was incomplete BD group consisted of 10 patients (25%), (1F, 9M). The fourth group was complete BD group II
---------------------------------------------------------------------------------------------------Abstract---
consisted of 6 patients (15%), (4F, 2M). DNA was extracted from the blood of all the 60 persons by salting out method, and then the amplification of HLA-B51 gene was performed by polymerase chain reaction (PCR) with specific primer. Results: The results showed that HLA-B51 was positive in 26.6% in RAU group, 55.5% in suspected BD, 30% incomplete BD, 100% complete BD and 15% in the control group. The most significant finding in this study was a highly significant association between HLAB51 and Behest's disease and HLAB51 had the major role in occurring BD, but it was not the exact cause. It might have a major predisposing factor, because this gene was also detected in the healthy controls. Conclusions:The patients who have RAU more than three times per year and have poor response to treatment should be considered to do HLA-B51 gene detection after the whole causes of RAU are excluded or have any other symptoms related to BD.
III
---------------------------------------------------------------------------------------- List of Content ----
List of Contents
Page
Contents Acknowledgements
Ι
Abstract
ΙΙ
List of Contents
ΙV
List of Tables
ΙX
List of Figures
X
List of Abbreviations
XΙ
Introduction
1
Aim of Study
2
Chapter One: Literature Review
3
1.1 Recurrent Aphthous Ulcer
3
1.1.1 Definition of RAU
4
1.1.2 Classification of RAU
4
1.1.2.1 Minor RAU (MiRAU)
4
1.1.2.2 Major RAU (MaRAU)
5
1.1.2.3 Herpetiform Ulceration (HuRAU), (unrelated to herpetic stomatitis)
5
1.1.3 Epidemiology of RAU
5
1.1.4 Age and sex
6
1.1.5 Etiology
6
1.2.5.1Trauma
7
1.1.5.2 Food allergy
7
1.1..5.3 Chemical exposure
7
1.1.5.4 Stress
8
1.1.5.5 Hematinic deficiencies
8
1.1.5.6 Hormonal changes
9
1.1.5.7 Infectious factors
9
1.1.5.8 Genetic factors
10
1.1.5.9 Systemic diseases
10
1) Gastrointestinal diseases
10 IV
---------------------------------------------------------------------------------------- List of Content ----
2) HIV-associated RAU
11
3) Other diseases
11
1.2 Behcet’s syndrome
11
1.2. 1 Definition
11
1.2. 2 Epidemiology
12
1.2.3 Clinical features
13
1.2.3.1 Recurrent oral (Aphthous-like) Ulcerations
13
1.2.3.2 Genital ulcer
14
1.2.3.3 Cutaneous lesions
14
1.2.3. 4 Ocular manifestations
16
1.2.3.5 Joint manifestations
17
1.2.3.6 Gastrointestinal manifestations
17
1.2.3.7 Neurological features
17
1.2.3.8 Vascular and cardiac manifestations
18
1.2.3.9 Renal manifestation
18
1.2.4 Etiology
19
1.2.4.1 Genetic factors (HLA-B51 and other MHC associations)
19
1.2.4.2 Bacterial cause
20
1.2.4.3 Viral etiology
21
1.2.4.4 Heat shock proteins
21
1.2.5 Pathophysiology of BD
22
1.2.6 Pathogenesis of vascular involvement
23
1.2.7 Immunology in BD
24
1.2.8 Diagnosis of BD
24
1.2.9 Major Histocompatibility Complex (MHC)
25
1.3 Polymerase chain reaction
30
1.3.1 Definition
30
1.3.2 PCR principles
31
1.3.2.1 Denaturation
31
V
---------------------------------------------------------------------------------------- List of Content ----
1.3.2.2 Annealing
31
1.3.2.3 Elongation
31
Chapter Two: Materials and Methods
33
2.1 Materials and instruments
33
2.1.1 Apparatuses
33
2.1.2 Instruments
34
2.1.3 Glassware
35
2.1.4 Chemical agents
35
2.1.5 DNA primers
36
2.1.6 Buffers and solutions
36
2.1.6.1 Buffer A (Red blood cell lyses buffer)
36
2.1.6.2 Buffer B (Proteinase K buffer)
37
2.1.6.3 SDS 10%
37
2.1.6.4 Proteinase K solution (19.6 mg/ml)
38
2.1.6.5 5.3 M NaCl solution
38
2.1.6.6 TrisHCl (20 mM)
38
2.1.6.7 Ethanol 70%
38
2.1.6.8 Isopropanol
38
2.1.6.9 5X TBE (Tris-Borate-EDTA)
38
2.1.6.10 1X TBE (Tris-Borate-EDTA)
38
2.1.6.11 0.5 M Na2EDTA
38
2.1.6.12 Ethidium bromide
38
2.1.6.13 DNA Ladder
39
2.1.6.14 Primers
39
2.1.6.15 DNA loading dye
39
2.1.6.16 Master Mix
39
2.1.6.17 Preparation of 2% Agarose gel
39
2.2 Persons and Questioner
40
2.2.1 Persons
40
VI
---------------------------------------------------------------------------------------- List of Content ----
A) Patients
41
B) Controls group
42
2.3 Methods
43
2.3.1 Case sheet
43
2.3.2 Clinical examination
44
2.3.3 Specimens collection
44
2.3.4 Extraction of genomic DNA from whole blood by salting out
45
2.3.5 Run for extracted DNA
46
2.3.6 PCR amplification
46
2.3.7 Protocol of PCR technique
47 47
Procedure 2.3.8 Gel analysation for Pcr product
48
2.3.9 Sterilization methods
49
2.4 Statistical analysis
49
Chapter Three: Results
50
3.1 The Persons
50
3.2 Clinical features of Patients groups
50
3.3 Genomic DNA extraction
52
3.4 Amplification of HLA-B51 gene
53
3.4.1 Amplification of HLA-B51 gene in RAU group
53
3.4.2 Amplification of HLA-B51 gene in Suspected BD group
54
3.4.3 Amplification of HLA-B51 gene in Incomplete BD group
56
3.4.4 Amplification of HLA-B51 gene in Complete BD group
57
3.4.5 Amplification of HLA-B51 gen in healthy control group
58
Chapter four: Discussion Discussion
60
4.1 The samples
60
4.2 Clinical features
60
4.3 DNA extraction
61
4.4 Amplification of HLA-B51 gene
61
Chapter five: Conclusions and Suggestions 64
5.1 Conclusions VII
---------------------------------------------------------------------------------------- List of Content ----
5.2 Recommendation
65
References
66
Appendixes
93
A) sequence of HLA-B51 gene
93
B) Form of case sheet
95
VIII
--------------------------------------------------------------------------------- List of Tables ----
List of Tables
Table No.
1.1
Table Title
Page No.
1.2 2.1
Incidence of BD according to different studies in different countries Criteria for the diagnosis of BD List of apparatuses
24 33
2.2 2.3
List of instruments List of glassware
34 35
2.4
List of chemical agents
35
2.5
36
2.6
The sequences and position of primers used for the DNA amplification Distribution of the persons according the groups
2.7
patient Exclusion Criteria
41
2.9
The reaction mixture (25µl) for PCR
48
3.1 3.2
Distribution of the groups according the gender Clinical features of patient groups
50 51
3.3
Prevalence of HLA-B51 gene positive according to the patients
52
IX
13
40
-------------------------------------------------------------------------------- List of Figures----
List of Figures Figure No.
1.1 1.2 1.3
Figure Title
Genetic region of the major histocompatibility complex in men. Diagrammatic representation of a human leucocyte antigen (HLA) class I molecule and HLA class II molecule A model of HLA-B51 molecule
Page No.
28 29 30
Displays the steps performed during a normal PCR 1.4
32
cycle Genomic DNA extraction from venous blood of patients
3.1
group by salting out method and run on 2% of agarose gel
52
Genomic DNA extraction from venous blood of control 3.2 3.3 3.4
subjects by salting out method and run on 2% of agarose gel Amplification of HLA-B51 gene in RAU patients. Amplification of HLA-B51 gene in Suspected BD patients.
53 54 55
Amplification of HLA-B51 gene in Incomplete BD patients. 3.5
56
3.6
Amplification of HLA-B51 gene in Complete BD patients.
57
3.7
Amplification of HLA-B51 gene in control subjects
58
X
-----------------------------------------------------------------------------------List of Abbreviations----
List of Abbreviations 3’
Three Carbon Pentose Sugar DNA end
5’
Fifth Carbon Pentose Sugar DNA end
+ bp
Positive Negative Base Pair
B.C. BD C0 CNS CMV CRP Da DNA DW dNTP ds DNA EDTA ESR F GIT HuRAU HSV H.pylori HLA HIV
Before Christ Behcet’s disease Centigrade Central Nervous System Cytomegalo Virus C-reactive Protein Dalton Deoxyribonucleic acid Distilled Water Deoxyribo nucleoside 5´-Triphosphates Double stranded DNA Ethylene diamine tetra acetic acid Erythrocyte sedimentation rate Female Gastrointestinal truct Herpetiform Recurrent Aphthous Ulcer Herpes Simplex virus Helicobacter pylori Human Leukocyte Antigen Human Immunodeficiency Virus
HHV-6
Human Herpes Virus type 6
HOCl
Hypochlorous acid
HSP
Heat shock proteins
IgG IgM IgD ISG IL-6
Immunoglobulin type G Immunoglobulin type M Immunoglobulin type D International Study Group for Behcet's Disease Inter-Leuken 6 XI
-----------------------------------------------------------------------------------List of Abbreviations----
Kb MHC
Kilo base Major Histocompatibility Complex
MgCL2
Magnesium Chloride
M
Male
mbp
mega base pair
MiRAU min MICA M mv μL ml MW MPO N PCR pg pmol ROS RAU Rpm ssDNA Th Tris TNF- , TCRs UV VZV W
Minor Recerrent Aphthous Ulcer Minute Major histocompatibility complex class I related gene A Molar Milli Volt Micro liter Milliliter Molecular weight Myeloperoxidase Normality Polymerase Chain Reaction Picko gram Picko mole Reactive oxygen species Recerrent Aphthous Ulcer Rounds per minute Single stranded DNA T- helper cell Tris hydroxymethyl aminomethane Tissue necrosis factor alpha T cell receptors Ultraviolet Varescella zoster virus Watt
XII
---------------------------------------------------------------------------------------------Introduction----
Introduction Recurrent aphthous ulcer (RAU) represents a very common but poorly understood mucosal disorder. It occurs in men and women of all ages, races and geographic regions. It is estimated that at least 1 in 5 individuals has at least once been afflicted with aphthous ulcers (Natah et al., 2004) The condition is classified as minor, major, and herpetiform on the basis of ulcer size and number. Attacks may be precipitated by local trauma, psychological disorder (like stress), food intake, drugs, hormonal changes and vitamin and trace element deficiencies (Natah et al., 2004). Local and systemic conditions and genetic, immunological and microbial factors all may play a role in the pathogenesis of recurrent aphthous ulceration. However, to date, no principal cause has been discovered. Since the etiology is unknown, diagnosis is entirely based on history and clinical criteria and no laboratory procedures exist to confirm the diagnosis. Although RAU may be a marker of an underlying systemic illness such as celiac disease, or may present as one of the features of BD, in most cases no additional body systems are affected, and patients otherwise remain fit and well (Seung-H.R. et al., 2005).
Behçet’s disease (BD) is a chronic, relapsing, multisystem inflammatory disorder of unknown aetiology with complicated and diversified clinical features of mucocutaneous lesions and ocular, vascular, articular, gastrointestinal, urogential, pulmonary and neurological involvement (Yazici et al., 2001, Zierhut et al., 2003,Yurdakul et al., 2004).
The pathogenesis of BD is probably mediated by a combination of factors involving genetic factors, immune factors, environmental factors and infectious agents. A complex genetic background leading to a pro-inflammatory, innateimmune system derived activation perpetuated by adaptive immune responses
-1-
---------------------------------------------------------------------------------------------Introduction----
against environmental and auto-antigens is accepted as the main pathogenic mechanism in BD (Ghate and Jorizzo, 1999). The disease exhibits a distinct geographic variation. It is particularly prevalent along the ancient “Silk Road” countries from Northwest China to the Mediterranean basin, although BD has been reported all over the world. Turkey has the highest incidence of BD in the world (80-300 per 100,000). In contrast, the prevalence is quite low in USA (1: 1, 500,000) (Yingbin et al., 2009).
There are several clues supporting involvement of genetic factors in the pathogenesis of BD, which include familial aggregation, distinct geographic distribution, and its association with the HLA-B51 gene (Gül, 2001). HLA-B is part of a family of genes called the human leukocyte antigen (HLA) complex. The HLA-B gene is located on the short (p) arm of chromosome 6 at position 21.3, from base pair 31,429,845 to base pair 31,432,923, (Hill et al., 1991).
Aim of the study The aim of this study is to identify correlation between patients with RAU, BD and present of HLA-B51 gene in among them and healthy control in Sulaimani governorate.
-2-
------------------------------------------------------------------------------------ Literatures Review ----
Chapter One Literature Review 1.1 Recurrent Aphthous Ulcer Recurrent aphthous ulcer (RAU) (also referred to as aphthae, or canker sores) seems to be as old as humanity itself. The Father of Medicine, Hippocrates (460 to 370 BC) is credited with the first use of the term “aphthae” in relation to focal painful inflammation of the oral mucosa, although valid clinical description of RAU only appeared in 1898 in a paper published by Mikulicz and Kümmel (Mikulicz von and Kümmel 1898; Sircus et al., 1957).
Recurrent aphthous stomatitis is one of the most common oral ailments, affects the lining tissues of the mouth. The disease is characterized by recurring painful ulcers of the mouth that are round or ovoid and have inflammatory halos. The ulcers typically appear first in childhood (patients often have a family history of recurrent aphthous stomatitis) and tend to abate around the third decade (Scully et al., 2003; Akintoye and Greenberg 2005). The frequency of aphthous ulcers is up to 20-25% in the general population, and 3-month recurrence rates are as high as 50% (Barrons 2001; Scully and Felix 2005). The term “recurrent aphthous stomatitis” should be reserved for recurrent ulcers confined to the mouth and seen in the absence of systemic disease (Femiano et al., 2005). However, ulcers that resemble recurrent aphthous stomatitis in some respects, such as their clinical appearance, can be found in systemic disorders such as Behçet’s syndrome (Verpilleux
et al., 1999),
gastrointestinal diseases such as gluten-sensitive enteropathy (Hunter et al., 1993) or inflammatory bowel disease (Rehberger et al., 1998; Sedghizadeh et al., 2002) , and immunodeficiency syndromes such as infection with the human immunodeficiency virus (HIV) (MacPhail and Greenspan 1997) or cyclic neutropenia (Notani et al., 2000). -3-
------------------------------------------------------------------------------------ Literatures Review ----
Cross-sectional studies suggest that recurrent aphthous stomatitis is more common in women, in people under the age of 40 years, in white, in nonsmokers, and in people of high socioeconomic status (Rivera-Hidalgo et al., 2004; Shulman 2004). Four stages of development of such ulcers have been described. The premonitory stage occurs within the first 24 hours, as patients may feel a tingling or mild irritant sensation. This is followed by the pre ulcerative stage, notable by red papules surrounded by an erythematous halo. With painful ulceration of the papule begins the ulcerative stage, which may last up to several weeks. The healing stage lasts in proportion to the severity of the ulcers (Petersen and Baughman 1996).
1.1.1 Definition of RAU RAU is an inflammatory condition of unknown etiology characterized by painful, recurrent (single or multiple) ulcerations of the oral mucosa (Graykowski et al., 1966).
1.1.2 Classification of RAU Stanley (1972) classifies RAU into three different variants; minor aphthous ulcers, major aphthous ulcers, and herpetiform ulcers, while Rogers (2002) classifies RAU into simple aphthosis and complex aphthosis.
1.1.2.1 Minor RAU (Mi RAU) This is the most common variant occuring in about 80 – 95 % of all RAU patients (Porter et al., 1998). It is 2 to 8 mm in diameter, may be single or multiple and round or oval (Tilliss and McDowell 2002; Scully and Felix 2005), usually occurs on non-keratinized labial, buccal mucosa and the floor of the mouth, but is uncommon on the keratinized gingiva, palate, or dorsum of the tongue (Field et al., 1992). Two to eight crops of lesions occur per year, lasting 7 to 14 days and then heal without scars (Jablonski, 1992).
-4-
------------------------------------------------------------------------------------ Literatures Review ----
1.1.2.2 Major RAU (Ma RAU) This is sometimes termed "periadenitis mucosa necrotica recurrence" it is much less common, accounts for 10-15% of RAU cases (Rennie et al., 1985). These ulcers are larger than minor ulcers often 1 cm or more in diameter with 1-2 lesions occurring at a time associated with severe pain, lasting 6 or more weeks and often heal with scarring. Ma RAU has a predilection for the lips, soft palate, and fauces, but can affect any site (Scully and Porter 1989). This is more common in the immune-deficient population, and is associated with severe pain, lasting 6 or more weeks (Scully et al., 2003).
1.1.2.3 Herpetiform
Ulceration
(HuRAU),
(unrelated
to
herpetic stomatitis) It is less common variety and accounts for only 5-10% of cases, and comprises ulcers that are initially multiple and pinpoint. Ulcers are particularly painful, last several weeks. They appear on both non-keratinized and keratinized mucosa and can affect the dorsum of the tongue and the hard palate, as well as the buccal and lip mucosae ( Tilliss and McDowell, 2002).
Simple aphthosis is characterized by episodic, short lived flares of aphthous ulcer, which are few in number, heal in 3-7 days and occur 3-6 times yearly. Rogers stated that complex aphthosis is aphthous ulcer troublesome affliction with multiple lesion, large lesions, slow healing and short remission or continuous ulceration, therefore patients with complex aphthosis may have oral and genital aphthosis, some patients with complex aphthosis develop BD (Rogers 2002).
1.1.3 Epidemiology of RAU RAU is considered as the most common oral mucosal disease in children and adults (Rogers, 1997). It seems to be more common in children and adults of -5-
------------------------------------------------------------------------------------ Literatures Review ----
higher, rather than lower, socio-economic status (Ship, 1996; Crivelli et al., 1988). About 20% of general population suffer from RAU during their life (Sircus et al., 1957). Prevalence of RAU had great variation from 5-66% according to a group of studies ( Miller and Ship 1977;chams et al., 2001). RAU is found in 2% of Swedish adults (Axéll and Henricsson, 1985) while infrequent in Bedouin Arabs (Fahmy, 1976) and is more common in Western countries (Embil et al., 1975).
1.1.4 Age and sex The onset of the disease occurred between age of 10-30 years, rarely occurred at age of 50 years for the first time (Nevill et al., 1995). RAU is found in about 1% of children of developed countries (Kleinman et al., 1994), but 40% of children (aged 15 years or less) may have a history of RAU, with a female predisposition in affected children (Field et al., 1992). In the adult population 60-85% of patients who have RAU appears before the age of 30 years (Rennie et al., 1985) with a slight predominance found for females (Axéll and Henricsson 1985). Cooke (1961) and Lehner (1968) have found in their studies that RAU is more in females than males the ratio varies from 2:1.
1.1.5 Etiology The exact etiology for recurrent aphthous stomatitis is not known, while a diversity of aetiological factors have been implicated in the pathogeneesis of RAS, these aetiological factors are called precipitating factors. These may be conveniently divided into host factors, genetics, nutrition, gastrointestinal disease, hormones, psychological, environmental factors, infection, trauma, allergy, chemical exposure (chemical irritants) and smoking (Ship 1997). Immune-complex mediated vasculitis and autoantibodies against the oral mucosal membranes have been suggested due to the histopathological -6-
------------------------------------------------------------------------------------ Literatures Review ----
features (Rodu and Mattingly 1992).While Porter et al. (1998) in the immunopathogeneetic studies detected that the ulcerations might be caused by cytotoxic action of lymphocytes and monocytes on the oral epithelium with an unknown trigger.
1.1.5.1 Trauma It has long been claimed to initiate ulcers in susceptible individuals. Wray D. et al., (1981) showed that minor trauma could induce ulcers in patients that are susceptible, but not in controls and Matsumuras et al., (1979) suggested that this effect is mediated by histamine, a hypothesis supported by similar work carried out in patients with Behcet's syndrome (Wong et al., 1984).
1.1.5.2 Food allergy Foods which can induce histamine release from peripheral blood basophils from patients with aphthae also can induce ulceration (Wray et al., 1982), such foods include coffee, chocolate, potatoes, cheese, nuts, cow-milk, figs, citrus fruits, and gluten-containing foods, (Petersen and Baughman 1996).
1.1.5.3 Chemical exposure Chemical agent like Sodium Laoryl Sulfate in the tooth paste and its effect was detected by Taback et al., (1982) in a paper on the role of salivary mucine in the protection of the oral cavity expressed that it had a significant reduction in numbers of ulcers when the patients used Sodium Laoryl Sulfate (SLS) free toothpaste that is used as detergent in dentifrices for 3 months. The mean reduction was about 70% compared with the pre-study period during which the subjects brushed with their regular dentifrice, the reasons for these results are not clear, but it appears likely that SLS may denature the mucosal mucin layer. Mucins are principal organic constituents of mucus, the visco-
-7-
------------------------------------------------------------------------------------ Literatures Review ----
elastic material that covers all mucosal surfaces, and evidence suggests that mucins play an integral role in non-immune protection of the mucosal surfaces. Herloson and Barkroll (1994) also show that Sodium Laoryl sulfate may increase the occurrence of oral ulceration. Smoking appears to inhibit the natural course of the disease and in older individual's ulceration often appears for the first time after cessation of smoking habits. These effects of smoking appear to be systemically mediated, since genital ulceration can also be inhibited by cigarette smoking (Wray 1982). This effect has been associated with a mucoprotective effect through increased keratinazation of the oral mucosa and decreased frequency of aphthae, this may be due to increased thiocynate level in saliva (Herloson and Barkroll 1994).
1.1.5.4 Stress Emotional and physical stress have been implicated in the pathogeneesis of the RAU which is supported by the observation that students and military personnel have a high incidence of oral ulcers (Fischman, 1994), while Gallo et al., (2009) in expretion the lack of a direct correlation between the level of stress and severity of RAS episodes suggest that psychological stress may act as a trigger or modifying factor rather than an etiological factor in susceptible RAS patients.
1.1.5.5 Hematinic deficiencies Deficiencies of iron, folic acid or vitamin B12, singly or in combination, were found in 20% of patients (Wray 1982; Field et al., 1987). Nolan and co-workers (1991) showed that patients who have both RAU and a vitamin B deficiency could benefit from vitamin replacement therapy. Olson et al., (1982) found that vitamin B12, folate and iron deficiencies were not significantly different between the patients with RAU and controls. These wide variations in the findings may be due to differences in genetic -8-
------------------------------------------------------------------------------------ Literatures Review ----
background and dietary habits of examined patients, or the multi-factorial etiology of RAU. Merchant et al., (1977) and Endre (1991) expressed the improvement of RAU patient with zinc sulphate supplementation in doses 220 mg/day that had zinc deficiency.
1.1.5.6 Hormonal changes In some women RAU have related to the onset of menstruation or the luteal phase of menstrual period (McCartan and Sullivan, 1992). A complete remission during pregnancy has been reported (Sircus et al., 1957; Vincent and Lilly, 1992) but with exacerbations occurring in the puerperium (Dolby, 1968). Sircus and co-workers (1957) have reported that almost no men developed RAU after the age of 50 years, whereas 10% of women had their first episode between 50-59 years. Ferguson et al., (1980) have shown the efficacy of depo-progestogenes in controlling such ulceration.
1.1.5.7 Infectious factors Barile and co-workers (1963) isolated Streptococcus oralis (also known as Streptococcus sanguis 2A, or L-forms of streptococci) from an aphthous ulcer lesion. It is believed that antibody formation and complement fixation induced by these streptococci may play a major role in the pathophysiology (Petersen and Baughman (1996). Birek et al., (1999) had detected Helicobacter pylori DNA in swabs from 23 of 32 RAU lesions using polymerase chain reaction (PCR) assay. Several viruses are detected in RAU that have been suggested by several researchers, adenoviruses isolated from oral aphthae (Sallay et al., 1973). Studd et al., (1991) detected HSV-1 DNA in only 2 of 11 biopsies of oral aphthae from RAU patients. VZV-like DNA detected by Pedersen et al.,( 1993), -9-
------------------------------------------------------------------------------------ Literatures Review ----
CMV-DNA by Sun et al., (1996), Epstein-Barr virus (EBV-DNA) by Sun et al., (1998) and HHV-6 by Ghodratnama et al., (1997).
1.1.5.8 Genetic factors Genetic factors have long been felt to be important in the etiology of RAS, the role of genetic factors can be examined in three ways: incidence among family members, HLA types, and HLA segregation. Aphthae have been shown to be more common among the families of affected individuals but no mendelian mode of inheritance has emerged (Sircus et al., 1957; Ship, 1965). Two separate studies in the United Kingdom (Challacombe et al., 1977) and America (Wray et al., 1981) have shown a significant association between RAS and the HLA types, HLA segregation studies, however, have been inconclusive (Wray et al., 1982). These data imply a genetic basis for RAS but with incomplete penetrance, and indicate a susceptibility to ulcerate. Indeed, analysis of twin studies (Miller, ship 1977) shows that RAS is at a maximum of 81% inherited, and that environmental factors play a significant role (Wray,1982).
1.1.5.9 Systemic diseases 1) Gastrointestinal diseases In some people the gluten protein of wheat induce inflammatory changes in the small intestinal mucosa called coeliac disease (gluten-sensitive enteropathy). Ferguson et al., (1980) found that gluten-sensitive enteropathy is present in 5% of patients with RAS, also in this study they expressed that the aphthae usually disappear with appropriate management of the coeliac disease. Regional enteropathy (Crohn’s disease) and ulcerative colitis may cause RAU (Rogers, 1997).
- 10 -
------------------------------------------------------------------------------------ Literatures Review ----
2) HIV-associated RAU Patients with HIV infection have an overall prevalence rate of recurrent aphthae ranging from 1% to 4% (Phelan et al., 1991; Muzyka and Glick, 1994). Although the lesions are mainly oral, with severe episodes, the ulcers are of the minor, major and herpetiform types and are often located on the soft palate, tonsils or tongue, aphthae have been reported in the esophagus and more distal gastrointestinal tract (Bach et al., 1990). Macphail et al., (1991) showed that 66% of HIV patients affected by RAU had the usually uncommon herpetiform or major types and that patients with MaRAU were significantly more immuno-suppressed than those with MiRAU or HuRAU in that they had fewer CD4 and CD8 lymphocytes.
3) Other diseases Some other diseases are related with RAU which are cyclic neutropenia, agranulocytosis, sweet’s syndrome, and periodic fever syndrome (Rogers 1997; Rebberger et al., 1998).
1.2 Behcet’s syndrome 1.2.1 Definition Behcet’s disease (BD) is a chronic multisystemic inflammatory disorder characterized by recurrent oral and geneital ulcers, ocular, joint, and skin lesions (Shimizu et al., 1979; Ohno et al., 1982; Kaklamani et al., 1998; Yurdakul et al., 2004). Involvement of the gastrointestinal tract, central nervous system, or pulmonary vasculature system is less common, but accounts for the majority of mortality associated with the BD (Wallace et al., 1999). Benjamin (2008) reported that For the first time Planner et al., in 1922 reported the first case that had all three manifedtation which are oral and genital ulcers with iritis . - 11 -
------------------------------------------------------------------------------------ Literatures Review ----
The Turkish dermatologist Hulusi Behcet in 1937 had classically described a triad of symptoms including recurrent oral ulcers, recurrent genital ulcers, and eye lesion, from that day this syndrome is known as Behcet’s disease or Behcet’s syndrome (BD), and continuous studies have been done on it in all aspects so far (Behcet 1937). In Iraq many researchs on BD have been done by a Sharquie (1984); ALRawi et al., (1986); Sharquie et al., (1990); Ghafour (1998); Al-Fahad and ALAraji (1999).
1.2.2 Epidemiology This disease is distributed worldwide, but a higher prevalence was found among the Asian and Eurasian populations along the Silk Road stretching to the countries of the Mediterranean region. (Tuzun et al., 1996) with lowest level in western countries (Krause et al. 1999). There have been no reports of clinical cases of BD among Black populations (Jacyk, 1994). The mean age at onset of BD is most common in the third decade, although the age at time of final diagnosis usually is in the fourth decade, both genders can be affected, (Bang et al., 1997).While in some studies record the variation between genders among the patients with BD, there was a high prevalence in adult females in Israeli Jews (Krause et al., 1999, 2001), and in Korea (Bang et al., 2001),while a higher prevalence of BD in males has been found in the Saudi Arabia (AL- Dalaan et al., 1994), Jordan (Al- Aboosi et al., 1996), Spain (Gonzalez-Gay et al., 2000; Baixauli et al., 2001), London and Japan (Muhaya et al., 2000), Iran and Turkey (Gurler et al., 1997; Kaya et al., 2002), and West Indies (Lannuzel et al., 2002). In Iraq, statistically, there is no significant difference between females and males affected by BD (Sharquie et al., 2000). About 2–3% of all affected individuals have childhood-onset BD ( generally defined as definitive BD before the age of 16 years) (Saylan et al., 1999). Onset of BD in children as young as 2 years of age has been reported - 12 -
------------------------------------------------------------------------------------ Literatures Review ----
(Kari et al., 2001). Childhood BD may be more likely to have a vague familial pattern than adulthood disease (Treudler et al., 1999).
Table (1.1) Incidence of BD according to different studies in different countries Country
Incidence
Studies
Turkey
370
Tuzun et al., 1996
Isreal
120
Jaber et al., 2002
Saudi Arabia
20
Kristine 2001
Iran
16.7
Davatchi et al., 1992
Japan
15
Mizuki et al., 2000
French West Indies
3
Lannuzel et al., 2002
Germany
2.26
Zouboulis et al., 1997
Iraq
1.7
Rawi and Neda, 2003
Spain
0.66
Gonzalez-Gay et al., 2000
England
0.64
Kristine 2001
USA*
1
O’Duffy, 1978
*Number of cases of all recorded countries per 100,000 populations for each year, except the USA record per 300,000 populations for each year.
1.2.3 Clinical features Behest's disease has a wide spectrum of clinical features and characterized by highly variable clinical course with recurrences and remissions attacks of oral, geneital, ocular, and skin lesions.
1.2.3.1 Recurrent Oral (Aphthous-like) Ulcerations Ulceration akin to recurrent aphthous stomatitis (RAS) occurs in all patients diagnosed with Behçet’s disease. The oral ulceration is the initial - 13 -
------------------------------------------------------------------------------------ Literatures Review ----
clinical feature of up to 86.5% of adults and children with BD. In Turkey, 3.8% of patients followed up because of recurrent aphthous stomatitis developed BD (Ekmekci et al., 2003). All three types of RAS-like ulcers can arise in BD (Porter et al., 1998). The ulcers are similar to those ulcers have in patients with aphthous ulcers observed in healthy people (Jorizzo, 1986).
1.2.3.2 Genital ulcer The genital ulcers of BD initially manifest as papules or pustules that later ulcerate. The ulcers are usually painful, superficial, and well demarcated and have an edematous border and a yellow fibrin-covered base. The ulcers may be indurated and can become secondarily infected. In males, the ulcers are usually localized on the scrotum and in females, the vulvae. The ulcers usually heal in a few weeks, with scarring (Nazzaro, 1966, Shimizu 1979). The vaginal and vulval ulceration of BD can cause difficulty with micturation, (Kontogiannis and Powell, 2000). Genital ulcers are rarely the initial manifestation of BD, are less common than oral ulcers, and, although arising in both children and adults, (Krause et al., 1999). The lesion recurs less frequently and more frequently occurs in women (Deuter et al., 2002; Somesb et al., 2002).
1.2.3.3 Cutaneous lesions The most frequent cutaneous features of BD are Erythema nodosum-like lesions, papulo-pustular lesions, abscesses, pyoderma gangrenosum-like lesions, palpable purpuric lesion of necrotizing vasculitis are activity of skin to injection and pathergy (Mason et al., 1969). Papulo-pustular lesions are cutaneous sterile folliculitis or acne-like lesions on an erythematous base which initially manifest as papules and evolve - 14 -
------------------------------------------------------------------------------------ Literatures Review ----
into pustules within 24 to 48 hours. These lesions usually arise simultaneously, most frequently on the skin of the back, face, and chest (Lakhanpal et al., 1988). Papulo-pustular lesions may be significantly more likely in BD patients with a positive pathergy test (Alpsoy et al., 1998). Erythema nodosum-like lesions frequently occur in BD; these are most frequently observed on the lower extremities (although they can occur on the upper extremities) and are characterized by painful purplish nodules (Saylan et al., 1999). It usually appears red, tender lumps, take longer to heal than papulopustular lesions, it may leave pigmented atrophic scar (Sharquie 1990). The non-specific hyperactivity reaction observed in response to minor cutaneous trauma in BD is known as the pathergy phenomenon. It was initially described by Blobner in 1937 and later was reviewed by Katzenellenbogene and Feuerman (1965). In a positive pathergy test, pricking the skin with a sterile needle, with or without the injection of a small amount of saline, gives rise to a 1-2 mm papule usually surrounded by an erythematous halo. The papule may remain unchanged or transform into a 1- 5mm pustule. The pustule becomes prominent 24 hours after needle insertion, becomes maximum in size after 48 hours, and disappears within 4-5 days. Interaction of cellular adhesion molecules together with endothelial proliferation may play an important role in the formation of skin pathergy reaction lesions in patients with BD (Inaloz et al., 2004). The pathergy phenomenon is usually positive during the active phases of BD and becomes negative or weakly positive when disease remits (Fresko et al., 1993). The pathergy test may not be specific to BD indeed, it has been observed in healthy individuals (Aral et al., 1986).
- 15 -
------------------------------------------------------------------------------------ Literatures Review ----
Many factors influence the results of the pathergy test: needle gauge, sharpness of the tip, direction of needle penetration, in situ injection or just a skin puncture with no injection, the number of skin punctures, the delay in reading the result, the description of a positive reaction, and, finally, where to draw the line between a positive and a negative result. All these factors may influence the pathergy test result (Saatchi et al., 2003), and since the pathergy test is not standardized, it is perhaps unsurprising that a wide range of different results has been obtained by different groups (Davatchi et al., 2003) . The variable association of pathergy test positivity with BD and its occurrence among healthy subjects prevent it from being used as a screening test (Yurdakul et al., 1988). An alternative and more quantitative method of testing for abnormal inflammatory responsiveness is to examine erythema following the injection of monosodium urate crystals into the forearm skin. Normally, erythema is maximal 24 hours after injection and has resolved by 48 hours. In contrast, the response in BD tends to persist for 48 hours or longer. In Turkish patients, this test was 61% sensitive and 100% specific for BD when compared with other rheumatological diseases (Cakir et al., 1991).
1.2. 3.4 Ocular manifestations Ocular manifestations in BD patients include anterior uveitis, posterior uveitis, bilateral swelling of the optic nerve head, retinal vasculitis, and bilateral lamellar macular hole. Ocular involvement is usually bilateral, with different severity between eyes. Ocular symptoms vary from a gritty sensation and blurring of vision to severe pain and blindness (Al- Aboosi et al., 1996). These manifestations have been reported in 27 % to 90% of patients with BD (Bietti and Bruna, 1966) and this disease may lead to visual loss in about five years if not treated (Shimizu et al., 1979). Behçet originally described hypopyon as a - 16 -
------------------------------------------------------------------------------------ Literatures Review ----
cause of blindness (Behçet, 1937). Inflammatory eye disease develops at least three years after the oral ulceration of BD (Imai, 1971). The presence of HLAB51 increases susceptibility to ocular disease (Nishiyama et al., 2001).
1.2.3.5 Joint manifestations These are arthralgia or arthritis and found in 18 % to 64% of patients. Relapsing pain, swelling, tenderness, and redness involve usually the knees, ankles, hands, wrists, elbows, and feet, and, unlike in rheumatoid arthritis, small joints are rarely affected (Mason and Barnes, 1969) Arthralgia or arthritis can be the first manifestation of BD in 0.5% to 7% of patients (Gurler et al., 1997; Zouboulis et al., 1997). Arthritis in BD is a recurrent seronegative arthritisand non-specific synovitis (Jorizzo and Rogers, 1990; Stratigos et al., 1992; Önder and Gürer, 1999).
1.2. 3.6 Gastrointestinal manifestations GIT involvement in BD most commonly due to mucosal ulceration can occur throughout the GIT, but with predominantly occurs in the ileocecal region (Jankowski et al., 1992), this ulcer leads to many symptoms according to the affected site in GIT, which are abdominal pain, diarrhea (occasionally bloody), intestinal perforation, and rectal bleeding (Wmadant et al., 2002). Emward et al., (2002) in their study show that the colon is the site most frequently involved. In children BD the incidence of abdominal pain and diarrhea is higher than the adult BD (Kone-Paut et al., 2002).
1.2. 3.7 Neurological features Neurological involvement predominantly involves the central nervous system (CNS), and may also involve the muscle and peripheral nerves These involvements are less frequent; 10% to 29 % (Alemah and Bignami ,1966), - 17 -
------------------------------------------------------------------------------------ Literatures Review ----
while according to the studies of Gonzalez-Gay et al., (2000); Chen and Chang, (2001) the frequency is from 2.2 to 44% in patients with BD. Three of the most common manifestations are pseudo-bulbar palsy, multiple sclerosis, and general paresis (Alemah and Bignami, 1966). The headache seems to be the most common clinical feature of neurological disease in BD, affecting up to 47% of patients (Krause et al., 1999). The neurological involvement may be due to arterial aneurysm (Houman et al., 2002).
1.2. 3.8 Vascular and cardiac manifestations Behçet’s disease is a chronic relapsing systemic vasculitis involving veins and arteries, vascular involvement manifest as deep and superficial vein thrombosis, thrombophlebitis, arterial obstruction, and aneurysms of artery such as the pulmonary arteries (Yazici et al., 1998).Within five years of the initial presentation of BD the venous involvement arises, deep and superficial vein thrombosis are common features (Koc et al., 1992). The frequency of vascular involvemen is slightly less common in children (from 10.5 to 21%) (Krause et al., 1999; Kone-Paut et al., 2002) than in adults (from 8 to 26.5%) (Krause et al., 1999; Baixauli et al., 2001). BuddChiari syndrome (sudden occlusion of the major hepatic veins) is a rare and serious complication of BD. (Kural-Seyahi et al., 2003). Cardiac manifestations in BD include the valvular disease like mitral valve regurgitation (Chikamori et al., 1990), intracardiac thrombus (Mogulkoc et al., 2000), myocardial infarction and aneurysms (Siepmann and Kirch, 1997), and endomyocardial fibrosis (Huong et al., 1997) . Cardiac manifestations are uncommon but are causes of mortality and morbidity in patients with BD (Hashimoto et al., 1994).
1.2.3.9 Renal manifestation Renal diseases that are associated with BD include the glomerulonephritis, asymptomatic hematuria and proteinuria (Akpolat et al., 2002). These - 18 -
------------------------------------------------------------------------------------ Literatures Review ----
nephritic symptoms in BD may lead to amylodosis which is rare and has a 50% mortality rate (Melikoglu et al., 2001).
1.2.4 Etiology The etiology and pathogeneesis of Behest's disease are unclear. Genetic, environmental, bacterial, viral and immunological factors have been proposed as causative agents who are mediating the pathogeneesis of BD by triggering immune response (Sakane, 1999; Zierhut, 2003).
1.2.4.1 Genetic factors (HLA-B51 and other MHC associations) Behcet’s disease (BD) is strongly associated with a classI major histocompatibility complex (MHC) allele, HLA-B51. This association was first reported in Japanese BD patients (Ono et al., 1973; Ono et al., 1975; Ohno et al., 1982). Association of HLA-B51 with BD was later confirmed in other ethnic groups, including those in which BD is seen very rarely (Ohno et al., 1999;Gül A 2001; Ambresin et al., 2002; Ohno et al., 2003; Pipitone et al., 2004;Fietta 2005; Bettencourt et al., 2008). No disease specific differences were observed in the sequence of HLAB51 alleles between BD patients and healthy controls, neither in the coding region nor in the regulatory sequences (Sano et al., 2001; Takemoto et al., 2008). HLA-B51 is a split antigene of HLA-B5, and the other split antigene HLA-B52 has not been associated with BD despite some exceptional reports (Sugisaki et al., 2005). Meguro and colleagues in 2009 reported the association of HLA-A26 allele and HLA-A*26-F*010101-G*010102 haplotype with BD even in HLAB51 negative patients in Japan, Taiwan and Greek. These observations suggest that contribution of the MHC region to the BD susceptibility includes both
- 19 -
------------------------------------------------------------------------------------ Literatures Review ----
HLA-B51 and other classical or nonclassical HLA associations with possible different pathogenic mechanisms. Although majority of BD patients are seen as sporadic cases, increased frequency of BD has long been noted among the relatives (Nishiura et al., 1996; Nishiyama et al., 2001; Fietta, 2005). Investigation of HLA-B51 interacting KIR3DL1/DS1 polymorphism documented the association of DL1/ DL1 geneotype with BD in Bw4-motif positive patients (Duymaz-Tozkir et al., 2008). These preliminary studies support an alternative hypothesis that the pathogeneic role of HLA-B51 may also include its interaction with KIR3DL1 molecules expressed on inflammatory cells.
1.2.4.2 Bacterial cause BD’s Research Committee of Japan focused on a possible pathogenesis role for streptococcal antigens (Japan’s group 1990). Kaneko et al., (1985) reported streptococcal group D antiserum in skin and mucosal lesion biopsies of BD. Four species of Streptococci which are Streptococcus sanguis, Streptococcus pyogenees, Streptococcus faecals, and Streptococcus salivarius have been suggested as etiological agenet in BD (Kaneko et al., 1988; Isogai et al., 2002, but the Streptococcus sanguis appears to be the most relevant strain. (Namba et al., 1986). Alyahya et al., (2002) also suggested that immunogeneic protein from Streptococcus sangius has cross-reactivity and may induce an immunological response in the human. Most clinical observations suggest that exposure to streptococcal antigenes may be a major provoking factor for disease activity. In some patients a skin reaction can be observed when streptococcal antigens are injected intradermally (Mizushima et al., 1988). The results of another study from Turkey showed that the combination of benzathine penicillin and colchicine is
- 20 -
------------------------------------------------------------------------------------ Literatures Review ----
more effective for controlling the mucocutaneous symptoms of the disease (Calgüneri et al., 1996).
1.2.4.3 Viral etiology A viral etiology was suggested by Behçet in his original publication, based on observations of inclusion bodies in the ulceration. Viral infection often thought to be a provoking factor in the disease; however, no case to case transmission has been described (Behçet, 1937). The herpes simplex virus type I (HSV 1) genome has been found in leucocytes from patients with BD, in association with circulating antibodies to HSV-1 ( Hamzoi et al., 1990; Studd et al., 1991). Cytomegalovirus was not isolated in biopsy specimens taken from ulcers (Ghodratnama et al., 1997). Antiviral therapy has been shown to be beneficial in the animal models, showing possibly their limited resemblance to human disease (Sohn et al., 2001; Sohn et al., 2004).
1.2.4.4 Heat shock proteins Heat shock proteins are a group of intracellular proteins which scavenge for other intracellular proteins under denaturating stress conditions such as infection, hypoxia, trauma, and toxic drugs (Lamb and Young, 1990; Direskeneli and Saruhan-Direskeneli, 2003). Significant increases of IgA antibodies against the 65 kda heat shock proteins characterize BD. Monoclonal antibodies to the heat shock proteins cross-react with selected strains of Streptococcus sanguis. (Lehner et al., 1991). Direskeneli et al., (1996) investigated T-cell responses to 60/65 kDa heat shock protein in Turkish patients and they found high T-cell immune responses and also B-cell epitopes.
- 21 -
------------------------------------------------------------------------------------ Literatures Review ----
The expression of HSP60 in epidermal regions is up-regulated at lesional sites in BD, and antibodies to streptococcal HSP60 might cause tissue damage (Ergun et al., 2001).
1.2.5 Pathophysiology of BD Myeloperoxidase (MPO) is a haeme-containing peroxidase expressed and stored in neutrophils and monocytes, which during cellular activation and degranulation, is released into phagocytic vacuoles as well as into the extracellular space (Winterbourn et al., 2000). MPO catalyses a reaction between hydrogene peroxide and chloride to geneerate hypochlorous acid (HOCl), a potent oxidant and chlorinating agent that can cause vascular damage when released by activated cells at inflammatory sites (Hoy et al., 2002; Lau and Baldus, 2006). Investigations have shown that various functions of neutrophils in peripheral blood, such as chemotaxis, phagocytosis and generation of reactive oxygen species (ROS) are enhanced in BD (Tuzun et al., 1999). High levels of MPO have been found in both plasma and supernatants of neutrophil cultures from patients with active BD (Accardo-Palumbo et al., 2000; Yazici et al., 2004) Therefore, activated neutrophils and MPO may play a central role in the pathophysiology of BD.
MPO may determine vascular damage by several mechanisms. MPO has been shown to activate metalloproteinase and catalytically consume endothelium-derived by reducing its bioavailability and impairing its vasodilatory and anti-inflammatory functions (Lau and Baldus 2006). Endothelial dysfunction evaluated by endothelium-dependent vasodilation occurs in BD patients (Chambers et al., 2001). Furthermore, no production was found to be decreased in patients with active disease compared with the inactive period and the control group.
- 22 -
------------------------------------------------------------------------------------ Literatures Review ----
Several studies have suggested that neutrophil and monocyte activity may be increased in BD (Takeno et al., 1995). Superoxide production is increased in the neutrophils of BD patients compared with appropriate control subjects, and this increase seems to be related to the presence of the HLA-B51 (Takeno et al., 1995). In addition, the migration of neutrophils during attacks, but not during remission, increases in BD (Carletto et al., 1997). Production of TNF- , IL-6, and the neutrophil chemoattractant IL-8 by monocytes has also been found to be elevated (Mege et al., 1993). Some studies also noted lower IL-12 production in active BD patients when compared with inactive BD, recurrent aphthous stomatitis, and control patients, thus suggesting that the immune system in BD may be characterized by a divergenet cytokine production profile of mixed Th1/Th2 /Th0 cell types (Raziuddin et al., 1998; Aridogan et al., 2003).
1.2.6 Pathogeneesis of vascular involvement Vascular involvement in BD is predominantly venous in contrast to what is seen in other systemic vasculitides. However, the rare presence of pulmonary emboli is suggestive of “sticky” thrombi. In histopathological specimens, in addition to thrombi, inflammatory infiltrates in vessel walls point to a vasculitic process (Melikoglu et al., 2008). Vasculitis is also present, in varying degrees, in the histopathologic specimens of oral and genital ulcers, erythema nodosum-like lesions, epididymitis, enteritis, and central nervous system lesions in BD. Nonlytic antibodies against endothelial cells are commonly present in both vascular and nonvascular BD (Direskeneli et al., 1995). A 44 kDa endothelial antigen is recognized by IgM AECA of BD patients. These antibodies, which mainly target a-enolase (Lee et al., 2003), increase the expression of ICAM-1 on EC and can activate mitogene-activated protein cascade through the extra-cellular signal regulated kinase (Lee et al., 2002). Endothelium-dependent brachial - 23 -
------------------------------------------------------------------------------------ Literatures Review ----
artery flow-mediated dilation is also impaired in BD, which is improved by vitamin C treatment and suggests a role for oxidative stress in vascular involvement (Chambers et al., 2001; Kayikcioglu et al., 2006).
1.2.7 Immunology in BD The major immunological features of BD consist of increased T- and Bcell responses to heat-shock proteins (HSP), increased neutrophil activity, and alterations in cytokine levels, although the interrelationships between and among these features are not clear. In several recent studies of patients with BD, increased numbers of
T-
cells have been found in peripheral blood and in affected tissues, a phenotypically distinct subset of these cells being observed at sites of inflammation (Mizuki et al., 2000; Bank et al., 2003).
1.2.8 Diagnosis of BD Behçet’s disease does not have any pathognomonic symptoms or laboratory findings, the diagnosis is made on the basis of the criteria proposed by the International Study Group for Behçet’s Disease in 1990, see Table (1-2).
Table (1.2) Criteria for the diagnosis of BD (Japane’s group 1990)
Finding Recurrent ulceration
oral
Definition Minor aphthous, major aphthous, or herp form
ulcers
observed by the physician or patient, which have recurred at least three times over a 12-month period
Recurrent
Aphthous ulceration or scarring observed by the
geneital
physician or patient
ulceration
- 24 -
------------------------------------------------------------------------------------ Literatures Review ----
Skin lesions
Pseudofolliculitis, or papulopustular lesions; or acneiform nodules observed by the physician in a postadolescent patient who is not receiving corticosteroids
Eye lesions
Anterior uveitis, posterior uveitis, or cells in the vitreous on slit-lamp examination; or retinal vasculitis detected by an ophthalmologist
Positive
Test interpreted as positive by the physician at 24 to 48
pathergy test
hours
There is no diagnostic test for Behest's disease. The erythrocyte sedimentation rate (ESR), C-reactive protein (CRP), C9 and/or C3, C4 complements may be elevated during the active phases of the disease. Immunoglobulins (IgM and IgG) may be elevated and immune complex are also found in the serum of some patients (Yazici et al., 1990).
Behçet's disease has diverse clinical features, so it is sometimes difficult to diagnose complicated cases. In such instances, analysis of HLA phenotypes and measurement of serum IgD levels may help to make a diagnosis, since patients with active Behçet's disease often have elevated levels of serum IgD ( Mumcu et al., 2004).
1.2.9 Major Histocompatibility Complex (MHC) The major histocompatibility complex (MHC) is a set of antigenes with immunological and non-immunological functions and present in all vertebrates studied so far (Trowsdale, 1995; Gruen and Weiss man, 1997). The function of the MHC can be described as pleiotropic, i.e. multiple unrelated ones (Jonker and Balner, 1980; Dausset, 1981). It is best known with its role in histocompatibility (Snell, 1981), and in immune regulation - 25 -
------------------------------------------------------------------------------------ Literatures Review ----
(Benacerraf, 1981; Zinkernagel, 1997) and with many other functions not much appreciated yet (Gruen and Weissman, 1997; Zavazava and Eggert, 1997; Penn and Potts, 1999). The mechanism of action of the main MHC molecules is peptide binding and presentation of them to T lymphocytes. Among the non-immune functions, the noteworthy ones are interactions with other receptors on the cell surface (Svejgaard and Ryder, 1976 ; Edidin, 1988), in particular with transferrin receptor (TfR), epidermal growth factor (Schreiber
et al.,
1984), various
hormone receptors (Verland et al., 1989), and signal transduction (Schafer et al., 1995). The MHC in humans is called Human Leukocyte Antigenes (HLA). Their encoding genes are located on chromosome 6p21.31 and cover a region of about 3.6 mega base pair (mbp) depending on the haplotype (Trowsdale J. 1995). The longest haplotype is the HLA-DR53 group haplotypes including a 110-160 kelo base pair (kbp) extra DNA in their DR/DQ region (Niven et al., 1990; Kendall et al., 1991). The HLA complex is divided into three regions: class I, II, and III regions as first proposed by Jan Klein in 1976 (Klein, 1976). The classical HLA antigens encoded in each region are HLA-A, -B, and -C in the class I region, and HLA-DR, -DQ and -DP in the class II region. All the class I genes are between 3 and 6 kbp, whereas, class II genes are 4-11 kbp long (Browning and McMichael, 1996). The class III region has the highest genetic density but some of the genes are not involved in the immune system (Aguado et al., 1996; and Gruen and Weissman, 1997). The Behcet’s disease susceptibility locus encompasses the HLA genes, located within the major histocompatibility complex (MHC). The MHC spans a 3.5 mega base pair region of the chromosome 6p21.31 and consists of over 200 genes arranged into three subregions, class I, class II, and class III (Figure 1-1).
- 26 -
------------------------------------------------------------------------------------ Literatures Review ----
(1) The class I genes encode peptide chains, which associate with β2 microglobulin to form the class I molecules (Figure 1-2 A). These molecules are expressed on the surface of all nucleated cells and play a crucial role in the restriction of cytotoxic T cell activity. The HLA class I molecules bind to peptide fragments derived from endogeneous antigenes and present them for recognition by the T cell receptors (TCRs) of CD8 positive T cells. (2) The class II (HLA-D) loci are subdivided into at least one A and one B gene. These encode the α and β peptide chains, respectively, which combine to form the heterodimeric class II molecules The expression of these molecules is normally restricted to professional antigene presenting cells, β-cells, and activated T cells. The HLA-DR, HLA-DQ, and HLA-DP molecules are involved in the activation of helper T cells. The α1 and β1 domains of these molecules form a cleft into which peptide fragments derived from exogenous antigens can bind. These peptides are then presented for recognition by the TCRs of CD4 positive T cells the recognition process activates the responding T cells and initiates an immune response. (3) The class III genes encode a range of molecules with a variety of functions, including complement components (C2, C4, and Bf), tumor necrosis factor, and heat shock protein, Hsp70 (Kelly M. 2003).
- 27 -
------------------------------------------------------------------------------------ Literatures Review ----
Figure (1.1) The genetic region of the major histocompatibility complex in man, HLA, is located on the short arm of chromosome 6 (6p21.3) and occupies a large segment of DNA, extending for about 3600 kbp. It is a region of highly polymorphic genes that form separate gene clusters, class I (telomeric) and class II (centromeric). These two regions are separated by another cluster of unrelated genes, which are called class III genes. The classical class I HLA loci are HLAA, -B, and -C, those of class II are HLA-DR (DRA, DRB), -DQ (DQA, DQB) and -DP (DPA, DPB). Class III HLA region comprises the complement genes C2, C4, Bf, heat shock proteins genes (HSP70), tumour necrosis factor genes (TNF), 21-hydroxylase (21-OH) and other ( Kantarova D. & Buc M. 2007).
- 28 -
------------------------------------------------------------------------------------ Literatures Review ----
Figure (1.2) A diagrammatic representation of (A) a human leucocyte antigene (HLA) class I molecule and (B) a HLA class II molecule, showing the antigene binding cleft (Kelly et al., 2003).
Many of the HLA genes are highly polymorphic. The class I and class II molecules encoded by these allelic variants show great variability in their three dimensional structures, particularly in the antigen binding regions of the molecules. This has important functional consequences, because the structure of the antigen binding site determines the way in which the molecule interacts with a particular antigenic peptide and T cell receptor. HLA-B51 differs from HLA-B52 only by two aminoacids in the helix. Asparagine and phenylalanine at positions 63 and 67 of the HLA-B51 molecule are replaced with glutamic acid and serine in the HLA-B52 at the corresponding positions (Falk et al., 1995).These two amino acids are located at the B pocket of the antigen binding groove (Figure1-3). HLA-B51 allele can bind peptides with eight or nine amino acids and a hydrophobic C-terminus (Sakaguchi et al., 1997). Later studies suggested that B pocket can be occupied by small amino - 29 -
------------------------------------------------------------------------------------ Literatures Review ----
acids alanine and proline, and changes in the B pocket can affect the motif of the peptides that can bind to HLA molecule (Lemmel et al., 2003).
Figure (1.3) A model of HLA-B51 molecule (1E28) showing the critical asparagine and phenylalanine at positions 63 and 67 in its antigene binding groove (Maenaka et al. 2000).
1.3 Polymerase chain reaction 1.3.1 Definition PCR is a simple way to quickly amplify specific sequences of target DNA from indicator organisms to an amount that can be viewed by the human eye with a variety of detection devices (Fairchild et al., 2006). It uses repeated replication cycles with specially designed primers, DNA polymerase, and the Deoxyribonucleoside 5́- triphosphates (dATP, dGTP, dCTP and dTTP). Some - 30 -
------------------------------------------------------------------------------------ Literatures Review ----
knowledge of the DNA sequence to be amplified is needed to design the primers. Twenty to forty PCR cycles produce million copies of the DNA within few hours; it was first described by Kary Mullis in 1985, who received a noble prize for this discovery (Pabinger, 2006).
1.3.2 PCR principles 1.3.2.1 Denaturation When a double stranded DNA (ds DNA) molecule is heated to 94 °C, the paired strands will separate (denature). This allows the primers access to the single stranded DNA (ssDNA) templates.
1.3.2.2 Annealing The reaction mixture is cooled (about 50 °C) to allow primers to select and bind (hybridize) to their complementary positions on the ssDNA template molecules.
1.3.2.3 Elongation The ssDNA/primer solution is heated to 72 °C. In the presence of the heat stable polymerase, PCR buffer, dNTP’s and magnesium (Mg2+) molecules, the replication procedure begins. With each repetition of this cycle, the target is doubled and soon, after about 30 cycles, the reaction will yield in excess of 1 million copies of the target DNA fragment (Viljoen et al., 2005).
- 31 -
------------------------------------------------------------------------------------ Literatures Review ----
Figure (1.4) displays the steps performed during a normal PCR cycle (Florida Museum of Natural History, 2006).
- 32 -
-------------------------------------------------------------------------------- Materials and methods----
Chapter Two Patients,Materials and Methods This study has been conducted in the molecular biology department of Kurdistan Institute for Strategic Studies and Scientific Researches in Sulaimani.
2.1 Materials and instruments 2.1.1 Apparatuses Table (2.1): List of apparatuses No.
Name
Company
Country
1
Thermo mixer compact
Eppendorf
Germany
2
Micro centrifuge
Eppendorf
Germany
3
Thermocycler gradient
Eppendorf
Germany
4
Vortex
IKA MS3 basic
Germany
5
Sensitive balance
Sartorius
USA
6
Electrophoresis power supply
Consort
Belgium
7
Gel Electrophoresis chamber
Biostep GmbH
UK
8
Microwave
Sharp
Japan
9
Water bath
GFL 1083
Germany
10
Freezer -40 °C
Liebherr
Germany
11
Ice maker
Zigara
Germany
12
Gel documentation
Herolab
Germany
13
Safety Cabinet class II
HERA safe
Germany
14
Autoclave
Systec
Germany
- 33 -
-------------------------------------------------------------------------------- Materials and methods---15
Thermo Magnetic stirrer
IKA
Germany
16
pH meter
Kink
Germany
17
Incubator
GFL
Germany
18
Refrigerator
Liebherr
Germany
19
Centrifuge
Anke(TDL-50B)
China
20
Camera
Sony (1080)
Japan
2.1.2 Instruments Table (2.2): List of instruments No.
Name
Company
Country
1
Micropipette (0.1- 2.5)μL
Eppendorf
Germany
2
Micropipette (2 –20) μL
Eppendorf
Germany
3
Micropipette (20 –200) μL
Eppendorf
Germany
4
Micropipette (10 -100) μL
Eppendorf
Germany
5
Micropipette (100 -1000) μL
Eppendorf
Germany
6
Micropipette tips
Eppendorf
Germany
7
Eppendorf tube 2 ml
Eppendorf
Germany
8
PCR tube ( 0.5, 1.5 ) ml
Eppendorf
Germany
9
Parafilm “M”
Chicago,IL60631
U.S.A.
10
Plastic plain tube
Commercial
Iran
11
EDTA tube
Commercial
Iran
12
Plastic cup
Commercial
Iran
13
Disposable syringe (5,10)ml
BD Discardit
Spain
14
Disposable dental mirror
Commercial
Iran
- 34 -
-------------------------------------------------------------------------------- Materials and methods----
2.1.3 Glassware Table (2.3): List of glassware No.
Name
Company
Country
1
Conical flask (25,250,500,2500) ml
Bro 3.3
Germany
2
Beacker (500) ml
Bro 3.3
Germany
3
Graduated cylinder(100,250)ml
Super- roil
Germany
2.1.4 Chemical Agents Table (2.4): List of chemical agents No.
Name
Company
Country
1
Triton X-100
Merck
Germany
2
Sodium dodecyle sulfate
Fluka
Switzerland
3
Sodium chloride
Merck
Germany
4
Tris base
Merck
Germany
5
Sucrose
Merck
Germany
6
MgCl2
Merck
Germany
7
96% Ethanol
Yasan
Iran
8
Isopropanol
Yasan
Iran
9
Ultra-pure distilled water DNase & RNase free
GIBCO
USA
10
NaOH
Fluka
Switzerland
11
HCl 0.1N
Fluka
Switzerland
12
Ethidium bromide
Aplichem
Germany
13
6X DNA Loading dye
Fermentas
Germany
14
Boric acid
Applichem
Germany
15
EDTA powder
Applichem
Germany
- 35 -
-------------------------------------------------------------------------------- Materials and methods---17
Proteinase K
Fermentas
Germany
18
Multi Agarose
Fermentas
Germany
19
Master mix ready to use
Fermentas
Germany
2.1.5 DNA primers Table (2.5): The sequences and position of primers used for the DNA amplification. Primer
Polarity
Position(nt)
Sequences ( 5'→3' )
CF
Sense
256-275
5’-GCTCCCACTCCATGAGGTAT-3
SR
Anti sense
1082-1102
5’-AGGCCATCCCCGGCGACCTAT-3’
2.1.6 Buffers and solutions 2.1.6.1
Buffer A (Red blood cell lyses buffer)
Composition: 1) 0.32 M sucrose (109.53 gm was dissolved in a final volume 1 L of distilled water) 2) 10 mM TrisHCl (1.21 gm was dissolved in a final volume 1 L of distilled water). 3) 5 mM MgCl2.6H2O (1.01 gm was dissolved in a final volume 1 L of distilled water) 4-0.75% Triton-X-100 (7.5 ml was added to 992.5 ml of Buffer A after autoclaving). * Buffer A was sterilized by autoclaving at 121 °C, 15 bar pressure for 20 min, prior
to
addition
of
Triton-X100. - 36 -
.
-------------------------------------------------------------------------------- Materials and methods----
Stock of 1000 ml of the erythrocyte lyses solution was prepared by addition of 109.53 g Sucrose to get final concentration of 0.32 M, 1.21 g Tris-HCl to get final concentration of 10 mM and 1.01 g MgCl2.6H2O to get final concentration of 5 mM, the mixture was stirred on a magnetic stirrer till dissolved completely and the mixture was autoclaved prior to addition of 7.5 ml Triton 100x to get 0.75%, then pH was adjusted to 7.6 (Miller et al., 1988). 2.1.6.2 Buffer B (Proteinase K buffer) Composition: 1) 20 mM Tris-HCl (2.42 gm was dissolved in a final volume 1 L of distilled water) 2) 4 mM Na2EDTA (1.488 gm was dissolved in a final volume 1 L of distilled water) 3) 100 mM NaCl (5.844 gm was dissolved in a final volume 1 L of distilled water).
* Buffer B was sterilized by autoclaving at 121 °C, 15 bar pressure for 20 min. Stock of 1000 ml solution was prepared by addition of 2.42 g of Tris-HCl to get final concentration of 20 mM, 1.488 g Na2EDTA to get final concentration of 4 mM and 5.844 g NaCl to get final concentration of 100 mM then the mixture was completed to 1000 ml by distilled water and stirred on a magnetic stirrer till dissolved completely. Then the pH was adjusted to 7.4 (Miller et al., 1988). 2.1.6.3 SDS 10% 10 gm SDS (sodium dodecyl sulfate) was dissolved in a final volume 100 ml of distilled water (D.W.), then heated to about 68 °C and stirred with a magnetic stirrer to dissolve properly and store at room temperature (Sambrook, 1989).
- 37 -
-------------------------------------------------------------------------------- Materials and methods----
2.1.6.4 Proteinase K solution (19.6 mg/ml) Proteinase K is prepared by manufacturer and was ready to use, the mixture was aliquoted into 10 tubes to avoid the repeated thawing and freezing because proteinase K is inactivated by multiple thawing and freezing, then the aliquots were stored at -20 °C. 2.1.6.5 5.3 M NaCl solution NaCl (30.97 g) was dissolved in a final volume 100 ml of D.W. then stirred with magnetic stirrer to dissolve properly and stored at room temperature. 2.1.6.6 TrisHCl (20 mM) Tris base (0.242 g) was dissolved in a final volume 100 ml of D.W., mixed and stirred properly then the pH was adjusted to 8.5 by 1 M HCl solution, stored in refrigerator. 2.1.6.7 Ethanol 70% To 70 ml of 98 % prepared ethanol, 28 ml of distilled water was added. 2.1.6.8 Isopropanol It is provided by manufacturer and was ready to use. 2.1.6.9 5X TBE (Tris-Borate-EDTA) Tris base (53 gm), boric acid (27.5 gm), 20 ml of 0.5 M EDTA (pH 8.0) were put in a conical flask, completed to 1 L by D.W., then pH was adjusted to 8.0 by 1 N NaOH solutions. 2.1.6.10 1X TBE (Tris-Borate-EDTA) 20 ml of 5X TBE was completed to 100 ml by D.W. 2.1.6.11 0.5 M Na2EDTA Na2EDTA (3.7224 gm) was dissolved in a final volume 20 ml of D.W., then pH was adjusted to 8.0 by 1 N NaOH solution and stored at room temperature. 2.1.6.12 Ethidium bromide It is provided by manufacturer and was ready to use. - 38 -
-------------------------------------------------------------------------------- Materials and methods----
2.1.6.13 DNA Ladder 10 µl DNA ladder, 10 µl of 6X loading dye were put in an eppendorf tube then 40 µl of aqua by distilled water was added to the mixture, mixed and stored at -20 °C. 2.1.6.14 Primers 10 µl (100 µM) of each primer was added to a small Eppendorf tube then 90 µl of aqua bi distilled water was added to get 10 µM primer solutions. 2.1.6.15 DNA loading dye It is provided by manufacturer and was ready to use. 2.1.6.16 Master Mix The reagent of Master Mix is an optimized ready-to-use 2X PCR mixture of Taq DNA polymerase (recombination), PCR buffer, Mgcl2 and dNTPs. It contains all components for PCR except DNA template and primers. 2.1.6.17 Preparation of 2% Agarose gel 1) The edges of the electrophoresis chamber were sealed with tape and it was placed in a horizontal position on the bench. 2) 2 gram agarose powder was dissolved in 100 ml of 1X TBE buffer in a conical flask. 3) The mixture was sealed with aluminum foil to avoid evaporation and it was boiled in a microwave oven until the agarose was dissolved. Boiling was done for minimum time required to allow all the grains of agarose to dissolve. 4) The flask was taken out from the microwave and it was allowed to cool to about 45- 55 °C. 5) The gel was mixed with 10µL (10 mM) of ethidium bromide thoroughly by gentle swirling.
- 39 -
-------------------------------------------------------------------------------- Materials and methods----
6) Molten agarose solution was poured into the chamber, air bubbles were removed in the molten gel easily by poking them with a micropipette tip. 7) Appropriate comb with 16 teeth was set on the chamber and soaked in agarose gel. 8) The gel was left to set for 30 min at room temperature, till it solidified then the comb and tape were removed carefully from the gel (Sambrook, 1989).
2.2 Persons and Questioner 2.2.1 Persons: In this study 60 persons (31F and 29M) were investigated (40 patients and 20 controls) their age ranged from 6 to 58 years. Approval of the Ethics Committee was obtained from the College of Dentistry/ University of Sulaimani. Table (2.6) Distribution of the persons according the groups Person groups
Frequency
Percentage
RAU
15
25.0
SuspBD
9
15.0
IncBD
10
16.7
ComBD
6
10.0
Control
20
33.3
Total
60
100.0
- 40 -
-------------------------------------------------------------------------------- Materials and methods----
Table (2.7) patient Exclusion Criteria No. Criteria 1
Trauma
2
Hormonal change
3
Haematological disorders
4
Pregnant women
5
Gastrointestinal disorders
A) Patients: 1) Recurrent oral aphthous ulcer group: 15 subjects (9F, 6M) had only RAU more than 3 episodes per year, the other causes of RAU that show in table (2-7) were excluded, while excluding stress was difficult due to the complexity of life style . The other 25 patients were divided into 3 sub groups according to the diagnostic criteria of the BD Research Committee of Japan (1987 revision). 2) Suspected BD group: In this study 9 patients (6F, 3M) were diagnosed as Suspected BD. 3) Incomplete BD group: 10 Patients (1F, 9M) were diagnosed as Incomplete BD. 4) Complete BD group: 6 Patients (4F, 2M) were diagnosed as complete BD.
- 41 -
-------------------------------------------------------------------------------- Materials and methods----
B) Control group: 20 persons (9F, 11M) were taken randomly and considered as a control group who had not any clinical features of BD.
2.2.2 Diagnostic criteria of the BD Research Committee of Japan Table (2.8) Diagnostic criteria for Behcet's disease (Lancet 1990) Criterion
Required features
Recurrent oral
Aphthous (idiopathic) ulceration, observed by physician or
ulceration
patient, with at least three episodes in any 12 month period
Recurrent genital
Aphthous ulceration or scarring, observed by physician or patient
ulceration Eye lesions
Anterior or posterior uveitis cells in vitreous in slit lamp examination; or retinal vasculitis documented by ophthalmologist
Skin lesions
Erythema nodosum-like lesions observed by physician or patient; papulopustular skin lesions or pseudofolliculitis with characteristic acnelform nodules observed by physician
Pathergy test
Interpreted at 24 to 48 hours by physician
A) Major 1) Recurrent aphthous ulceration of the oral mucous membrane 2) Skin lesions 3) Eye lesions 4) Genital ulcers B) Minor 1) Arthiritis without deformity and ankylosis 2) Gastro-intestinal lesions characterised by ileocecal ulcers - 42 -
-------------------------------------------------------------------------------- Materials and methods----
3) Epididiyitis 4) Vascular lesions 5) Central nervous system symptoms
2.2.2.1 Diagnosis Complete Behcet
4 major features
Incomplete Behcet
3 major features or 2 major features + 2 minor features or typical ocular symptoms + 1 major feature or 2 minor features
Suspected
2 major features or 1 major feature + 2 minor features
2.3 Methods 2.3.1 Case sheet A printed form in the appendix (show in page no. 93) prepared to each person who was included in this study. It included the personal information like name, age, sex, past and present medical history of diseases. This is in addition of a history about oral lesion type, frequency per year, duration, and other manifestations of BD.
- 43 -
-------------------------------------------------------------------------------- Materials and methods----
2.3.2 Clinical Examination Intra oral examination: firstly do intra oral examination to identify the present of oral aphthous ulcer and it’s number (single or multiple ulcer), size (minor, major, or herptiform), site of lesion. The patients refer to the following departments: a) Dermatology department to diagnose skin manifestation of BD. b) Ophthalmology department to diagnose eye lesion of BD. c) Rheumatology department to diagnose Joint manifestation of BD. d) Neuro-medicine department to diagnose neurological manifestation of BD.
2.3.3 Specimen collection Blood: 2 ml of venous blood were aspirated aseptically from each person who was included in this study. Samples were collected in EDTA tubes, then put in an ice container and brought to the Kurdistan Institute for Strategic Studies and Scientific Researches in Sulaimani as soon as possible, stored in a deep freezer (-4 °C) till the DNA was extracted. The samples were collected from August 2009 to May 2010, in the following sites in Sulaimani city: 1) Shaheed Saifadeen Consultation Clinic/ Dermatology Department. 2) College of Dentistry. 3) Internal Medicine Teaching Hospital/ Rheumatology Department. 4) Prof. Nazar Talabani’s clinic and Dr.Muhamad Yussif’s clinic. - 44 -
-------------------------------------------------------------------------------- Materials and methods----
2.3.4 Extraction of genomic DNA from whole blood by salting out (Miller et al., 1988) 1) 1 volume of buffer A was added to 1 volume of blood and 2 volumes of cold, sterile, distilled, deionized water. Then the tubes were vortexed gently or inverted 6-8 times and left to incubate on ice for 2-3 min. 2) Tubes were spinned at 3500 rpm for 15 min at 4 °C. Supernatant was discarded and the pellet was re-suspended (vortexed for 30 sec at medium speed) in 2 ml of buffer A and 6 ml of water. Then spinned at 3500 rpm for 15 min at 4oC. The pellet should be white to cream in colour. If pellet was significantly red, washing step was repeated again. 3) 5 ml of Buffer B and 500 µl of 10% of SDS were added to pellet. Pellet was re-suspended by vortexing vigorously for 30-60 sec. Then 5 µl of Proteinase K solution (100 mg/ml) was added. The Proteinase K solution should be made fresh and refrigerated prior to use. 4) The mixture was left to incubate for two hours at 55 °C in a water bath. Samples were removed and left to cool to room temperature (or left on ice for 2-3 min). Four ml of 5.3 M NaCl solution was added, vortexes gently for 15 sec. 5) The tubes were spinned at 4500 rpm for 15-20 min at 4 °C, the supernatant was poured off into a fresh tube, an equal volume of cold isopropanol (stored at -20 °C) was added, inverted 5-6 times gently to precipitate DNA. 6) The DNA was removed with a wide bore tip and transferred in to a microcenterfuge tube, then washed with 1 ml of 70% of ethanol. DNA was left to dry for 15-20 min at 37 °C, then re-suspended in 300-400 µl of TrisHCl, pH 8.5. DNA then was left to re-dissolve overnight at room temperature, and then safely refrigerated at -30 °C. - 45 -
-------------------------------------------------------------------------------- Materials and methods----
2.3.5 Run for extracted DNA The extracted DNA was run on 2% of agarose gel by using Gel Electrophoresis chamber to know that DNA is present or not, as follow: 1) 2% of agarose gel was prepared and put in the tank of Gel Electrophoresis chamber. 2) 6 μl of Gene Ruler 100 bp plus DNA ladder (3kb) were taken and put into first lane of the gel 3) 2 μl of 6x loading dye was taken and put on parafilm for each DNA sample, then 5 μl of DNA sample was taken , the DNA sample was mixed with 6x DNA loading dye, then the mixture was put into the lane in the gel (each separate sample was put in a separate lane). 4) 1x TBE buffer was added into the chamber until the gel sank. 5) The Gel Electrophoresis chamber was connected with Electrophoresis power supply to run the samples at 90 V, 100mA, 9 W for 60 min. 6) The gel from the chamber was removed and read in the gel documentation under ultraviolet light, if DNA present showed it as a band then a picture was taken by a special camera which was connected to the gel documentation.
2.3.6 PCR amplification The HLA-B51 gene sequence was amplified by PCR based on the most conserved regions, the PCR primer was designed to amplify the sequence between nt 256 to nt 1102, yielding an amplicon of 846 bp.
- 46 -
-------------------------------------------------------------------------------- Materials and methods----
2.3.7 Protocol of PCR technique Detection of the HLA-B51 gene by PCR, DNA extraction from human mononuclear lymphocytes was performed by salting out procedure. The dissolved DNA in TrisHCl (20 mM) was used as a template in the PCR reaction. PCR reaction was performed in a 25 μl reaction volume. The oligonucleotide primers were used to amplify the 846-bp fragment of the HLA-B51 gene. The primer sequences were as follows: Forward primer (5’-GCTCCCACTCCATGAGGTAT-3’) Reverse primer(5’-AGGCCATCCCCGGCGACCTAT-3’) Procedure: 1) Add 12.5 μl of master mix solution into sterilized 1.5 ml pcr tube. 2) Add 0.5 μl of each forward and reverse primer. 3) Add 2 μl of DNA template . 4) Add 9.5 μl of sterilized deionized distilled water to get 25 μl total volume of pcr product 5) Do short centrifuge for mixture and put into pcr machine for amplification of gene by using this program that show below:
The conditions of the amplification include: 1) Initial denaturation for 2 min. at 95 °C. 2) 35 cycles: each cycle consists of a) Denaturation for 45 sec at 93 °C. b) Annealing for 35 sec at 57 °C c) Extention for 1 min at 72 °C.
- 47 -
-------------------------------------------------------------------------------- Materials and methods----
3) Final extension for 5 min. at 72 °C (according to primer manufacturer), in the Thermocycler machine. The amplification products were analyzed on 2% of agarose gel at 90 V, 100 mA, 9 W for 60 min. Table (2.9) the reaction mixture (25µl) for PCR Component
Volume
Final concentration
12.5 μl
1x
Forward primer 10pmol/μl
0.5μl
0.1-1 μM
Reverse primer10pmol/μl
0.5 μl
0.1-1 μM
2 μl
10pg-1μg
Master mix 4x
Template DNA Sterilized deionized water
9.5 μl
Total volume 0f PCR product
25 μl
2.3.8 Gel analyzation for PCR product The PCR product was run on 2% of agarose gel by using Gel Electrophoresis chamber to detect the HLA-B51 gene, as follows 1) 2% of agarose gel was prepared and put in the tank of Gel Electrophoresis chamber. 2) 6 μl of Gene Ruler 100 bp plus DNA ladder (3kb) were taken and put into the first lane of the gel. 3) 2 μl of 6x DNA loading dye was taken and put on parafilm for each PCR product, then 6 μl of PCR product was taken, the PCR product was mixed with 6x DNA loading dye, this mixture was put into the lane in the gel (each separate sample was put in a separate lane), and the negative control (PCR product contained all reaction mixture of PCR except the DNA template) was put into the second lane. - 48 -
-------------------------------------------------------------------------------- Materials and methods----
4) 1x TBE buffer was added into the chamber until the gel sank. 5) The Gel Electrophoresis chamber was connected with Electrophoresis power supply to run the samples at 90 V, 100mA, 9 W for 60 min. 6) The gel was removed from the chamber and read in the Gel documentation under ultraviolet light, if HLA-B51 was present showed it as a band at level of 846 bp of DNA ladder then a picture was taken by a special camera which was connected to the gel documentation. 2.3.9 Sterilization method All autoclavable solutions, materials, and instruments were sterilized using autoclave at 121 °C and 15lb for 15 min., and glassware was sterilized using oven at 180 °C for 2 hour (Hogg, 2005).
2.4 Statistical analysis Each returned questionnaire was given an identity number (ID), prior to data entry and analysis. The questions of studying the data were entered into Microsoft Excel Spreadsheet, and then the data was transferred into SPSS (Statistical Package for the Social Sciences-version 13.0). Descriptive statistics (number and percentage) was calculated for all the samples, ANOVA were used to find significant association. A p-value < 0.05 was considered as significant.
- 49 -
------------------------------------------------------------------------------------------Results -----
Chapter Three Results 3.1 Persons The experiment consisted of 60 persons of 6-58 years old, 31 males (51.7%) and 29 females (48.3%), see table (3-1).
Table (3.1) Distribution of the groups according the gender Gender
Group
Total
Percent
RAU
Susp.BD
Inc.BD
Com.BD
control
Male
6
3
9
2
11
31
51.7
Female
9
6
1
4
9
29
48.3
Total
15
9
10
6
20
60
100
The patients consisted
of 15 (9F ,6M) patients , who had only the
recurrent oral aphthous ulcer, while the other 25 (11F, 14M ) patients were divided into 3 subgroups; Suspected BD, Incomplete BD, Complete BD groups according to the diagnostic criteria of the BD Research Committee of Japan (1987 revision). Another 20 (9F, 11M) persons were taken as a control who had not any clinical features of BD.
3.2 Clinical features of the patients groups The clinical features of all patient groups were show in the table (3-2) 1) Recurrent Oral Aphthous Ulceration In this study all patients had RAU which was first symptoms in all patients. - 50 -
------------------------------------------------------------------------------------------Results ----2) Genital ulcer was had in 100% on Complete BD. group, 70% in Incomplete BD. group, 33 % in Suspected BD. group. 3) Skin lesion was had in 100% in Complete BD. group, 70% in Incomplete BD. group, 56% in Suspected BD. group. 4) Joint manifestation was had in 66.66% on Complete BD. group, 10% in Incomplete BD. group, 22.22 % in Suspected BD. group. 5) Eye lesion was had in 50 % on Complete BD. group, 40% in Incomplete BD. group. 6) Vascular involvement was had in 33.33 % on Complete BD. Group.
Table (3.2) clinical features of patients groups Group
RAU
Susp.BD
Incomp.BD
Comp.BD
Oral RAU
100%
100%
100%
100%
Genital ulcer
0%
33%
70%
100%
Skin lesion
0%
56%
70%
100%
0%
22.22%
10%
66.66%
Eye lesion
0%
0%
40%
50%
Vascular involvement
0%
0%
0%
33.33%
Joint manifestation
- 51 -
------------------------------------------------------------------------------------------Results -----
3.3 Genomic DNA extraction All 40 test patient's blood samples were subjected to DNA extraction by salting out method. Agarose gel electrophoresis showed successful extraction for all samples although there was interruption in the thickness of bands of different samples which revealed the difference in the amount of DNA extraction (Figure 3-1). Also, venous blood from 20 controls (healthy samples) was subjected to the same method of genomic DNA construction. The electrophoresis pattern for them has also been succeeded (Figure 3-2). It was appeared that salting out method used to extract genomic DNA is reliable and gives good results.
Figure (3-1): Genomic DNA extraction from venous blood of the patients group by salting out method and was run on 2% of agarose gel. Lane M: DNA ladder marker 1000bp Lanes: 1-30, patient genomic DNA sample.
- 52 -
------------------------------------------------------------------------------------------Results -----
Figure (3-2): Genomic DNA extraction from venous blood of control subjects by salting out method and was run on 2% of agarose gel. Lane M: DNA ladder marker 1000bp Lanes: 1-13: subjects genomic DNA sample.
3.4
Amplification of HLA-B51 gene
3.4.1 Amplification of HLA-B51 gene in RAU group The agarose gel electrophoresis patterns for the PCR products of HLAB51 for the 15 patients with RAU shown in figure (3-3) were 4 positive for the amplified amplicon whereas the others were negative.
- 53 -
------------------------------------------------------------------------------------------Results -----
Figure (3-3) Amplification of HLA-B51 gene in RAU patients. Lane M: DNA ladder marker. Lane NC: Negative control. Lanes: 1-12 patient samples. Samples: 1, 2, 7, 8 were positive while the others were negative. 1 Lane 1: a 50 years old male had 6-7 episodes of oral RAU per year, for 5 years 2 Lane 2: a 34 years old female had 6-8 episodes of oral RAU per year, for 1 year. 3 Lane 7: a 28 years old female had 5- 6 episodes of oral RAU per year, for 3 years. 4 Lane 8: a 17 years old male had 8- 10 episodes of oral RAU per year, for 3 years.
3.4.2 Amplification of HLA-B51 gene in Suspected BD group The agarose gel electrophoresis patterns for the PCR products of HLAB51 for the 9 patients diagnosed as the Suspect BD shown in figure (3-4) were 5 positive for the amplified amplicon whereas the others were negative.
- 54 -
------------------------------------------------------------------------------------------Results -----
Figure (3-4) Amplification of HLA-B51 gene in Suspected BD patients. Lane M: DNA ladder marker. Lane NC: Negative control. Lanes: 1-9 patient samples. Samples: 1, 2, 3, 7, 8 were positive while the others were negative. 1- Lane 1: a 30 years old female had 4-6 episodes of oral RAU per year for 2 years, 2 episode genital aphthous ulcer, and joint pain. 2- Lane 2: a 40 years old female had 4-5 episodes of oral RAU per year, for 10 years, and 4 episodes of genital aphthous ulcer. 3- Lane 3: a 20 years old male had 4-6 episodes of oral RAU per year, for 3 years, with skin lesion (foliculitis). 4- Lane 7: a 32 years old female had 4-5 episodes of oral RAU per year, for 5 years, with skin lesion (foliculitis). 5- Lane 8: a 42 years old male had 5-7 episodes of oral RAU per year, for 4 years , with skin lesion (erytheme nodusam), and arthiritis.
- 55 -
------------------------------------------------------------------------------------------Results -----
3.4.3 Amplification of HLA-B51 gene in Incomplete BD group The agarose gel electrophoresis patterns for the PCR products of HLAB51 for the 9 patients diagnosed as Incomplete BD shown in the figure (3-5) were 3 positive for the amplified amplicon whereas the others were negative.
Figure (3-5) Amplification of HLA-B51 gene in Incomplete BD patients. Lane M: DNA ladder marker. Lane NC: Negative control. Lanes: 1-10 patient samples. Samples: 2, 3, 7 were positive while the others were negative. 1-Lane 2: a 34 years old male had 2-3 episodes of oral RAU per year, for 3 years, 2 episodes of genital aphthous ulcer, and skin lesion (foliculitis). 2- Lane 3: a 29 years old female had 6-8 episodes of oral RAU per year, for 1 year, 2 episode of genital aphthous ulcer. 3-Lane 7: a 34 years old male had 2-6 episodes of oral RAU per year, for 3 years, with eye lesion.
- 56 -
------------------------------------------------------------------------------------------Results -----
3.4.4 Amplification of HLA-B51 gene in Complete BD group The agarose gel electrophoresis patterns for the PCR products of HLAB51 for the 6 patients diagnosed as Complete BD shown in figure (3-6) were 6 positive for the amplified amplicon.
Figure (3-6) Amplification of HLA-B51 gene in Complete BD patients. Lane M: DNA ladder marker. Lane NC: Negative control Lanes: 1-6 patient samples. Samples: all were positive. Lane 1: a 45 years old female had 6-8 episodes of oral RAU per year, for 9 years, 6 episode of genital aphthous ulcer, skin lesion (foliculitis), and deep venous thrombosis (DVT) . Lane 2: a 50 years old male had 4-7 episodes of oral RAU per year, for 7 years, 2 episodes of genital aphthous ulcer per years, eye lesion, with skin lesion (foliculitis). - 57 -
------------------------------------------------------------------------------------------Results ---- Lane 3: a 42 years old female had 6-8 episodes of oral RAU per year, for 7 years, 8 episode of genital aphthous ulcer, skin lesion (foliculitis, erytheme nodusam) , and deep venous thrombosis (DVT) . Lane 4: a 36 years old male had 6-9 episodes of oral RAU per year, for 14 years, 2 episode of geneital aphthous ulcer per years, eye lesion, with skin lesion (foliculitis, erytheme nodusam). Lane 5: a 52 years old female had 3-5 episodes of oral RAU per year, for 3 years, , 2 episode of geneital aphthous ulcer, skin lesion (foliculitis) , arthiritis . Lane 6: a 54 years old female had 6-10 episodes of oral RAU per year, for 10 years, 6 episode of geneital aphthous ulcer per year, skin lesion (foliculitis) , arthiritis , and eye lesion.
3.4.5 Amplification of HLA-B51 gene in healthy control group The agarose gel electrophoresis patterns for the PCR products of HLAB51 for the 20 healthy controls shown in figure (3-7) were 3 positive for the amplified amplicon whereas the others were negative.
Figure (3-7) Amplification of HLA-B51 gene in control subjects. - 58 -
------------------------------------------------------------------------------------------Results ----Lane M: DNA ladder marker. Lane NC: Negative control. Lanes: 1-12 subjects sample. Samples: 4, 5, 6 were positive while the others were negative
Table (3.3) Prevalence of HLA-B51 gene positive according to the Patients Count
Group
Total
HLAB51 Positive (%) Negative (%) RAU
Total
4 (26.66%)
11 (73.33%)
15
BD
14 (56%)
11 (44%)
25
Control
3 (15%)
17 (85 %)
20
21
39
60
Note: From the 25 patints of BD, 9 of them were diagnosed as Suspected BD (5 positeve and 4 negative), 10 of them were diagnosed as incomplete BD (3 positeve and 7 negative),while 6 of them diagnosed as complete BD all were positive.
The relation between RAU and BD are significant (with value = .046).
=0.05 and P
The relation between RAU and Control are significant (with P value = .046). The relation between BD and Control are significant (with value = .046).
=0.05 and
=0.05 and P
The relation between Positive and Negative are no significant (with =0.05 and P value = 0.223). - 59 -
………………………………………………………………… Discussion……
Chapter four Discussion 4.1 The samples In this study 60 subjects were investigated; 31 males (51.7%) and 29 females (48.3%). They were divided into 5 groups according to their clinical features. The age group was 6-58 years. The recurrent oral aphthous ulcer (RAU) and Behcet’s disease (BD) occur in all ages, and affect both genders (Natah et al., 2004) while the third decade is the most commonly reported age of onset for BD (Seung-H et al., 2005). This study demonstrated that male predominance was noted among BD patients (56% male). No differences were detected with respect to duration, frequency, age of onset or family history. RAU is most common oral lesion and it is the symptom for many disorders, so most of time without correct history of patient and investigation can not approach to diagnosis of RAU. The endemic areas described as the ‘ancient Silk Road’ include countries in the Mediterranean Basin and Asia, most notably, Turkey and Japan (Yurdakul et al., 2004). As Iraq is located in the Asia so the patient with complex aphthous ulcer need follow up and advanced investigation such as genetic detection.
4.2 Clinical features In this study RAU was seen in all patients with BD; it commonly preceded other systemic features. However, it is difficult to predict with certainty those patients initially presenting with RAU who will subsequently proceed to develop multi system involvement as part of BD. This was also concluded by ( Seung-H et al., 2005). - 60 -
………………………………………………………………… Discussion…… RAU was the most common basic symptom, followed by skin lesions, geneital ulceration/positive skin pathergy reaction, and ocular lesion. Oral ulcerations were found in 100% of the patients, indicating key bases of diagnosing BD. Genital ulceration was less significant, compared with oral ulceration. Solitary genital ulceration hardly suggested BD, and diagnosis could not easily be made based on genital ulceration, and similar diseases should be ruled out (Yingbin et al., 2009). Bang et al. (1997) examined the prognosis of the clinical relevance of RAU in BD, and the investigators found that approximately half of the patients who were initially diagnosed as RAU-only, developed other manifestations of BD in an average of 7.7 years after onset. In this study there is not difference in the characteristic feature for oral RAU in RAU group and BD group.
4.3 DNA extraction In this study DNA was extracted manually from whole blood by salting out method according to Miller et al., (1988), and it was more preferable than extracting by the kit that is ready made for DNA extraction because the solutions that were used to salting out were more stable than the kit and the amount of extracted DNA was more, the error was less in salting out method.
4.4 Amplification of HLA-B51 gene In this study HLA-B51 gene was amplified by polymerase chain reaction (PCR). Today PCR is more preferable in medical aspect for diagnosing most of the diseases, causative agents such as bacteria and virus, to detect the related gene to diseases which is helpful to prevent the occurrence of diseases. It was positive in 26.6% in RAU group, 55.5% in Suspect BD group, 30% in Incomplete BD, 100% in Complete BD, and 15% in healthy controls. The most
- 61 -
………………………………………………………………… Discussion…… significant finding in this study was a highly significant association between HLA-B51 and BD. There was no relationship between HLA-B51 and different manifestations of the disease.
Mizuki et al (1999) have suggested that the same HLA-B51 association exists worldwide and this has been confirmed in many different ethnic groups, but mostly in the Far East and Mediterranean countries, this HLA-B51 association is unclear.
In Germany, however, two studies reported an increased frequency of HLA-B5 in BD patients by 23% (compared with 14% of controls). 27 and 67% using the ISG criteria. It is well established that BD is associated with the HLA-B51 molecule that has a relatively high incidence, which ranges from 36.3% to 76.9% in many ethnic groups including the Asian and Eurasians and the prevalence of HLAB51 was found to be significantly increased in patients with BD (35.2% ) (Mizuki et al., 2001). Salvarani et al., (2001) demonstrate that the MICA-A6 allele is significantly associated with the susceptibility to BD. However, the MICA-A6 allele is not associated with BD in some ethnic groups.
Mizuki et al (2000) suggested that a genetic predisposition to BD appears to play an important role with a strong association with the MICA gene rather than HLA B51, but a recent report has suggested that the real pathogenic gene for BD is the HLA-B gene itself and the HLA-B51 allele is the major susceptibility gene responsible for the development of BD (Mizuki et al. 2001). Therefore, authors cannot be certain whether HLAB51 itself or a closely linked gene is responsible for the susceptibility to BD. - 62 -
………………………………………………………………… Discussion…… It’s probably difficult to understand and explain why the BD. is common in a Silk Road.
- 63 -
Conclusions ----
Conclusions 1- The clinical diagnosis of BD may pose considerable difficulties. Since the disease is multi-systemic and does not have any pathognomonic symptom or laboratory finding, the diagnosis is based on a cluster of clinical manifestations. Thus, the presence of a relatively specific laboratory marker can substantially facilitate the diagnosis of BD, and possibly support a diagnosis before all disease manifestations have occurred. 2- HLA-B51 may play a role in the pathogenesis of BD, but cannot be used as predictive value for the occurrence of organ involvement. 3- Any patient who has complex RAU and its common causes are excluded, and does not respond to treatment, or associated with other BD symptoms, then he needs detection of HLA-B51 gene and under observation.
- 64 -
…………………………………………….Recommendation…..
Recommendation
1- Further prospective studies with a larger number of patients are needed to determine the prevalence of HLA-B51 gene in patients with BD and healthy controls in Iraq. 2- Further studies are needed a- To explain further immunochemistry aspects of BD. b- To know that BD is related with other gene or not such as MICA gene. c- To clarify the role of each causative agents on BD, especially virus and bacteria. d- To evaluate the effect of drugs in treating BD, and to try to find specific drugs with minimum side-effects.
65
--------------------------------------------------------------------------------------------------------------- References -
References -AAccardo-Palumbo A.,Triolo G., and Carbone M. C. (2000) Polymorphonuclear leukocyte myeloperoxidase levels in patients with Behçet's disease. Clin Exp Rheumatol 18:495-498. Aguado B., Milner C. M., and Campbell R. D. (1996) Genes of the MHC class III region and the functions of the proteins they encode. In: Browning M, McMichael A, eds. HLA and MHC: genes, molecules and function, Oxford: Bios Scientific Publishers: 39-76. Akintoye S. O., and Greenberg M. S. (2005) Recurrent aphthous stomatitis. Dent Clin North Am, 49:31-47. Akpolat T., Akkoyunlu M., Akpolat, I., Dilek, M., Odabas, A.R., and Ozen, S. (2002). Renal Behçet’s disease: a cumulative analysis. Semin Arthritis Rheum, 31:317-337. Al- Aboosi, M. M., Al- Salem, M. Saadeh A., Al- Jamal M., Hijawi M., and Khammash M. (1996) Behçet’s disease: clinical study of Jordanian patients. Int J Dermatol 35:623-625. Al- Dalaan A. N., Al- Balaa S. R., Al- Ramahi K., Al- Kawi Z., Bohleg S., and Bahabri S. (1994) Behçet’s disease in Saudi Arabia. J. Rheumatol, 21:658661. Alemah G., and Bignami A. (1966). Involvement of the nervous system in Behcet's disease. In International Symposium on Behcet's Disease, Rome, 1965, p. 52. Al-Fahad and AL-Araji (1999) Neuro-Behcet's disease in Iraq: a study of 40 patients. J Neurol Sci. Nov 30;170(2):105-11
- 66 -
--------------------------------------------------------------------------------------------------------------- References -
Alpsoy E., Aktekin M. G., Durusoy H. C., and Yilmaz E. (1998) A randomized, controlled and blinded study of papulopustular lesions in Turkish Behçet’s patients. Int J Dermatol, 37: 839-842. Al-Rawi ZS, Sharquie KE, Khalifa SJ, Al-Hadithi FM, Munir JJ. (1986) Behçet's disease in Iraqi patients. Ann Rheum Dis. Dec;45(12):987-90 Alyahya RA, Nair SP, Henderson B, Murraypl Porter SR. (2002) Investigation of immunogenetic proteins from streptococcus sanguis in Behcet’s disease .cited by 10. Inter Conf. on Behcet’ s disease . p.93. Ambresin A, Tran T, Spertini F, Herbort C (2002) Behçet’s disease in Western Switzerland: epidemiology and analysis of ocular involvement. Ocul Immunol Inflamm 10:53–63 Aral O, Dilsen N, Konice M (1986). Positive skin pathergy reactivity as a genetic marker of Behçet’s disease. In: Recent advances in Behçet’s disease. Lehner T, Barnes CG, editors. London: Royal Society of Medical Services, pp. 173– 175. Aridogan BC, Yildirim M, Baysal V, Inaloz HS, Baz K, Kaya S. (2003) Serum Levels of IL-4, IL-10, IL-12, IL-13 and IFN-gamma in Behçet's disease. Aug;30(8):602-7. Axéll T., and Henricsson V. (1985) The occurrence of recurrent aphthous ulcers in an adult Swedish population. Acta Odontol Scand 43: 121-125. -BBach M. C., Howell D. A., Valenti A. J., Smith T. J., and Winslow D. L. (1990) Aphthous ulceration of the gastrointestinal tract in patients with the acquired immunodeficiency syndrome (AIDS). Ann Intern Med 112: 465-467.
- 67 -
--------------------------------------------------------------------------------------------------------------- References -
Baixauli A., Calvo J., Tamarit J.J., Campos C., Garcia S., Herrera A. (2001) Behçet’s disease: retrospective study. Ann Med Interna 18: 405-410. Bang D., Lee J.H., Lee E. S., Lee S., Choi
J. S., and
Kim Y. K .(2001)
Epidemiologic and clinical survey of Behçet’s disease in Korea: the first multicenter study. J Korean Med Sci 16: 615-618. Bang D., Yoon K. H., Chung H. G., Choi E. H. Lee E. S., and Lee S. (1997). Epidemiological and clinical features of Behçet’s disease in Korea. Yonsei Med J 38: 428-436. Bank I., Duvdevani M., and Livneh A. (2003). Expansion of gammadelta T-cells in Behçet’s disease: role of disease activity and microbial flora in oral ulcers. J Lab Clin Med 141: 33-40. Barile M. F., Graykowski E. A., Driscoll E. J., and Riggs D. B. (1963). L form of bacteria isolated from recurrent aphthous stomatitis lesions. Oral Surg Oral Med Oral Pathol 16: 1395-1402. Barrons, R. W. (2001). Treatment strategies for recurrent oral aphthous ulcers. J Health Syst Pharm 58: 41-50. Behçet H. (1937) Ueber rezidiverende aphtoese durch ein virus verur sachte Geschwuere am mund am Auge und an den Genitalien. Dermatol Wochenschr 105: 1152Benacerraf B. (1981) Role of MHC gene products in immune regulation. Science; 212: 1229-1238. Benjamin Moore (2008) science, and medical planning in early twentieth-century Britain Oct;65(4):487-517. Bettencourt N, Sampaio F, Carvalho M, Leite D, Rocha J, Ribeiro J, Ribeiro V. (2008) Primary diagnosis of quadricuspid aortic valve with multislice computed tomography. May-Jun;2(3):195-6.
- 68 -
--------------------------------------------------------------------------------------------------------------- References -
Bietti G. B., and Bruna F. (1966) An opthalmic report on Behget's disease. In International Symposium on Behcet's disease, Rome, 1965, p 79. Edited by M. Monacelli and P. Nazzaro. Birek C., Grandhi R., McNeill K., Singer D., Ficarra G., and Bowden G.(1999) Detection of Helicobacter pylori in oral aphthous ulcers. J Oral Pathol Med 28: 197-203. Blobner F (1937). Zur rezidivierenden Hypopyoniritis. Z Augenheilkunde 91:129– 139. Browning M, and McMichael A. (1996) MHC and HLA: Genes, Molecules and Function. Oxford: Bios Scientific Publishers. -CCakir N Yazici H, Chamberlain MA Barnes CG, Yurdakul S, Atasoy S et al., (1991). Response to intradermal injection of monosodium urate crystals in Behçet’s syndrome. Ann Rheum Dis 50:634–636 Calgüneri M., Ertenli S., and Kiraz S. (1996) Effect of prophylactic benzathine penicillin on mucocutaneous symptoms of Behçet’s disease. Dermatology 192: 125-128. Carletto A., Pacor M. L., Biasi D., Caramaschi P., Zeminian S., and Bellavite P. (1997). Changes of neutrophil migration without modification of in vitro metabolism and adhesion in Behçet’s disease. J Rheumatol 24:1332-1336. Chajek T., and Fainaru M. (1975) Behcet's disease report of cases. Medicine. 54:179-196. Challacombe SJ, Batchelor JR, Kennedy LA, Lehner T. (1977)HLA antigens in recurrent oral ulcerations. Arch Dermatol 113: 1717-9. Chambers J. C., Haskard D. O., and Kooner J. S. (2001) Vascular endothelial function and oxidative stress mechanisms in patients with Behçet's syndrome. J Am Coll Cardiol, 37:517-520. - 69 -
--------------------------------------------------------------------------------------------------------------- References -
Chajek t and fainaru m. (1975) Behcet’ s desease. Report of cases . medicine. 5475. 54.179-196. Chams F., Davatchi F., Shahram M., Akbarian, A. Nadji Gharibdoost Hchams A jamshidi A. (2001) Familial oral aphthosis in general population as compared to Behcet’s disease 8th Int. Conf. on Behcet’s diseae 1998, In Behcet’s diseae proceeding of 8th and 9th
Int. Conf. on Behcet’s diseae.
Jan. p. 644. Chen Y. C., and Chang H. W. (2001) Clinical characteristics of Behçet’s disease in southern Taiwan. J Microbiol Immunol Infect 34:207-210. Chikamori T, Doi Y. L., Yonezawa Y., Takata J., Kawamura M., and Ozawa T. (1990) Aortic regurgitation secondary to Behçet’s disease. A case report and review of the literature. Eur Heart J 11: 572-576. Cooke B. E. D. (1961) Recurrent Mikulicz's aphthae. Dental Practitioner, 12: 119124. Criteria for diagnosis of Behçet’s Disease (1990) International Study Group for Behçet’s disease. Lancet;335:1078-80.
Crivelli M. R., Aguas S., Adler I., Quarracino C., and Bazerque P. (1988) Influence of socioeconomic status on oral mucosa lesion prevalence in schoolchildren. Community Dent Oral Epidemiol16:58-60. -DDausset J. (1981) The major histocompatibility complex in man. Science; 213: 1469-1474. Davatchi F., Shahram F., and Akbarian M. (1992) Epidemiology of Behçet’s disease Iran. In: Rheumatology APPLAR Nasution AR, Darmawan J, Isbagio H, editors. Tokyo: Churchill Livingstone, pp. 95-98.
- 70 -
--------------------------------------------------------------------------------------------------------------- References -
Davatchi F, Shahram F, Nadji A, Jamshidi AR, Chams C, Chams H et al., (2003). Influence of pathergy test on the accuracy of different diagnosis criteria for Behçet’s disease. Adv Exp Med Biol 528:109–112. Deuter , koether, Gendagdin M, Zierhut N Stuebiger. (2002) Behcet’ s disease visual acuity after 5 years in patients with alpha-Interferon-Treatment. 10th Int.Conf. on Behcet’ s disease. June ;P 68. Direskeneli H, Keser G, D’Cruz D, Khamashta MA, Akoglu T, Yazici H et al (1995) Antiendothelial cell antibodies, endothelial proliferation and von Willebrand factor antigen in Behçet’s disease. Clin Rheumatol 14(1):55–61 Direskeneli H., Hasan A., and Shinnick T. (1996) Recognition of B cell epitopes of the 65 KD HSP in Behçet’s disease. Scand J Immunol 43: 464-471. Direskeneli H., and Saruhan-Direskeneli G. (2003) The role of heat shock proteins in Behçet’s disease. Clin Exp Rheumatol 21: S44-S48 Dolby A. E. (1968) Recurrent Mikulicz's oral aphthae-their relationship to the menstrual cycle. Br Dent J 124: 359-360. Duymaz-Tozkir J, Uyar A
Norman PJ et al (2008) Distribution of killer
immunoglobulinlike receptor 3DL1/3DS1 alleles in Behçet’s disease. Arthritis Rheum 58(Suppl):S855.
-EEdidin M. (1988) Function by association MHC antigens and membrane receptor complexes. Immunology Today 9: 218-219. Ekmekci P., Boyvat A., Ozdemir E., Gurler A., and Gurgey E.( 2003) Is long term observation of patients with recurrent aphthous stomatitis necessary? Clinical follow-up of 1238 cases. Adv Exp Med Biol 528: 127-130.
- 71 -
--------------------------------------------------------------------------------------------------------------- References -
Embil J. A., Stephens R.G., and Manuel F.R. (1975) Prevalence of recurrent herpes labialis and aphthous ulcers among young adults on six continents. Can Med Assoc J 113: 627-630. Endre L. (1991) Recurrent aphthous ulceration with zinc deficiency and cellular immune deficiency. Oral Surg Oral Med Oral Pathol 72: 559-61. Ergun T., Ince U., Eksioglu-Demiralp E., Direskeneli H, Gurbuz O., and Gurses L. (2001) HSP 60 expression in mucocutaneous lesions of Behçet’s disease. J Am Acad Dermatol 45: 904-909.
Emward TA Woodward M, Maziumzadeh KT, calamia Mayo. (2002) Gastrointestinal Disease in Behcet’ s disease. 10th Int. Conf. On Behcet’ s disease , June ; P. 84. -FFahmy M. S. (1976) Recurrent aphthous ulcers in a mixed Arab community. Community Dent Oral Epidemio l4: 160-164. Fairchild A., Lee M. D., and Maurer J. J. (2006) PCR basics. P: 1- 27. In Maurer J. (ed.). PCR methods in foods. Springer Science Media, Inc. US. Falk K., Rötzschke O., and Takiguchi M. (1995) Peptide motifs of HLA-B51, B52 and -B78 molecules, and implications for Behçet’s disease. Int Immunol 7:223-228. Femiano F., Gombos F., Nunziata M., Esposito V., and Scully C. 2005. Pemphigus mimicking aphthous stomatitis. J Oral Pathol Med 34:508-510. Ferguson M. M., Wray D. Carmichael H. A., Russell R. I., and Lee F. D. (1980) Coeliac disease associated with recurrent aphthae. Gut 21: 223-226.
- 72 -
--------------------------------------------------------------------------------------------------------------- References -
Field EA
Rotter E, Speechley JA, Tyldesley WR. (1987) Clinical and
haematological assessment of children with recurrent aphthous ulceration. Br Dent J 163: 19-22. Field, E. A., Brookes
V., and Tyldesley
W. R. (1992) Recurrent aphthous
ulceration in children: a review. Int J Pediatr Dent 2: 1-10. Fietta P (2005) Behçet’s disease: familial clustering and immunogenetics. Clin Exp Rheumatol 23(Suppl 38):S96–S105. Fischman, S. L. (1994) Oral ulcerations. Semin Dermatol. 13:74-77. Florida Museum of Natural History, (2006) Florida Museum of Natural History. PCR, .Accessible through the Web athttp://www.flmnh.ufl.edu/cowries/ PCR.gif. Fresko I, Yazici H, Bayramicli M, Yurdakul S, Mat C (1993) Effect of surgical cleaning of the skin on the pathergy phenomenon in Behçet’s syndrome. Ann Rheum Dis 52:619–620. -GGallo C. B., Mimura M. M., and Sugaya N. N. (2009) Psychological stress and recurrent aphthous stomatitis. Clinics. 64:645-648. Ghafour ZI. (1998) Recurrent aphthous stomatitis and it’s relationship to Behçet’s disease .A thesis submitted to scientific committee of Dermatology and venerology. Ghate J. V., and Jorizzo J. L. (1999) Behçet’s disease and complex aphthosis. J Am Acad Dermatol 40:1-18. Ghodratnama
F., Riggio
M. P., and Wray
D. (1997) Search for human
herpesvirus 6 human cytomegalovirus and varicella zoster virus DNA in recurrent aphthous stomatitis tissue. J Oral Pathol Med 26: 192-197.
- 73 -
--------------------------------------------------------------------------------------------------------------- References -
Gonzalez-Gay M. A., Garcia-Porrua C., Branas
F., Lopez-Lazaro
L., and
Olivieri I . (2000) Epidemiologic and clinical aspects of Behçet’s disease in a defined area of Northwestern Spain, 1988-1997. J Rheumatol 27: 703-707. Graykowski E. A., Barile M. F., Lee W. B., and Stanley H. R. (1966) Recurrent aphthous
stomatitis.
Clinical,
therapeutic,
histopathologic,
and
hypersensitivity aspects. JAMA 196: 637-644. Gruen J. R., and Weissman S. M. (1997) Evolving views of the major histocompatibility complex. Blood; 90: 4252-4265. Gül A. (2001) Behçet’s disease: an update on the pathogenesis. Clin Exp Rheumatol 19(Suppl 24):S6-S12. Gurler A., Boyvat A., and Tursen U. (1997) Clinical manifestations of Behçet’s disease: an analysis of 2147 patients. Yonsei Med J 38:423-427.
-HHamzoi K., Ayed K., and Slim A.( 1990) Natural killer cell activity, interferon gamma and antibodies to herpes viruses in patients with Behçet’s disease. Clin Exp Immunol ,79: 28-30. Hashimoto T, Haraoka H, Nippn, Rinsho. (1994) Behcet’ s disease in Japanese .Journal clinical Med. Aug. 1994; 52(8)2138-42. Herlotson B. B., and Barkroll P. (1994) Sodium Laoryl sulfate and RAS. Acta odontal-Scand. 52: 257-259. Hill A. V., Allsopp, C. E., Kwiatkowski D., Anstey N. M., Twumasi P., Rowe P. A., Bennett, S., Brewster, D., McMichael, A. J. and Greenwood, B. M. (1991)Common west African HLA antigens are associated with protection from severe malaria Nature 352 (6336): 595-600. Doi: 10.1038/352595a0. PMID 1865923. Hogg, S. (2005) Essential Microbiology. John Wiley and Sons Ltd, England. - 74 -
--------------------------------------------------------------------------------------------------------------- References -
Houman M H, zitoui . MI , Iaadihar Li, lamlonum M ,BenGhorhel Makni SI, Miled. M. (2002) Autoantibodies in Behcet’s disease. Yonsei Med Journal, vol 41 . No 3 p .36. Hoy A., Leininger-Muller B., Kutter D., Siest, G., and Visvikis S. (2002) Growing significance of myeloperoxidase in non-infectious diseases. Clin Chem Lab Med 40: 2-8. Hunter
I. P., Ferguson
M. M., Scully
C. (1993) Effect of dietary gluten
elimination in patients with recurrent minor aphthous stomatitis and no detectable gluten enteropathy. Oral Surg Oral Med Oral Pathol 75: 595-598. Huong D. L., Wechsler, B., Papo, T., de Zuttere, D., Bletry, O., and Hernigou, A. (1997) Endomyocardial fibrosis in Behçet’s disease. Ann Rheum Dis 56: 205-208. -IImai Y. (1971) Studies on prognosis and symptoms of Behçet’s disease in long term observation. Jpn J Clin Ophthalmol 25: 661-694. Inaloz HS, Evereklioglu C, Unal B, Kirtak N, Eralp A, Inaloz SS (2004). The significance of immunohistochemistry in the skin pathergy reaction of patients with Behçet’s syndrome. J Eur Acad Dermatol Venereol 18:56–61 Isogai M, Hirata H , Isogai K , Matuo K, kimura K, Yokota k ,Oguma M, Tojo F ,kaneko, kotake, and S Ohno .( 2002 ) Anti- microbial activity of synthetic human cap 18. Pepsides to streptococcus sangus isolated from patients with Behcet’ s disease 10th International conference on Behcet’sdisease. In BD, June.( 2002), p. 93.
- 75 -
--------------------------------------------------------------------------------------------------------------- References -
-JJaber
L., Milo
G., Halpern
G. J., Krause
I., and Weinberger
A. (2002)
Prevalence of Behçet’s disease in an Arab community in Israel. Ann Rheum Dis 61: 365-366. Jablonski's Dictionary of Dentistry, (1992) p742. Jacyk wk . (1994) Behcet’sdisease in south Africa blackes: report of five cases J. Am Acad Dermatol . May;30 (5pt 2): 869-73. Jankowski J, Crombie I, Jankowski R (1992). Behçet’s syndrome in Scotland. Postgrad Med J 68:566–570. Japane’s group of BD (1990) Adapted from International Study Group for Behcet's Disease. Criteria for diagnosis of Behcet's disease. 335:1078. Jonker M., and Balner H. (1980) The major histocompatibility complex: a key to a better understanding of evolution. Transplantation Proceedings. 12: 575-581. Jorizzo
J. L. (1986) Behcet’s disease an updatebased on the international
conference in London Arch. Dermatol. 122:556-558. Jorizzo J. L., and Rogers R. S. (1990) Behçet’s disease. J Am Acad Dermatol 23: 738-741. -KKaklamani V. G., Vaiopoulos G., and Kaklamanis P.G. (1998) Behcet's disease. Semin Arthritis Rheum 27:197-217. Kaneko F., Takahashi Y., and Muramatsu Y. (1985) Immunological studies on aphthous ulcer and erythema nodosum like eruptions in Behçet’s disease. Br J Dermatol 113: 303-312.
- 76 -
--------------------------------------------------------------------------------------------------------------- References -
Kaneko F. Takahashr-Y, Muramatsu R, Miura Y. (1988) Immunological studies on aphthous ulcer and erythema nodosum-like eruptions in Behcet’sdisease British Journal Dermatol ; 113:303-12. Kantarova D., and Buc M. (2007) Genetic Susceptibility to Type 1 Diabetes Mellitus in Humans. Physiol. Res. 56: 255-266. Kari J. A., Shah V., and Dillon, M. J. (2001) Behçet’s disease in UK children: clinical features and treatment including thalidomide. Rheumatology (Oxford) 40: 933-938. Katzenellenbogen I, Feuerman EJ (1965) Beitrag zum Morbus Behçet Die Bedeutung der spezifschen. Hauthyperraktivität und der Behçetin Reaktion Hautarzt 16:13–18. Kayikcioglu M, Aksu K, Hasdemir C, Keser G, Turgan N, Kultursay H et al (2006) Endothelial functions in Behçet’s disease. Rheumatol Int 26(4):304–308. Kaya T. I., Dur, H., Tursen U., and Gurler A. (2002) Association of class I HLA antigens with the clinical manifestations of Turkish patients with Behçet’s disease. Clin Exp Dermatol 27:498-501. Kelly M. A., Rayner M. L., Mijovic C. H., and Barnet A. H. (2003) Molecular Aspectes of type 1 Diabetes.J Clin Pathol: Mol Pathol 56: 1-10. Kendall E., Todd J. A., and Campbell R. D. (1991) Molecular analysis of the MHC class II region in DR4, DR7, and DR9 haplotypes. Immunogenetics 34: 349-357. Klein J. (1976) Evolution and function of the major histocompatibility complex: facts and speculations. In: Gotze D, ed. The Major Histocompatibility System in Man and Animals, New York: Springer-Verlag p. 339-378. Kleinman D.V., Swango P. A., and Pindborg J. J. (1994) Epidemiology of oral mucosal lesions in United States schoolchildren. Community Dent Oral Epidemiol 22: 243-253.
- 77 -
--------------------------------------------------------------------------------------------------------------- References -
Koc Y., Gullu I., Akpek G., Akpolat T., Kansu E., and Kiraz S. (1992) Vascular involvement in Behçet’s disease. J Rheumatol 19: 402-410. Kone-Paut I., Gorchakoff-Molinas A., Weschler B., and Touitou I. (2002) Paediatric Behçet’s disease in France. Ann Rheum Dis 61:655-656. Kontogiannis V., and Powell R. J. (2000) Behçet’s disease. Postgrad Med J 76:629637. Krause-I, Rosen-Y, Kaplan-I, Milo-G, Guedj-D , Molad-Y, Weinberger-A. (1999 ) RAS in Behcet’sdisease Clinical features and correlation with systemic disease expression and severity. J-Oral- Pathology-Med. May . 28(5) : 193-6. Krause I., Uziel Y., Guedj D., Mukamel M., Harel L., and Molad Y. (1999) Childhood Behçet’s disease: clinical features and comparison with adultonset disease. Rheumatology (Oxford) 38:457-462. Krause I., Mader R., Sulkes J., Paul M., Uziel Y., and Adawi M. ( 2001) Behçet’s disease in Israel: the influence of ethnic origin on disease expression and severity. J Rheumatol 28:1033-1036. Kristine M Lohr , Francisco Talavera, Lawrence H, Alex J , Arthur. (2001) Behcet’sdisease Medical Journal . October. 29; Vol.2:No.10. Kural-Seyahi E., Fresko I., Seyahi N., Ozyazgan Y., Mat C., and Hamuryudan V.( 2003) The long-term mortality and morbidity of Behçet syndrome: a 2decade outcome survey of 387 patients followed at a dedicated center. Medicine (Baltimore) 82: 60-76. -LLakhanpal S., O’Duffy J. D., and Lie J. (1988) Pathology. In: Behçet’s disease: a contemporary synopsis. Plotkin G, Calabro J, O’Duffy J, editors. New York: Futura Publishing Company, pp. 102-142. - 78 -
--------------------------------------------------------------------------------------------------------------- References -
Lamb J. R., and Young D. B. (1990) T cell recognition of stress proteins. A link between infectious and autoimmune disease. Mol Biol Med 7: 311-321. Lannuzel A., Lamaury I., Charpentier D., and Caparros-Lefebvre D. (2002) Neurological manifestations of Behçet’s disease in a Caribbean population: clinical and imaging findings. J Neurol 249: 410-418. Lau D., and Baldus S. (2006) Myeloperoxidase and its contributory role in inflammatory vascular disease. Pharmacol Ther 111: 16-26. Lee KH, Cho HJ, Kim HS, Lee WJ, Lee S, Bang D (2002) Activation of extracellular signal regulated kinase 1/2 in human dermal microvascular endothelial cells stimulated by anti-endothelial cell antibodies in sera of patients with Behçet’s disease. J Dermatol Sci 30(1):63–72 Lee KH, Chung HS, Kim HS, Oh SH, Ha MK, Baik JH (2003) Human alphaenolase from endothelial cells as a target antigen of anti-endothelial cell antibody in Behçet’s disease. Arthritis Rheum 48(7):2025–2035 Lehner
T. (1968) Autoimmunity in oral diseases, with special reference to
recurrent oral ulceration. Proceedings of the Royal Society of Medicine, 61: 515-524. Lehner
T., Lovery
E., and
Smith
R. (1991) Association between the 65
kilodalton heat shock protein streptococcus sangius and the corresponding antibodies in Behçet’s syndrome. Infect Immun 59: 1434-1441. Lemmel C., Rammensee H. G., and Stevanovic S. (2003) Peptide motif of HLAB5101 and the linkage to Behçet’s disease. In: Zierhut M, Ohno S (eds) Immunology of Behçet’s disease. Swets & Zeitlinger, Lisse, pp 127-137. -MMacphail L. A., Greenspan D., Feigal D. W., Lennette E. T., and Greenspan J. S. (1991) Recurrent aphthous ulcers in association with HIV infection: - 79 -
--------------------------------------------------------------------------------------------------------------- References -
description of ulcer types and analysis of T-lymphocyte subsets. Oral Surg Oral Med Oral Pathol 71: 678-683. MacPhail L. A, and Greenspan J. S. (1997) Oral ulceration in HIV infection: investigation and pathogenesis. Oral Dis;3:Suppl 1:S190-S193. Maenaka, K., Maenaka, T., Tomiyama, H.,Takiguchi, M., Stuart, D.I.,Jones, E.Y. (2000) Nonstandard peptide binding revealed by crystal structures of HLAB*5101, J.Immunol. 165: 3260 Mason R. M., and Barnes C. G. (1969) Behget's syndrome with arthritis. Annals of the Rheumatic Diseases 28: 95-103. Matsumuras N.and M. Zushina Y. (1979) leukocyte movement and colchicines treatment in BD. lancet; 2:813. Mc Cartan B. E., and Sullivan A. (1992) The association of menstrual cycle, pregnancy, and menopause with recurrent oral aphthous stomatitis: a review and critique. Obstet Gynecol 80: 455-458. Mege J. L., Dilsen N., Sanguedolce V., Gul A., Bongrand P., and Roux H. (1993) Overproduction of monocyte derived tumor necrosis factor alpha, interleukin (IL) 6, IL-8 and increased neutrophil superoxide generation in Behçet’s disease. A comparative study with familial Mediterranean fever and healthy subjects. J Rheumatol 20:1544-1549. Meguro A, Inoko H, Ota M, (2009) Genetics of Behçet’s disease inside and outside the MHC. Ann Rheum Dis 69:747–754. Melikoglu M, Kural-Seyahi E, Tascilar K, Yazici H (2008) The unique features of vasculitis in Behçet’s syndrome. Clin Rev Allergy Immunol 35(1–2):40–46 Melikoglu
M., Altiparmak
M. R., Fresko
I., Tunc
R., Yurdakul S
and
Hamuryudan V.( 2001). A reappraisal of amyloidosis in Behçet’s syndrome. Rheumatology (Oxford) 40: 212-215.
- 80 -
--------------------------------------------------------------------------------------------------------------- References -
Merchant HW, Gangarosa LP, Glassman AB, Sobel RE. (1977) Zinc sulphate supplementation for the treatment of recurring oral ulcers. South Med J 70: 559-61. Mikulicz von J., and Kümmel W. (1898) Die Krankheiten des Mundes, Jena . Miller MF, Ship II. (1977) A retrospective study of the prevalence and incidence of recurrent aphthous ulcers in a professional population, 1958-1971. Oral Surg Oral Med Oral Pathol 43: 532-7. Miller SA, Dykes DD, Polesky HF (1988) A simple salting out procedure for extracting
DNA
from
human
nucleated
cells.
Nucleic
Acids
Research;vol.16,p:1215. Mizuki N., Ota M., Yabuki K., Katsuyama Y., Ando H., and Palimeris G. D., (2000) Localization of the pathogenic gene of Behçet’s disease by microsatellite analysis of three different populations. Invest Ophthalmol Vis Sci 41: 3702-3708. Mizuki N., Yabuki K., Kondiatis E., Stephens H. A., Madanat W., Kanawati C. A., Stanford M. R., and Vaughan R. W. (1999) MIC-A allele profiles and HLA class I associations in Behcet’s disease. Immunogenetics 49: 613-617. Mizuki N, Ota M, Katsuyama Y, Yabuki K, Ando H, Shiina T, Nomura E, Onari K, Ohno S, Inoko H. (2001) HLA-B*51 allele analysis by the PCR -SBT method and a strong association of HLA-B*5101 with Japanese patients with Beh et’s disease.Tissue Antigens; 58: 181-4. Mizushima Y., Matsuda T., and Hoshi K . (1988) Induction of Behçet’s disease symptoms after dental treatment and streptococcal antigen skin test. J Rheumatol 15: 1029-1030. Mogulkoc N., Burgess M. I., and Bishop P. W. (2000) Intracardiac thrombus in Behçet’s disease: a systematic review. Chest 118:479-487. - 81 -
--------------------------------------------------------------------------------------------------------------- References -
Muhaya M., Lightman S., Ikeda E., Mochizuki M., Shaer B., and McCluskey P. (2000) Behçet’s disease in Japan and in Great Britain: a comparative study. Ocul Immunol Inflamm 8:141-148. Mumcu G, Ergun T, Inanc N, Fresko I, Atalay T, Hayran O, Direskeneli H. (2004) Oral health is impaired in Behçet's disease and is associated with disease severity. Rheumatology (Oxford). Aug;43(8):1028-33. Muzyka BC, Glick M. (1994) Major aphthous ulcers in patients with HIV disease. Oral Surg Oral Med Oral Pathol 77: 116-20, 1. -NNamba K., Uena T., and Okito M. (1986) Behçet’s disease and streptococcal infection. Jpn J Ophthalmol 30: 385-401. Natah S. S., Konttinen Y. T., Enattah N. S., Ashammakhi N., and Sharkey K. A. Hayrinen-Immonen R. (2004) Recurrent aphthous ulcers today: a review of the growing knowledge. Int J Oral Maxillofac Surg 33: 221-234. Nazzaro P. (1966) Cutaneous manifestations of Behçet’s disease. In: International Symposium on Behçet’s Disease in Rome. Monacelli M, Nazzaro P, editors. Karger: Basel, p. 1-24. Nevill B. W., and Damin D. D., Alleu Man Bouguot J. E. (1995) Oral and Maxillofacial pathology. 1st edition W. B. Saunders company philadelphia. P. 236 -255. Nishiura K, Kotake S, Ichiishi A, Matsuda H (1996) Familial occurrence of Behçet’s disease.Jpn J Ophthalmol 40:255–259. Nishiyama M., Nakae K., and Umehara T. (2001) A study of familial occurrence of Behçet’s disease with and without ocular lesions. Jpn J Ophthalmol 45:313-316.
- 82 -
--------------------------------------------------------------------------------------------------------------- References -
Niven M. J., Hitman G. A., Pearce H., Marshall B., and Sachs J. A. (1990) Large haplotype-specific differences in inter-genic distances in human MHC shown by pulsed field electrophoresis mapping of healthy and type 1 diabetic subjects. Tissue Antigens 36: 19-24. Nolan A, McIntosh WB, Allam BF, Lamey PJ. (1991) Recurrent aphthous ulceration: Vitamin B1, B2 and B6 status and response to replacement therapy. J Oral Pathol Med 20: 389-91, Notani K., Kobayashi S., Kondoh K., Shindoh M., Ferguson M. M., and Fukuda H. A. (2000) Case of Sweet’s syndrome (acute febrile neutrophilic dermatosis) with palatal ulceration. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 89: 477-479. -OO’Duffy J. D. (1978) Summary of International Symposium on Behçet’s Disease. Istanbul .1977. J Rheumatol 5:229-233. Ohno S., Ohguchi M., Hirose S., Matsuda H., Wakisaka A., and Aizawa M. (1982) Close association of HLA-Bw51 with Behc¸et’s disease. Arch Ophthalmol. 100: 1455-1458. Ohno S., Zierhut M., Mizuki N. (2003) Immunology and functional genomics of Behçet’s disease. Cell Mol Life Sci 60 (9): 1903-1922. Ohno S, Verity DH, Marr JE (1999) Behçet’s disease, the Silk Road and HLAB51:historical and geographical perspectives. Tissue Antigens 54:213–220. Önder M., and Gürer M. A. (1999) Behçet’s disease: an enigmatic vasculitis. Clin Dermatol 17: 571-576. Ono S, Aoki K, Sugiura S et al (1973) HL-A5 and Behçet’s disease. Lancet 2:1383–1384. Ono S, Nakayama E, Sugiura S. (1975) Specific histocompatibility antigens associated with Behçet’s disease. Am J Ophthalmol 80:636–641 - 83 -
--------------------------------------------------------------------------------------------------------------- References -
Olson JA, Feinberg I, Silverman S, Abrams D, Greenspan JS.(1982) Serum vitamin B12, folate, and iron levels in recurrent aphthous ulceration. Oral Surg Oral Med Oral Pathol 54: 517-20.
-PPabinger S. (2006) Development of a Web-based application for managing and analyzing real-time PCR experiments. Fachhochschul-Diplomstudiengang. Hagenberg, Austria. Pedersen A., Madsen H. O., Vestergaard B. F., and Ryder L. P. (1993) Varicella zoster virus DNA in recurrent aphthous ulcers. Scand J Dent Res 101: 311313. Petersen MJ, Baughman RA. (1996) Recurrent aphthous stomatitis: primary care management. Oral Diagnostic, Nurse Pract. May;21(5):36-40, 42, 47. Penn D. J., and Potts W. K. (1999) The evolution of mating preferences and major histocompatibility complex genes. American Naturalist 153: 145-164. Peretz B. (1994) Major recurrent aphthous stomatitis in an 11 year old girl: case report. J Clin Pediatr Dent 18: 309-312. Phelan JA, Eisig S, Freedman PD, Newsome N, Klein RS.(1991) Major aphthouslike ulcers in patients with AIDS. Oral Surg Oral Med Oral Pathol 71: 68-72. Pipitone N, Boiardi L, Olivieri I et al (2004) Clinical manifestations of Behçet’s disease in 137 Italian patients: results of a multicenter study. Clin Exp Rheumatol 22(Suppl 36):S46–S51 Porter S. R., Scully C., and Pedersen A. (1998) Recurrent aphthous stomatitis. Crit Rev Oral Biol Med. 9(3): 306-321.
-RRawi Z. S., Neda A. H.( 2003) Prevalence of Behçet’s disease among Iraqis. Adv Exp Med Biol 528: 37-41. - 84 -
--------------------------------------------------------------------------------------------------------------- References -
Raziuddin S., Al- Dalaan A., Bahabri S., Siraj A. K., and Al- Sedairy S. (1998) Divergent cytokine production profile in Behçet’s disease. Altered Th1/Th2 cell cytokine pattern. J Rheumatol 25:329-333. Rehberger A., Puspok A., Stallmeister T., Jurecka W., and Wolf K. (1998 ) Crohn’s disease masquerading as aphthous ulcers. Eur J Dermatol l8(4):274276. Rennie J. S., Reade P. C., Hay K. D., and Scully C. (1985) Recurrent aphthous stomatitis-review. Br Dent J 159: 361-367. Rivera-Hidalgo F., Shulman J. D., and Beach M. M. (2004) The association of tobacco and other factors with recurrent aphthous stomatis in an US adult population. Oral Dis 10: 335-345. Rodu B., and Mattingly G. (1992) Oral mucosal ulcers diagnosis and management. J Am Dent Assoc. 123(10): 83-86. Rogers R. S. (1997) Recurrent aphthous stomatitis: clinical characteristics and associated systemic disorders. Semin Cutan Med Surg. 16(4):278-283. Rogers |||. (2002)Complex aphthousis .10th Int.Conf.On Behcet's disease .June; p 60 . -SSaatchi A, Fathi MH, Salehi M, , Mortazavi V, Moosavi SB. (2003) Behcet Diseas, Dent Mater. May;19(3):188-98 Sakaguchi T., Ibe M., and Miwa K. (1997) Predominant role of N-terminal residue of nonamer peptides in their binding to HLA-B 5101 molecules. Immunogenetics 46:245-248. Sakane T., Takeno M., Suzuki N., Inaba G. N., and Engl J. (1999) titlakay 341(17): 1284-1291. - 85 -
--------------------------------------------------------------------------------------------------------------- References -
Sallay K., Kulcsár G., Nász I., Dán P., and Geck P.(1973) Adenovirus isolation from recurrent oral ulcers. J Periodontol 44: 712-714. Salvarani C, Boiardi L, Mantovani V, Olivieri I, Ciancio G, Cantini F, Salvi F, Malatesta R, Molinotti C, Govoni M, Trotta F, Filippini D, Paolazzi G, Viggiani M. (2001) Association of MICA alleles and HLAB51 in Italian patients with Beh et’s disease. J Rheumatol; 28: 1867-70. Sambroock J, Fritsch EF, Manlatis T (1989) Molecular cloning A laboratory manual. 2nd edn. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Sano K, Yabuki K, Imagawa Y (2001) The absence of disease-specific polymorphisms within the HLA-B51 gene that is the susceptible locus for Behçet’s disease. Tissue Antigens 58:77–82. Saylan T., Mat C., Fresko I., and Melikoglu M. (1999) Behçet’s disease in the Middle East. Clin Dermatol 17:209-223. Schafer P. H., Pierce S. K., and Jardetzky T. S. (1995) The structure of MHC class II: a role for dimer of dimers. Seminars in Immunology7: 389-398. Schreiber A. B., Schlessinger J., and Edidin M. (1984) Interaction between major histocompatibility complex antigens and epidermal growth factor receptors on human cells. Journal of Cell Biology 98: 725-731. Scully
C., and Felix
D. H. (2005)
Oral medicine: update for the dental
practioner. Aphthous and other common ulcers. Br Dent J 199(5):259-264. Scully
C
., Gorsky
M., and Lozada-Nur
F. (2003) The diagnosis and
management of recurrent aphthous stomatitis: a consensus approach. J Am Dent Assoc 134:200-207. Scully C., and Porter S. (1989) Recurrent aphthous stomatitis: current concepts of etiology, pathogenesis and management. J Oral Pathol Med 18: 21-27. Sedghizadeh P. P., Shuler C. F., Allen C. M., Beck F. M., and Kalmar J. R. (2002) Celiac disease and recurrent aphthous stomatitis: a report and review - 86 -
--------------------------------------------------------------------------------------------------------------- References -
of the literature. Oral Surg Oral Med Oral Pathol Oral Radiol Endod.94:474478. Seung H. R., Young B. Kim., and Eun S. L. (2005) Comparison of Behcet’s Disease and Recurrent Aphthous Ulcer According to Characteristics of Gastrointestinal Symptoms J Korean Med Sci 20: 971-976. Sharquie K E (1984) Suppression of Behçet's disease with dapsone Apr;110(4):493-4. Sharquie K E (1990) Behcet’s disease Postgraduate doctor Middle East .13:186190. Sharquie KE, Najim RA, Hussein AK (2000) Behcet Disease, Saudi Med J 21(5):464-7. Shimizu T., Ehrlich G. E., Inaba G., and Hayashi K. (1979) Behçet disease (Behçet syndrome) Semin Arthritis Rheum 8: 223-260. Ship II.( 1965) Inheritance of aphthous ulcers of the mouth. J Dent Res 44: 837-44. Ship I. I. (1996) Socioeconomic status and recurrent aphthous ulcers. J Am Dent Assoc 73: 120-123. Ship J. A. (1997) Recurrent aphthous stomstitic .an update .Oral .surg. Oral Med., Oral pathol. Oral Radiol, Oral Endod. 81: 141-147. Shulman J. D. (2004) An exploration of point, annual, and lifetime prevalence in characterizing recurrent aphthous stomatitis in USA children and youths. J Oral Pathol Med 33:558-566. Siepmann
M., Kirch
W. (1997) Coronary anomaly in Behçet’s syndrome.
Rheumatol Int 17: 39-42.
- 87 -
--------------------------------------------------------------------------------------------------------------- References -
Sircus W., Church R., and Kelleher J. (1957) Recurrent aphthous ulceration of the mouth: a study of the natural history, aetiology, and treatment. Quart J Med 26: 235-249. Snell G.D. (1981) Studies in histocompatibility. Science. 213: 172-178. Sohn S., Bang D., Lee E. S., Kwon H. J, Lee S. I., and Lee S. (2001) Experimental studies on the antiviral agent famciclovir in Behçet’s disease symptoms in ICR mice. Br J Dermatol 145(5):799-804. Sohn S., Lutz M., Kwon H. J., Konwalinka G., Lee S., and Schirmer M. (2004) Therapeutic effects of gemcitabine on cutaneous manifestations in an Adamantiades–Behçet’s disease-like mouse model. Exp Dermatol 13(10): 630-634. Somesb Gupta MD, DNB Skika , vema saliva malhoulous. (2002) Multilating large genital ulcers in women due to Behcet’sdisease /Bipolar aphthosis of Neumann . 10th International conference of Behcet’sdisease . June. p75. Soysal M, Denizci U, Alhan S, Hamuryudan V, Dede H, Yurdakul S, Altuğ A, Yazici H. (1990) Splenic size in Behçet's syndrome. Dec;29(6):497-8. Stanley, H. R. (1972) Aphthous lesions Oral Surg Oral Med Oral Pathol 33: 407416. Stratigos A., Laskaris G., and Stratigos J. (1992) Behçet’s disease. Semin Neurol 12: 346-357. Studd M., McCance D. J., and Lehner T. (1991) Detection of HSV-1 DNA in patients with Behçet's syndrome and in patients with recurrent oral ulcers by the polymerase chain reaction. J Med Microbiol 34: 39-43. Sugisaki K, Saito R, Takagi T et al (2005) HLA-B52-positive vasculo-Behçet’s disease: usefulness of magnetic resonance angiography, ultrasound study,
- 88 -
--------------------------------------------------------------------------------------------------------------- References -
and computed tomographic angiography for the early evaluation of multiarterial lesions. Mod Rheumatol 15:56–61. Sun A., Chang J. G., Kao C. L., Liu B. Y., Wang J. T., Chu C. T., Yuan J. H., Chiang C. P. (1996) Human cytomegalovirus as a potential etiologic agent in recurrent aphthous ulcers and Behçet's disease. J Oral Pathol Med 25: 212218. Sun A., Chang J. G., Chu C. T., Liu B. Y., Yuan J. H., Chiang C. P. (1998) Preliminary evidence for an association of Epstein-Barr virus with preulcerative oral lesions in patients with recurrent aphthous ulcers or Behçet’s disease. J Oral Pathol Med 27: 168-175. Svejgaard A., and Ryder L. P. (1976) Interaction of HLA molecules with nonimmunological ligands as an explanation of HLA and disease association. Lancet ii: 547-549. -TTaback L.A., Levine M. J., Mandel I. D., and Ellison S. A. (1982) Role of salivary mucins in the protection of the oral cavity. J Oral Pathol 11: 1-17. Takemoto Y, Naruse T, Namba K et al (2008) Re-evaluation of heterogeneity in HLAB* 510101 associated with Behçet’s disease. Tissue Antigens 72:347– 353. Takeno M., Kariyone A., Yamashita N., Takiguchi M., Mizushima Y., Kaneoka H. (1995) Excessive function of peripheral blood neutrophils from patients with Behçet’s disease and from HLA-B51 transgenic mice. Arthritis Rheum 38:426-433. The MHC sequencing consortium (1999) Complete sequence and gene map of a human major histocompatibility complex. Nature; 401: 921-923. Tilliss T.S.I., and McDowell J.D. (2002) Differential Diagnosis: Is It Herpes or Aphthous? J Contemp Dent (3)1:001-015.
- 89 -
--------------------------------------------------------------------------------------------------------------- References -
Treudler R., Orfanos C. E., and Zouboulis C. C. (1999) Twenty-eight cases of juvenile-onset Adamantiades-Behçet disease in Germany. Dermatology 199:15-19. Trowsdale J. (1995) Both man & bird & beast comparative organization of MHC genes Review Immunogenetics; 41: 1-17. Tuzun B., Tuzun Y., Yurdakul S., Hamuryudan V., Yazici H., and Ozyazgan Y. (1999) Neutrophil chemotaxis in Behçet's syndrome. Ann Rheum Dis 58:658Tuzun Y., Yurdakul S., Cem M. M., Ozyazgan Y., Hamuryudan V., and Tuzun B. (1996) Epidemiology of Behçet’s syndrome in Turkey. Int J Dermatol 35:618-620. -VVerland S., Simonsen M., Gammeltoft S., Allen H., Flavell R. A., and Olsson L. (1989) Specific molecular interaction between the insulin receptor and a D product of MHC class I. Journal of Immunology. 143: 945-951. Verpilleux M. P., Bastuji-Garin S., and Revuz J. (1999) Comparative analysis of severe aphthosis and Behçet’s disease: 104 cases. Dermatology 198:247-251. Viljoen G.J., Nel L. H., Crowtherl J. R. (2005) Molecular Diagnostic PCR Handbook. Published by Springer. IAEA. Vincent S. D., and Lilly G. E. (1992) Clinical, historic, and therapeutic features of aphthous stomatitis. Literature review and open clinical trial employing steroids. Oral Surg Oral Med Oral Pathol 74: 79-86.
-WWallace G R., Verity DH. Delamaine L J., Ohno S., Inoko H., Ota M. Mizuki N, Yabuki K, Kondiatis E, Stephens HA, Madanat W, Kanawati CA, - 90 -
--------------------------------------------------------------------------------------------------------------- References -
Stanford MR, Vaughan RW (1999) MIC-A allele profiles and HLA class I associations in Behçet's disease.Jul;49(7-8):613-7.
Winterbourn C. C., Vissers M. C., and Kettle A. J. (2000) Myeloperoxidase. Curr Opin Hematol 7:53-58. Wmadanat Z, Sharaiha S, Khasawneth H, Zureikat F, Fayrad. (2002) Gastrointestinal manifestations of Behçet's disease 10th In. Conf.on Behçet's disease Jun. P:85. Wong R. G., Ellis, C. N. Diaz, L. A. Behcet’s Disease. (1984) Int. J. Dermatol. Jan. Feb.; 23(1) :25-32. Wray D., Graykowski E. A., and Notkins A. L. (1981) British Medical J ii, 1569-1570. Wray D, Vlagopoulus TP, Siraganian RP. (1982) Food allergens and basophil histamine release in recurrent aphthous stomatitis. Oral Surg Oral Med Oral Pathol 54: 388-95, Wray D. (1982) A double-blind trial of systemic zinc sulfate in recurrent aphthous stomatitis. Oral Surg Oral Med Oral Pathol 53: 469-72.
-YYazici C., Kose K., Calis M., Demir M., Kirnap M., and Ates F. (2004) Increased advanced oxidation protein products in Behçet's disease: a new activity marker Br J Dermatol. 151:105-111. Yazici H., Yurdakul S., and Hamuryudan V. (1998) Behçet’s syndrome. In: Rheumatology. Klippel JH, Dieppe PA, editors. London: Mosby, pp. 1-6. Yazici H,, Yurdakul S., and Hamuryudan V., (2001) Behçet’s disease. Curr Opin Rheumatol .13:18-22.
- 91 -
--------------------------------------------------------------------------------------------------------------- References -
Yazici H. Soysal M, Denizci U, Alhan S, Hamuryudan V, Dede H, Yurdakul S, Altuğ A, (1990) Splenic size in Behçet's syndrome. Dec;29(6):497-8. Yingbin S., Shixin H., Jiuhong L., Qiushi R., Fangji S., and Hongduo Chen. (2009) The Clinical Feature of Behçet’s Disease in Northeastern China, Yonsei Med J 50(5): 630-636. Yurdakul S, Gunaydin I, Tuzun Y, Tankurt N, Pazarli H, Ozyazgan Y et al., (1988). The prevalence of Behçet’s syndrome in a rural area in northern Turkey. J Rheumatol 15:820–822 Yurdakul S., Hamuryudan V., and Yazici H. (2004) Behcet syndrome. Curr Opin Rheumatol.16: 38-42.
-ZZavazava N., and Eggert F. (1997) MHC and behavior. Immunology Today.18: 8-10. Zierhut
M., Mizuki
N., and Ohno
S. (2003) Immunology and functional
genomics of Behçet’s disease. Cell Mol Life Sci 60 (9): 1903-1922. Zinkernagel R. M. (1997) Cellular immune recognition and the biological role of major transplantation antigens. Scandinavian J of Immunology 46: 421-436. Zouboulis C. C., Kotter I., Djawari D., Kirch W., Kohl P. K., Ochsendorf F. R. (1997) Epidemiological features of Adamantiades-Behçet’s disease in Germany and in Europe. Yonsei Med J 38:411-422.
- 92 -
-ANucleotide of HLA-B51 gene My NCBI chromosome 6, GRCh37 primary reference assembly HLA B51(5)HLA-B major histocompatibility complex, class I, B
AGTTCTAAAGTCCCCACGCACCCACCCGGACTCAGAGTCTCCTCAGACGCCGAGATGCTGGTCATGGCGC CCCGAACCGTCCTCCTGCTGCTCTCGGCGGCCCTGGCCCTGACCGAGACCTGGGCCGGTGAGTGCGGGTC GGGAGGGAAATGGCCTCTGCCGGGAGGAGCGAGGGGACCGCAGGCGGGGGCGCAGGACCTGAGGAGCCGC GCCGGGAGGAGGGTCGGGCGGGTCTCAGCCCCTCCTCACCCCCAGGCTCCCACTCCATGAGGTATTTCTA CACCTCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCTCAGTGGGCTACGTGGACGACACCCAG TTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGAGAGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGG GGCCGGAGTATTGGGACCGGAACACACAGATCTACAAGGCCCAGGCACAGACTGACCGAGAGAGCCTGCG GAACCTGCGCGGCTACTACAACCAGAGCGAGGCCGGTGAGTGACCCCGGCCCGGGGCGCAGGTCACGACT CCCCATCCCCCACGTACGGCCCGGGTCGCCCCGAGTCTCCGGGTCCGAGATCCGCCTCCCTGAGGCCGCG GGACCCGCCCAGACCCTCGACCGGCGAGAGCCCCAGGCGCGTTTACCCGGTTTCATTTTCAGTTGAGGCC AAAATCCCCGCGGGTTGGTCGGGGCGGGGCGGGGCTCGGGGGACTGGGCTGACCGCGGGGCCGGGGCCAG GGTCTCACACCCTCCAGAGCATGTACGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGA CCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCCGCGGAC ACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCGGAGAGCCTACCTGG AGGGCGAGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGACAAGCTGGAGCGCGCTGGTAC CAGGGGCAGTGGGGAGCCTTCCCCATCTCCTATAGGTCGCCGGGGATGGCCTCCCACGAGAAGAGGAGGA AAATGGGATCAGCGCTAGAATGTCGCCCTCCGTTGAATGGAGAATGGCATGAGTTTTCCTGAGTTTCCTC TGAGGGCCCCCTCTTCTCTCTAGACAATTAAGGAATGACGTCTCTGAGGAAATGGAGGGGAAGACAGTCC CTAGAATACTGATCAGGGGTCCCCTTTGACCCCTGCAGCAGCCTTGGGAACCGTGACTTTTCCTCTCAGG CCTTGTTCTCTGCCTCACACTCAGTGTGTTTGGGGCTCTGATTCCAGCACTTCTGAGTCACTTTACCTCC ACTCAGATCAGGAGCAGAAGTCCCTGTTCCCCGCTCAGAGACTCGAACTTTCCAATGAATAGGAGATTAT
93
CCCAGGTGCCTGCGTCCAGGCTGGTGTCTGGGTTCTGTGCCCCTTCCCCACCCCAGGTGTCCTGTCCATT CTCAGGCTGGTCACATGGGTGGTCCTAGGGTGTCCCATGAAAGATGCAAAGCGCCTGAATTTTCTGACTC TTCCCATCAGACCCCCCAAAGACACACGTGACCCACCACCCCATCTCTGACCATGAGGCCACCCTGAGGT GCTGGGCCCTGGGTTTCTACCCTGCGGAGATCACACTGACCTGGCAGCGGGATGGCGAGGACCAAACTCA GGACACTGAGCTTGTGGAGACCAGACCAGCAGGAGATAGAACCTTCCAGAAGTGGGCAGCTGTGGTGGTG CCTTCTGGAGAAGAGCAGAGATACACATGCCATGTACAGCATGAGGGGCTGCCGAAGCCCCTCACCCTGA GATGGGGTAAGGAGGGGGATGAGGGGTCATATCTCTTCTCAGGGAAAGCAGGAGCCCTTCAGCAGGGTCA GGGCCCCTCATCTTCCCCTCCTTTCCCAGAGCCGTCTTCCCAGTCCACCGTCCCCATCGTGGGCATTGTT GCTGGCCTGGCTGTCCTAGCAGTTGTGGTCATCGGAGCTGTGGTCGCTGCTGTGATGTGTAGGAGGAAGA GTTCAGGTAGGGAAGGGGTGAGGGGTGGGGTCTGGGTTTTCTTGTCCCACTGGGGGTTTCAAGCCCCAGG TAGAAGTGTTCCCTGCCTCATTACTGGGAAGCAGCATGCACACAGGGGCTAACGCAGCCTGGGACCCTGT GTGCCAGCACTTACTCTTTTGTGCAGCACATGTGACAATGAAGGATGGATGTATCACCTTGATGGTTGTG GTGTTGGGGTCCTGATTCCAGCATTCATGAGTCAGGGGAAGGTCCCTGCTAAGGACAGACCTTAGGAGGG CAGTTGGTCCAGGACCCACACTTGCTTTCCTCGTGTTTCCTGATCCTGCCCTGGGTCTGTAGTCATACTT CTGGAAATTCCTTTTGGGTCCAAGACTAGGAGGTTCCTCTAAGATCTCATGGCCCTGCTTCCTCCCAGTG CCCTCACAGGACATTTTCTTCCCACAGGTGGAAAAGGAGGGAGCTACTCTCAGGCTGCGTGTAAGTGGTG GGGGTGGGAGTGTGGAGGAGCTCACCCACCCCATAATTCCTCCTGTCCCACGTCTCCTGCGGGCTCTGAC CAGGTCCTGTTTTTGTTCTACTCCAGGCAGCGACAGTGCCCAGGGCTCTGATGTGTCTCTCACAGCTTGA AAAGGTGAGATTCTTGGGGTCTAGAGTGGGTGGGGTGGCGGGTCTGGGGGTGGGTGGGGCAGAGGGGAAA GGCCTGGGTAATGGGGATTCTTTGATTGGGATGTTTCGCGTGTGTGGTGGGCTGTTTAGAGTGTCATCGC TTACCATGACTAACCAGAATTTGTTCATGACTGTTGTTTTCTGTAGCCTGAGACAGCTGTCTTGTGAGGG ACTGAGATGCAGGATTTCTTCACGCCTCCCCTTTGTGACTTCAAGAGCCTCTGGCATCTCTTTCTGCAAA GGCACCTGAATGTGTCTGCGTCCCTGTTAGCATAATGTGAGGAGGTGGAGAGACAGCCCACCCTTGTGTC CACTGTGACCCCTGTTCCCATGCTGACCTGTGTTTCCTCCCCAGTCATCTTTCTTGTTCCAGAGAGGTGG GGCTGGATGTCTCCATCTCTGTCTCAACTTTACGTGCACTGAGCTGCAACTTCTTACTTCCCTACTGAAA ATAAGAATCTGAATATAAATTTGTTTTCTCAAATATTTGCTATGAGAGGTTGATGGATTAATTAAATAAG TCAATTCCTGGAATTTGAGAGAGCAAATAAAGACCTGAGAACCTTCCAGAA
94
-BUniversity of Sulaimani College of Dentistry Department of Oral Diagnosis and Medicine Case No.:---------------------Name………………………………………… age… ….…Yr., sex………..… Address …………………………………. ………………………………
Occupation
Tel No:
Date……………..
Family history of Behjat disease
No………yes……………………………………………………..
Medical history
Oral Ulceration Type Minnor……………… Major………………. Herpitiform………….. - Location
………………………………………………………………………………
………………………………… - Frequency of occurance ………………………………………………………………………… ………………………………………………………. -No.of ulcer ........................................................................................................... -Duration ……………………………………………………………… - Respond totreatment or not …………………………………………….. -Skin lesion: -Genital lesion: -Eye lesion: -Joint manifestation : -Vascular involvement: -Other manifestation - HLA-B51 95
6 HLA-B51HLA- B
HLAB51
0048.3290051.63160 20 0037.515 25 1987 9 360022.5
002510 2 4 00156 HLA-B21 DNA
0026.6HLA-B51 0055.5 0030 00100 0015 HLA-B51 HLA-B51
HLA- B51
HLA-B51
1432
2011
: ﺑﺮﯾﻨﯽ ﺋﮫﻓﺜﮫﺳﯽ دووﺑﺎرهوهﺑﻮو ﺑﮫ ﯾﮫ ﻧﺎوﭘﯚﺷﯽ دهم داده
ھﮫره ﺑﺎوه دووﺑﺎرهوهﺑﻮو و ﮐﮫ
ﺑﺮﯾﻨﯽ ﺑﮫﺋﺎزار و ﭼﮫﻧﺪﺟﺎر ڕووداﻧﯽ ﺟﯿﺎده ھﯿﭻ
ﺳﮫرﺑﮫﺧﯚ ڕووﺑﺪات و ﭘﮫﯾﻮهﻧﺪی ﻧﮫ ﮐﯚﺋﮫﻧﺪاﻣﮫﮐﺎﻧﯽ ﺗﺮهوه ھﮫ ﺑﺖ وه
وه .ﺋﮫم ﺑﺮﯾﻨﮫ ﻟﮫواﻧﮫﯾﮫ
ﮐﯽ ﺗﺮ و ﻟﮫواﻧﮫﺷﮫ ﭘﮫﯾﻮهﻧﺪی ﺑﮫ ﭼﮫ ﻧﺪاﻣﯽ ھﮫرس ،ﮐﮫ
ﮐﯽ ﺧﯚﺷﯿﯽ
ﺑﮫھﺠﮫت. ﻧﮫﺧﯚﺷﯿﯽ ﺑﮫھﺠﮫت ﺑﮫ
ﭼﺎو ،ﺟﻮﻣﮕﮫﮐﺎن،
ﮐﯽ ﭼﮫﻧﺪ ﮐﯚﺋﮫ
وه .ﺑﮫزۆرﯾﯽ ،ﯾﮫﮐﮫم ﻧﯿﺸﺎﻧﮫی ﺑﺮﯾﻨﯽ ﺋﮫﻓﺜﮫﺳﯽ
ﻗﮫ ﮐﯚﺋﮫﻧﺪاﻣﯽ دهﻣﺎرﯾﺶ ده
دووﺑﺎرهوهﺑﻮوه ،ﯾﺎن ﺑﮫدهﮔﻤﮫن ﺑﺮﯾﻦ ﻟﮫ ﺋﮫﻧﺪاﻣﮫﮐﺎﻧﯽ زاوزێ ڕوودهدات .ﺋﮫم ﺑﺎره ﺗﻮوﺷﯽ ھﮫردوو ڕهﮔﮫزهﮐﮫ ده
ﺑﮫ
ھﮫر ﺗﮫﻣﮫ
ڕﯾﮑﮫوﺗﯽ ﻧﮫﺧﯚﺷﯿﯽ ﺑﮫھﺠﮫت ﺟﯿﺎوازه ﺑﮫ
زۆرﯾﯽ ﻟﮫ
ﺳ دهﯾﮫی دواﺗﺮی ﺗﮫﻣﮫن ڕوودهدات.
ی ﺟﻮﮔﺮاﻓﯿﺎﯾﯽ ،ﺑﮫرزﺗﺮﯾﻦ ﺋﺎﺳﺘﯽ ﺋﮫ
وﺗﮫ درﯾﮋه
ی ﺣﮫرﯾﺮﯾﯿﮫوه ﺑﮫرهو ﻧﺎوﭼﮫﮐﺎﻧﯽ ﺳﮫر دهرﯾﺎی ﻧﺎوهڕاﺳﺖ وه
ده ﺋﺎﺳﺘﯽ ﺋﮫ
وﺗﮫش ﻟﮫ
ﻣﺘﺮﯾﻦ
ڕۆژﺋﺎواﮐﺎﻧﮫ .ھﯚﮐﺎری ڕاﺳﺘﮫﻗﯿﻨﮫی ﻧﮫﺧﯚﺷﯿﯽ ﺑﮫھﺠﮫت ڕوون ﻧﯿﯿﮫ ﺑﮫ م وه ﻟﮫﺳﮫر ﻧﮫﺧﯚﺷﯿﯽ ﺑﮫھﺠﮫت ،ﭘﮫﯾﻮهﻧﺪی زۆر
ﺗﻮﮋهرهوهﮐﺎن ﭼﮫﻧﺪ ھﯚ-ﻓﺎﮐﺘﮫ
دﯾﺎرھﮫﯾﮫ ﻟﮫ ﻧﻮان HLA-Bو ﻧﮫﺧﯚﺷﯿﯽ ﺑﮫھﺠﮫت ﺑﮫﺗﺎﯾﺒﮫﺗﯽ ﺟﯿﻨﺊ ،HLA-B51ﮐﮫ ﮐﮫوﺗﻮوهﺗﮫ ﺳﮫر ﭘﮫﻟﯽ ﮐﻮرﺗﯽ ﮐﺮۆﻣﯚﺳﯚﻣﯽ ژﻣﺎره ﺷﮫش. وهﯾﮫ ،دۆزﯾﻨﮫوهی ﺟﯿﻨﯽ HLA-B51ﻟﮫ ﺋﮫو ﻧﮫﺧﯚﺷﺎﻧﮫی ﮐﮫ ﺑﺮﯾﻨﯽ
ﻣﮫﺑﮫﺳﺖ :ﻣﮫﺑﮫﺳﺖ ﻟﮫ ﺋﮫ
ﺋﮫﻓﺜﮫﺳﯽ دووﺑﺎرهوهﺑﻮو و ﻧﮫﺧﯚﺷﯿﯽ ﺑﮫھﺠﮫﺗﯿﺎن ھﮫﯾﮫ ﻟﮫ
ﺎﻧﯽ.
وهﮐﮫ 60 :ﮐﮫس ) 31ﻣ -51.6%-و 29ﻧﺮ (-%48.3-ﺑﮫﺷﺪارﺑﻮون ﻟﮫ ﺋﮫم وهﯾﮫ 40 ،ﻧﮫﺧﯚش و 20 ﻟﮫ
ﻧﺪروﺳﺖ ﮐﮫ ھﯿﭻ ﻧﯿﺸﺎﻧﮫﯾﮫﮐﯽ ﻧﮫﺧﯚﺷﯿﯽ ﺑﮫھﺠﮫﺗﯿﺎن ﻧﮫﺑﻮو،
و 40ﻧﮫﺧﯚﺷﮫی ﺗﺮ داﺑﮫﺷﮑﺮان ﺑﯚ ﺳﮫر 4ﮔﺮوپ ،ﮔﺮوﭘﯽ ﯾﮫﮐﮫم :ﮔﺮوﭘﯽ ﺑﺮﯾﻨﯽ ﺋﮫﻓﺜﮫﺳﯽ
دووﺑﺎرهوهﺑﻮو ﺑﻮون ،ﮐﮫ
ﻟﮫ 15ﻧﮫﺧﯚش ﮐﮫ دهﮐﺎﺗﮫ %37.5ﮐﮫ ﺗﮫﻧﮭﺎ ﺑﺮﯾﻨﯽ ﺋﮫﻓﺜﮫﺳﯽ
دووﺑﺎرهوهﺑﻮوی دهﻣﯿﺎن ھﮫﺑﻮو .ھﮫروهھﺎ 25ﻧﮫﺧﯚﺷﮫﮐﮫی ﺗﺮﯾﺶ ﺟﺎرﯾﮑﯽ ﺗﺮ داﺑﮫﺷﮑﺮان ﺑﯚ ﺳﮫر 3 ﮔﺮوﭘﯽ ﺑﺠﻮﮐﺘﺮ ﺑﮫ
وهﯾﯽ ﻧﮫﺧﯚﺷﯿﯽ ﮐﯚﻣﯿﺘﮫ
ﺑﮫھﺠﮫت ) ﭼﺎوﭘ ﺎﺧﺸﻨﺮاوو (1987ﮔﺮوﭘﯽ دووهم: ﮐﮫﻟﮫ 9ﻧﮫ
6) %22.5ﻣ و 3ﻧﺮ(
وهی ﻧﮫﺧﯚﺷﯿﯽ ﺧﯚﺷﯿﯽ ﺑﮫھﺠﮫت ﺑﻮون م :ﮔﺮوﭘﯽ ﻧﺎﺗﮫواوی ﻧﮫﺧﯚﺷﯿﯽ
1) %25ﻣ 9 ،ﻧﺮ( ﮔﺮوﭘﯽ ﺟﻮارهم :ﮔﺮوﭘﯽ ﺗﮫواوهﺗﯽ
ﺑﮫھﺠﮫت ﺑﻮون ﮐﮫ ﻟﮫ 10ﻧﮫ ﻧﮫﺧﯚﺷﯿﯽ ﺑﮫھﺠﮫت ﺑﻮون و ﻟﮫ 6ﻧﮫ ﻟﮫ
4) %15ﻣ 2 ،ﻧﺮ( DNA ,ﺗﺮﺷﮫ ﻧﺎوﮐﯽ دوواﻧﯿﯽ ی ﺳﯚﻟﺘﯿﻦ ﺋﺎوت ،ﭘﺎﺷﺎن ﺟﯿﻨﯽ HLA-B51
ر 60ﻧﮫﺧﯚﺷﮫﮐﮫ ده
ﮔﮫورهﮐﺮاﯾﮫهوه ﺑﮫ ﮐﺎرﻟﯿﮑﯽ زﻧﺠﯿﺮه ﭘﯚﻟﯿﻤﮫرﮐﺮدن ﺑﮫ ﺑﮫ
ت.
ﺋﮫﻧﺠﺎم :ﺋﮫﻧﺠﺎﻣﮫﮐﺎن ﺋﮫوهﯾﺎن دهرﺧﺴﺖ ﮐﮫ HLA-B51ﭘﯚزهﺗﯿﭫ ﺑﻮو ﻟﮫ %26.6ﮔﺮوﭘﯽ ﺑﺮﯾﻨﯽ ﺋﮫﻓﺜﮫﺳﯽ ﺧﯚﺷﯿﯽ ﺑﮫھﺠﮫت %30 ،ﮔﺮوﭘﯽ ﻧﺎﺗﮫواوی
دووﺑﺎرهوهﺑﻮو %55.5،ﻟﮫ
ﻧﮫﺧﯚﺷﯿﯽ ﺑﮫھﺠﮫت %100 ،ﮔﺮوﭘﯽ ﺗﮫواوی ﻧﮫﺧﯚﺷﯿﯽ ﺑﮫھﺠﮫت ،و %15ﮐﯚﻧﺘﺮۆڵ .ﺑﮫرﺟﺎوﺗﺮﯾﻦ دۆزﯾﻨﮫوه ﻟﮫ ﺋﮫ
وهدا ﺋﮫو ﭘﮫﯾﻮهﻧﺪﯾﮫ زۆرهﯾﮫ ﮐﮫ ﻟﮫ ﻧﯿﻮان ﻧﮫﺧﯚﺷﯿﯽ ﺑﮫھﺠﮫت و ﺟﯿﻨﯽ HLA-B51
دا ھﮫﺑﻮو .ﺟﯿﻨﯽ HLA-B51
رهﮐﯽ ده
ڕاﺳﺘﮫﻗﯿﻨﮫی ﺋﮫم ﻧﮫﺧﯚﺷﯿﯿﮫ ﻧﯿﯿﮫ ،ﺑﮫ م ده ﮐﮫﺳﺎﻧﯽ ﺗﮫﻧﺪروﺳﺘﯿﺸﺪا ھﮫﯾﮫ.
ڕووداﻧﯽ ﻧﮫﺧﯚﺷﯽ ﺑﮫھﺠﮫت دا ﺑﮫ ﺧﺘﯽ ﺳﮫره
ﺑﮫر ﺋﮫوهی ﺋﮫم ﺟﯿﻨﮫ ﻟﮫ
HLA-B51
2003
2011
1432
2711
