Journal of Biotechnology 117 (2005) 267–275

Chitin-binding domain based immobilization of d-hydantoinase Jong-Tzer Chern, Yun-Peng Chao ∗ Department of Chemical Engineering, Feng Chia University, 100 Wenhwa Road, Taichung, Taiwan Received 9 September 2004; received in revised form 21 January 2005; accepted 9 February 2005

Abstract Chitin-binding domain (ChBD) of chitinase A1 from Bacillus circulans WL-12 comprises 45 amino acids and exhibits remarkably high specificity to chitin (Hashimoto, M., Ikegami, T., Seino, S., Ohuchi, N., Fukada, H., Sugiyama, J., Shirakawa, M., Watanabe, T., 2000. Expression and characterization of the chitin-binding domain of chintinase A1 from B. circulans WL-12. J. Bacteriol. 182, 3045–3054.). To investigate the feasibility of exploiting ChBD as affinity tags to confine enzymes of interest on chitin, ChBD fused to the C-terminus of the gene encoding d-hydantoinase was constructed. Subsequent expression of the hybrid protein in Escherichia coli gave a soluble fraction accounting for 8% of total cell protein content. Direct adsorption of the ChBD-fused d-hydantoinase on chitin beads was carried out, and SDS-PAGE analysis showed that the linkage between the fusion protein and the affinity matrix was highly specific, substantially stable, and reversible. As compared to its free counterpart, the immobilized d-hydantoinase exhibited higher tolerance to heat and gained a half life of 270 h at 45 ◦ C. In addition, the shelf life (defined as 50% of initial activity remained) of the immobilized enzyme stored at 4 ◦ C was found to reach 65 days. Furthermore, d-hydantoinase immobilized on chitin could be reused for 15 times to achieve the conversion yield exceeding 90%. Overall, it illustrates the great usefulness of ChBD for enzyme immobilization. © 2005 Elsevier B.V. All rights reserved. Keywords: Chitin-binding domain; Enzyme immobilization; Bioconversion; d-hydantoinase

1. Introduction The approach by restriction of enzymes in a defined space allowing enzyme reutilization without the need of further purification is particularly useful for the applied bioprocess. In general, immobilization methods developed to date can be classified into two categories, ∗ Corresponding author. Tel.: +886 4 24517250 3677; fax: +886 4 24510890. E-mail address: [email protected] (Y.-P. Chao).

0168-1656/$ – see front matter © 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.jbiotec.2005.02.001

including entrapment and surface fixation. The former calls for the physical enclosure of enzyme in the porous materials. However, the problem of diffusion limitations to the enzymatic reaction is commonly encountered. In contrast, the latter aims at retaining enzymes on the support surface. To achieve long-standing retention of enzymes, it requires the chemical modification of support materials followed by fixing them on the matrix surface via covalent binding. However, the condition involving chemical treatment is usually harsh to most of the enzymes to be immobilized. Moreover, it

268

J.-T. Chern, Y.-P. Chao / Journal of Biotechnology 117 (2005) 267–275

frequently obtained the heterogeneous preparation of immobilized enzymes due to the probability of more than one functional site of enzymes binding to the matrix surface. The advance in recombinant DNA technology has made the creation of chimeric proteins easily achievable. In principle, the protein engineered to carry affinity tags from heterologous sources is able to bind specifically to its unnatural cognate ligands. This approach has become widely acceptable for enzyme immobilization based on the following merits: (1) strong and reversible binding of enzymes to the support; (2) proper orientation of immobilized enzymes to expose their active domains; (3) mild immobilization conditions; (4) direct affinity of enzymes to the support from crude cell-free extract (CFX); and (5) the lack of diffusion constraints (Salemuddin, 1999). A broad spectrum of fusion tags has been explored (Terpe, 2003), and the choice of an appropriate affinity tag for use remains biased. Among the peptide tags previously developed, FLAG, poly-His, c-myc, and glutathione S-transferase are the most commonly used. However, the matrix materials for the binding of these affinity peptides are costly. Recent progress in using cellulose-binding domain (CBD) as a fusion tag has proven very useful to immobilize enzymes on cellulose (Shpigel et al., 1999). This approach receives great attractiveness mainly because of low cost and availability of cellulose. Nevertheless, the CBD-fused protein expressed in Escherichia coli is usually prone to aggregates, thereby leading to the requirement for protein refolding prior to the administration of enzyme immobilization. Chitin-binding domain (ChBD) of chitinase A1 from Bacillus circulans WL-12 is a small peptide consisting of 45 amino acids. Previous studies showed that ChBD exhibited remarkably high specificity to chitin and its binding activity was reversible and functional over a wide range of pHs (Hashimoto et al., 2000; Watanabe et al., 1994). It is expected that the interference of ChBD with the tertiary structure of fusion proteins would be minimal owing to its small size. In addition, chitin is the most abundant naturally existing polysaccharides from the cell wall structure of fungi and the exoskeletons of invertebrates (Wen et al., 2002). It would be appealing to use chitin as the adsorption matrix on economic grounds. Accordingly, in this study we have attempted to immobilize ChBD-

linked d-hydantoinase on chitin. The result illustrates the great usefulness of ChBD for enzyme immobilization, and it clearly opens up a new route in bioprocess engineering.

2. Materials and methods 2.1. Materials The enzymes utilized for gene cloning were mainly from New England Biolabs (MA, USA). Pfu polymerase applied in polymerase chain reaction (PCR) was obtained from Promega (WI, USA). d,lHydroxyphenyl hydantoin (dl-HPH) was purchased from TCI (Tokyo, Japan) and other chemicals were from Sigma (MO, USA). As the immobilization matrix, chitin beads with size ranging between 50 and 100 ␮m in diameter were obtained from New England Biolabs. 2.2. DNA manipulation and bacterial strains The E. coli strain DH5␣ (deoR endA1 gyrA96 hsdR17 supE44 thi1 recA1 lacZM15) was used as an intermediate cell for gene cloning. To clone ChBD, the genomic DNA of B. circulans WL-12 (CCRC, Taiwan) was prepared in compliance with the previous method (Chao et al., 2003). The isolated genome was used as the template and subsequent performance of PCR with the primers (GCAAAGCTTGGCCTGACCGGTCTGAAC and TTCCTCGAGCCCGGGTTGAAGCTGCCACCAGGCAG) gave the DNA product of ChBD. Cleaved by HindIII and XhoI, the PCR DNA was ligated to pBluescript (Stratagene) to obtain pBlueChi. The DNA containing ChBD was further recovered from pBlue-Chi by HindIII-XhoI digestion and spliced to pET-20bI (Wang et al., 2004) to obtain pET-Chi. Subsequently, the gene encoding d-hydantoinase from Agrobacterium radiobacter NRRL B11291 was amplified from pHDT200 (Chao et al., 2000) by PCR using primers, AGAATTCCATATGGATATCATCATCAAG and TTCGGAAGCTTTTG-CTTGTATTTGCG. Finally, the PCR DNA was trimmed with NdeI and HindIII and ligated to corresponding sites of pET-Chi and pET-20bI. As a result, it gave pChHDT and pHDT, respectively. Similar to pChHDT, pHDT contains the d-hydantoinase gene but without fusion to ChBD.

J.-T. Chern, Y.-P. Chao / Journal of Biotechnology 117 (2005) 267–275

2.3. Enzyme production and immobilization The E. coli strain carrying pChHDT was constructed by transformation of the plasmid into the calciuminduced competence of BL21 (DE3) (Novagen, WI, USA) to confer ampicillin resistance. The resulting cells, designed BL21/pChHDT, were cultured in shake flasks containing Luria–Bertani medium (Miller, 1972) at 25 ◦ C. When the cell density reached 0.18 mg of drycell weight per millilitre, 100 ␮M IPTG was added to trigger the production of the ChHDT-fused dhydantoinase. Eight hours later, the induced cells were harvested by centrifugation and resuspended in 5-ml adsorption buffer consisting of 500 mM NaCl, 1 mM EDTA, and 20 mM Tris (pH 8.0). Consequently, CFX was prepared by disrupting cells with a French press and followed by spinning down to collect the supernatant. The protein concentration in CFX was then adjusted to reach 10–15 mg/ml by the same buffer. By use of Bio-Rad dye reagent (Bradford assay), the protein content was determined with bovine serum albumin as the protein standard. Chitin beads (1 ml) were first spun down and washed with 20-fold volume of adsorption buffer. Another centrifugation was applied to harvest chitin beads which were then soaked in 1-ml adsorption buffer. Subsequently, the addition of 10-ml CFX into chitin beads allowed the adsorption reaction to proceed at 4 ◦ C. The incubation time lasted for 6 h during which occasional stirring was administrated. Finally, chitin beads thus treated were gathered by centrifugation and rinsed by 20-fold volume of the same buffer. The washing step was repeated three times and the recovered chitin beads were stored in 2-ml adsorption solution at 4 ◦ C. 2.4. Production of N-carbamoyl-d-hydroxyphenyl glycine (CpHPG) by immobilized d-hydantoinase dl-HPH could be readily converted to CpHPG with the aid of d-hydantoinase. To initiate this bioconversion reaction, the immobilized d-hydantoinase was added into the 10-ml reaction solution to reach 150-U activity, and the reaction was proceeded at 40 ◦ C and 200 rpm for 30 min. The reaction solution consisted of 100 mM dl-HPH, 0.5 mM MnCl2 , and 0.5 M Tris buffer (pH 8.0). Upon the end of the reaction, the immobilized enzyme was collected by centrifugation, and the supernatant was removed for further analysis. Subsequently,

269

the recovered enzymes were administrated in another run of the reaction. The cycle was then repeated. 2.5. Analytical methods The concentrations of dl-HPH and CpHPG were analyzed by means of high pressure liquid chromatography (HPLC) according to the previous study (Chao et al., 1999). To analyze the protein distribution profile, dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed based on the method reported previously (Chao et al., 2000). In addition, the determination of d-hydantoinase activity essentially followed the past report with slight modification (Chao et al., 1999). Unless stated otherwise, 10 ␮l of the immobilized enzyme was added to the 1-ml reaction solution containing 30 mM dl-HPH, 0.5 mM MnCl2 , and 0.1 M sodium phosphate buffer (pH 7.5). The reaction was undergone at 37 ◦ C for 20 min and quenched by heating at 85 ◦ C for 10 min. Subsequent determination of CpHPG concentrations was carried out by HPLC. The unit (U) of enzyme activity was defined as ␮mole of CpHPG produced per min.

3. Results 3.1. Construction and expression of d-hydantoinase-ChBD gene fusion in E. coli The main function of ChBD was reported to be responsible for the specific binding of chitinase A1 to chitin. This in turn would assist the hydrolysis of chitin by chitinase A1 (Watanabe et al., 1994). Therefore, provided that the enzymes of interest are tagged with ChBD it seems plausible to confine the ChBDfused proteins on chitin. To test the feasibility of this approach, plasmid pChHDT containing the fusion of ChBD to the C-terminus of the d-hydantoinase gene was then constructed. A short peptide consisting of KL-G-L-T-G-L-N-S-G-L-T-T as a linker separating the d-hydantoinase gene and ChBD was included in the gene construct to reduce the possible interference of peptide folding with each other. As described in Section 2, shake-flask cultures of the pChHDT-bearing cells were carried out to produce the d-hydantoinase-ChBD fusion protein in response to IPTG induction. In a similar fashion, the free form of d-hydantoinase was ob-

270

J.-T. Chern, Y.-P. Chao / Journal of Biotechnology 117 (2005) 267–275

Fig. 1. Expression of the ChBD-fused d-hydantoinase in E. coli. As described in Section 2, IPTG was added to initiate the production of d-hydantoinase- ChBD fusion protein in strain BL21/pChHDT. Subsequently, CFX was obtained for further analyses by SDS-PAGE. In a similar manner, protein samples from the same host cell but bearing plasmid pHDT were prepared. Like pChHDT, pHDT contains the d-hydantoinase gene but without the ChBD tag. Key: lane 1, protein marker; lane 2, CFX from uninduced BL21/pChHDT; lane 3, CFX from induced BL21/pChHDT; lane 4, CFX from induced BL21/pHDT. The positions of the ChBD-fused d-hydantoinase (Hyd-ChBD) and d-hydantoinase (Hyd) were indicated by the arrows.

Fig. 2. Affinity adsorption of the d-hydantoinase-ChBD fusion protein on chitin beads. According to Section 2, the adsorption of CFX from IPTG-induced BL21/pChHDT on chitin beads was carried out. Upon the completion of adsorption, a centrifugation was administrated to retrieve chitin beads and followed by washing chitin beads with the buffer solution. The supernatant after centrifugation and the washing solution were saved for SDS-PAGE analysis. To release the bound proteins from chitin, chitin beads kept in 2% SDS solution were heated in boiled water for 10 min. Key: lane 1, protein marker; lane 2, CFX before adsorption; lane 3, CFX after adsorption; lane 4, washing buffer; lane 5, 3 ␮l of boiled chitin beads. The position of the target protein was indicated by the arrow.

tained from the cell harboring pHDT. The cytoplasmic proteins from CFX were prepared and subject to SDSPAGE analyses. As a consequence, it revealed a comparable production of soluble hybrid proteins relative to its native counterpart (Fig. 1).

2000), this result suggests the high binding specificity of ChBD to chitin.

3.2. Immobilization of d-hydantoinase-ChBD on chitin beads

To further characterize the immobilized dhydantoinase, the dependence of enzymatic activity on different pHs and temperatures were investigated. The pH range was restricted to 6–10 for this study because of limited solubility of the substrate at pH less than 6. As indicated in Fig. 3a, the maximal activity of the immobilized enzyme was obtained at pH 8.0, and less than 50% of the maximum remained as pH fell outside the range of 7–10. For parallel comparison, the response of the free enzyme to pHs was also examined and gave a similar trend to that exhibited by the immobilized counterpart. Moreover, the temperature for obtaining the maximal activity of the immobilized dhydantoinase and its free counterpart was found at 55 and 45 ◦ C, respectively (Fig. 3b). Overall, these results clearly indicate that d-hydantoinase after immobilization could still retain its biological activity. As shown above, the lower dependence of the immobilized d-hydantoinase on temperatures might reveal its marked resistance to heat. Therefore, it is

An attempt to immobilize the hybrid protein was made by mixing chitin beads with CFX prepared from the IPTG-induced BL21/pChHDT strain according to Section 2. Upon completing the adsorption procedure, chitin beads were recovered by centrifugation and the supernatant was analyzed by SDS-PAGE. As depicted in Fig. 2, it showed that little of the ChBD-fused dhydantoinase was left in CFX, indicating the strong association of the target protein with chitin beads. This argument is supported by subsequent washing of chitin beads with the buffer solution to remove unrestrained proteins, which gave no trace of the fusion protein found in the wash solution. Furthermore, proteins bound on chitin beads were desorbed by boiling. As revealed from SDS-PAGE, over 95% of liberated proteins were identified as the hybrid protein. In a good agreement with the previous report (Hashimoto et al.,

3.3. Effect of pH and temperatures on immobilized d-hydantoinase

J.-T. Chern, Y.-P. Chao / Journal of Biotechnology 117 (2005) 267–275

271

Fig. 3. Effects of pH and temperature on the immobilized d-hydantoinase. Refer to the method in Section 2 for assaying enzyme activities. For comparison, the free enzyme (0.8 mg) obtained by the previous method (Huang et al., 2003) was assayed for its responsive changes in activity at similar conditions. (a) To examine the response of d-hydantoinase to pH, the free (䊉) and immobilized () form were kept at the indicated pH and 37 ◦ C. (b) The investigation of the temperature effect on the free (䊉) and immobilized () d-hydantoinase was carried out by subjecting the enzyme to various temperatures but maintaining pH at 7.5. The relative activity was defined as the respective enzyme activity relative to the maximum. (c) The thermal stability of the free (
, ) and immobilized (䊉) d-hydantoinase were characterized by continuously incubating the enzyme at 45 ◦ C. In this case, d-hydantoinase with () or without (
) fusion to ChBD was used as free form of enzymes. Enzyme samples were withdrawn to determine the remaining activity at time intervals. Residual enzyme activity was calculated by dividing the obtainable activity along the time course with the initial enzyme activity.

272

J.-T. Chern, Y.-P. Chao / Journal of Biotechnology 117 (2005) 267–275

intriguing to see how d-hydantoinase bound on chitin copes with heat. As illustrated in Fig. 3c, constantly incubated at 45 ◦ C, immobilized enzymes were found to remain substantially stable and its half life could reach 270 h. Unlike its immobilized counterpart, the free form of d-hydantoinase (irrespective of having ChBD fusion) became more labile to heat and a half life of 50–80 h was obtained. This result clearly indicates that d-hydantoinase thus immobilized displays a higher thermal stability. 3.4. Production of CpHPG by immobilized d-hydantoinase As reported recently, metal ions play an important role on the mammalian imidase (Huang and Yang, 2002). Accordingly, it becomes imperative to investigate the effect of metal ions on d-hydantoinase, and the result showed that the activity of the immobilized enzyme could be greatly enhanced with the aid of Co2+ and Mn2+ (Fig. 4a). Here, Mn2+ was used throughout the study. To determine the most favorable dosage, the immobilized enzyme was examined for its activ-

ity in the presence of various amounts of Mn2+ . As a consequence, the concentration of Mn2+ equilibrant to 0.5 mM was found to be sufficient for obtaining the saturated activity (Fig. 4b). The impressive stability of the immobilized dhydantoinase prompts us to explore it as the biocatalyst. The reusability of immobilized enzymes in the bioconversion process was then investigated. As elucidated in Fig. 5, the immobilized enzyme could be reused for 10 cycles to achieve a complete conversion of dl-HPH to CpHPG. After that, the conversion yield gradually declined and still reached 90% after 15-time recycling of the enzyme, while it dropped to 50% at the 30th repeated run. Furthermore, the stability of the ChBD-linked enzyme on chitin was studied by examining the remaining activity of the immobilized d-hydantoinase after a long-term storage. As shown in Fig. 6, the immobilized enzyme remained fully stable for 30 days and still retained 50% of the initial activity after preserving for 65 days. Subsequent analyses of SDS-PAGE showed an undetectable amount of the fusion protein released into the storage solution (data not shown).

Fig. 4. The effect of metal ions on immobilized d-hydantoinase. The enzyme activity was determined according to the method described in Section 2. (a) The immobilized enzyme-mediated reaction was carried out in the presence of various ions with the final concentration of 1 mM. (b) Similarly, the enzymatic reaction was performed by varying Mn2+ concentration in the solution. The relative activity was defined as the respective enzyme activity relative to that without the metal ion. Key: nil, without metal ions.

J.-T. Chern, Y.-P. Chao / Journal of Biotechnology 117 (2005) 267–275

Fig. 5. Repeated use of the immobilized d-hydantoinase for CpHPG production. Refer to Section 2 for the reaction condition. Upon the end of the reaction, the immobilized d-hydantoinase was recovered by centrifugation and followed by rinsing with the adsorption buffer. The new run of the production process was initiated by subsequent addition of the immobilized d-hydantoinase of recovery to a fresh reaction solution. The cycle was repeated as indicated. The conversion yield was defined as the amount (mM) of CpHPG obtained relative to that of dl-HPH.

4. Discussion It has been well recognized that, in addition to enzyme reuse, the approach by immobilizing enzymes offers several advantages including the easy separation of enzymes from the reaction products, the elevation of enzyme concentrations per unit volume, and perhaps the enhancement of enzyme stability and activity. In this work, the utilization of ChBD as an affinity tag to retain d-hydantoinase on chitin was newly explored. In spite of its illusive function in cell physiology, d-hydantoinase from A. radiobacter mediates a reaction leading to the production of CpHPG, an intermediate which could be further converted to d-phydroxyphenylglycine (d-HPG) (Olivieri et al., 1979). d-HPG is of great commercial value for its potential use as the precursor of semi-synthetic antibiotics. Therefore, the achievement of d-hydantoinase immobilization presents an important and fundamental step in this bioconversion process. An initial attempt was made to

273

Fig. 6. Effect of the storage time on the stability of the immobilized d-hydantoinase. A large batch of the immobilized enzyme was prepared and kept in the adsorption buffer at 4 ◦ C. At each storage day as indicated in the figure, equal aliquots (10 ␮l) were withdrawn and determined for the enzyme activity.

attach ChBD to the C-terminus of d-hydantoinase, and the production of this hybrid protein was achieved in E. coli. As a result, it produced the d-hydantoinase-ChBD fusion protein in a soluble form and the yield approximately reached 8% of total cell protein content (Fig. 1). A recent study reported the fusion of maltose binding protein (MBP) to the N-terminus of d-hydantoinase from Bacillus stearothermophilus SD1 (Kim et al., 2001). With this approach, they were able to attain a high production of the fusion protein in a soluble fraction. However, a similar approach by the C-terminal fusion of MBP to A. radiobacter d-hydantoinase showed a conflicting result that most of the MBP-fused protein aggregated (data not shown). As revealed by the crystal structure, the C-terminus of d-hydantoinase functions as tetramer structural core (Cheon et al., 2002) and the attachment of affinity tags to this domain might be unfavorable. Nevertheless, the C-terminal fusion of the ChBD tag to d-hydantoinase still displayed its active function as demonstrated here. Isolated ChBD was found to assume a tightly packed structure which leads to its notable stability (Hashimoto et al., 2000). ChBD binds very specifically to insoluble chitin via a hydrophobic interaction, and bound ChBD

274

J.-T. Chern, Y.-P. Chao / Journal of Biotechnology 117 (2005) 267–275

could be liberated by controlling pH (Hashimoto et al., 2000). These remarkable features of ChBD have made it attractive for versatile applications. The first example by exploiting ChBD as an affinity tag was reported to assist on-column purification of proteins in conjunction with a protein splicing element known as intein (Chong et al., 1997). Alternatively, our emphasis was placed on the application of ChBD for enzyme immobilization. As illustrated in Fig. 2, d-hydantoinase tagged with ChBD was targeting to chitin, and it required at least 3 h to reach the saturated level of adsorbed proteins at pH 8 and 4 ◦ C. However, the time needed for sufficient binding strongly depended on pH and generally was shorter when the operational pH approached to 9. Given the various ratios of CFX to chitin beads and sufficient adsorption time, the maximal load could reach approximately 5 ␮g of protein adsorbed per ␮l of chitin beads at pH 7–9. To demonstrate the usefulness of the ChBDdirected immobilization of d-hydantoinase, the enzyme exposed to physical changes was examined and, in particular, shown to exhibit higher tolerance to heat. In contrast, the free enzyme became more susceptible to the temperature upon exceeding the optimum (Fig. 3b). As deduced by the enzyme activity, the immobilized enzyme staying at 45 ◦ C maintained 90% stability for 180 h, and it lost 60% of the initial activity after 280-h incubation (Fig. 3c). However, no enzymes released from chitin beads were detected during the experimental period as judged by SDS-PAGE analyses. This result indicates the thermal integrity of ChBD. Subsequent application of the immobilized d-hydantoinase for CpHPG production from dl-HPH (100 mM) illustrated good reusability of the immobilized enzyme for 15 cycles to achieve over 90% of conversion yield (Fig. 5). In particular, d-hydantoinase thus fixed was maintained substantially stable for 30 days during storage (Fig. 6). Previously, a study reported the use of Bacillus d-hydantoinase adsorbed on DEAE-cellulose for the conversion reaction to CpHPG (Lee et al., 1996). The result showed that with the use of 50-mM dl-HPH a constant production rate achieved by the immobilized enzyme was maintained over nine successive runs. However, the conversion yield was not reported. A similar approach by the immobilization of d-hydantoinase from lentil seeds on DEAE-cellulose was found effective to stabilize the protein (Rai and Taneja, 1998). The conversion yield reached 70–85%

after three repetitive uses of the immobilized enzyme for the production of d-amino acids. Moreover, the immobilization of d-hydantoinase from Vigna angularis was recently achieved via covalent linkage to aminopropyl glass beads (Arcuri et al., 2004). It reported the achievement of a conversion yield of 98% with eight repeated uses of the immobilized enzyme, and the concentration of substrate used was 12.5 mM. In conclusion, the use of ChBD for directing the retention of d-hydantoinase on chitin was successfully developed. As illustrated in this study, this approach is marked with high stability as well as facile operation and provides a promising way for enzyme immobilization. Acknowledgements This work was co-supported by National Science Council of Taiwan and Widetex Chemical Co. with the grant NSC92-2622-E-035-017-CC3.

References Arcuri, M.B., Antunes, A.C., Machado, S.P., Almeida, C.H.F., Oestreicher, E.G., 2004. Stability of immobilized d-hydantoinase from Vigna angularis and repeated cycles of highly enantioenriched production of N-carbamoyl-d-phenyl glycine. Amino Acids 27, 69–74. Chao, Y.P., Chiang, C.J., Lo, T.E., Fu, H., 2000. Overproduction of dhydantoinase and carbamoylase in a soluble form in Escherichia coli. Appl. Microbiol. Biotechnol. 54, 348–353. Chao, Y.P., Fu, H., Lo, T.E., Chen, P.T., Wang, J.J., 1999. Onestep production of d-p-hydroxyphenlyglycine by recombinant Escherichia coli strains. Biotechnol. Prog. 15, 1039–1045. Chao, Y.P., Fu, H., Wang, Y.L., Huang, W.B., Wang, J.Y., 2003. Molecular cloning of the carboxylesterase gene and biochemical characterization of the encoded protein from Pseudomonas citronellolis ATCC 13674. Res. Microbiol. 154, 521–526. Cheon, Y.H., Kim, H.S., Han, K.H., Abendroth, J., Niefind, K., Schomburg, D., Wang, J., Kim, Y., 2002. Crystal structure of d-hydantoinase from Bacillus stearothermophilus: insight into the stereochemistry of enantioselectivity. Biochemistry 41, 9410–9417. Chong, S., Mersha, F.B., Comb, D.G., Scott, M.E., Landry, D., Vence, L.M., Perler, F.B., Benner, J., Kucera, R.B., Hirvonen, C.A., Pelletier, J.J., Paulus, H., Xu, M.Q., 1997. Single-column purification of free recombinant proteins using a self-cleavable affinity tag derived from a protein splicing element. Gene 192, 271– 281. Hashimoto, M., Ikegami, T., Seino, S., Ohuchi, N., Fukada, H., Sugiyama, J., Shirakawa, M., Watanabe, T., 2000. Expression

J.-T. Chern, Y.-P. Chao / Journal of Biotechnology 117 (2005) 267–275 and characterization of the chitin-binding domain of chitinase A1 from Bacillus circulans WL-12. J. Bacteriol. 182, 3045– 3054. Huang, C.Y., Chao, Y.P., Yang, Y.S., 2003. Purification of industrial hydantoinase in a chromatographic step without affinity tag. Protein Expr. Purif. 30, 134–139. Huang, C.Y., Yang, Y.S., 2002. The role of metal on imidie hyrolysis: metal content an pH profiles of metal ion replaced mammalian imidase. Biochem. Biophys. Res. Commun. 297, 1027– 1032. Kim, G.J., Lee, D.E., Kim, H.S., 2001. High-level expression and one-step purification of cyclic amidohydrolase family enzymes. Protein Exp. Purif. 23, 128–133. Lee, D.C., Lee, S.G., Kim, H.S., 1996. Production of d-phydroxylphenylglycine from d,l-hydroxylphenyl hydantoin using immobilized thermostable d-hydantoinase from Bacillus stearothermophilus SD-1. Enzyme Microb. Technol. 18, 35–40. Miller, J.H., 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Olivieri, R., Fascetti, E., Angellini, L., Degen, L., 1979. Enzymatic conversion of N-carbamoyl-d-amino acids to d-amino acids. Enzyme Microb. Technol. 1, 201–204.

275

Rai, R., Taneja, V., 1998. Production of d-amino acids using immobilized d-hydantoinase from lentil, Lens esculenta, seeds. Appl. Microbiol. Biotechnol. 50, 658–662. Salemuddin, M., 1999. Bioaffinity based immobilization of enzymes. In: Fiechter, A. (Ed.), Advances in Biochemical Engineering/Biotechnology, vol. 64. Springer-Verlag, Berlin, pp. 203–226. Shpigel, E., Goldlust, A., Efroni, G., Avraham, A., Eshel, A., Dekel, M., 1999. Immobilization of recombinant heparinase I fused to cellulose-binding domain. Biotechnol. Bioeng. 65, 17–23. Terpe, K., 2003. Overview of tag protein fusions: from molecular and biochemical fundamentals to commercial systems. Appl. Microbiol. Biotechnol. 60, 523–533. Wang, Z.W., Law, W.S., Chao, Y.P., 2004. Improvement of the thermoregulated T7 expression system by using the heat-sensitive lacI. Biotechnol. Prog. 20, 1352–1358. Watanabe, T., Ito, Y., Yamada, T., Hashimoto, M., Skine, S., Tanaka, H., 1994. The role of the C-terminal domain and type III domains of chitinase A1 from Bacillus circulans WL-12 in chitin degradation. J. Bacteriol. 176, 4465–4472. Wen, C.M., Tseng, C.S., Cheng, C.Y., Li, Y.K., 2002. Purification, characterization and cloning of a chitinase from Bacillus sp. NCTU2. Biotechnol. Appl. Biochem. 35, 213–219.