Name: ____________________________________________________ Period: ____________

.Part D – The Simulation

.

The purpose of this part of the webquest is to simulate DNA fingerprinting and determine which of your classmates threw the gum. For the purposes of this simulation we shall consider the restriction enzyme Alu I which makes a blunt cut between the G and C in the DNA sequence shown below.

AG CT TC GA For example given the following DNA sequence, the Alu I enzyme would make two cuts resulting in three pieces with sizes of 2, 9 and 5 base-pairs each.

AG CTCGGTCAG CTACA TC GAGCCAGTC GATGT 2

9

5

On the following page are 'DNA' samples from four sources, the three students and the gum. Scan each piece of DNA for the Alu I restriction site. After locating any/ all of the possible locations that this particular restriction enzyme will cut each sample, make note of the total of number of fragments produced from each the sample. Additionally, for each digest, make note of the length of the individual fragments for each DNA sample.

Use the data obtained from the digestion (cutting) of the four DNA samples with the restriction endonuclease Alu I to make check marks indicating the positions of the bands on the gel after applying the electric current to the setup.

Construct a brief summary of the results addressing the following:   

Who threw the gum? What evidence leads to that conclusion? Why did Dr. N hand out envelopes?

DNA Sequences

Gum

AGCACCAGCTTCGTAAAGCTGGCCAGCT TCGTGGTCGAAGCATTTCGACCGGTCGA

Student 1

TTCGATAGCTCGAGCTGGAGCTAGCTGG AAGCTATCGAGCTCGACCTCGATCGACC

Student 2

AGCTTAGCAGCTGGGTAAAGCTGGCCTA TCGAATCGTCGAC CCATTTCGACCGGAT

Student 3

AGCACCAAGCTCGTAAAGCTGGCCCAGC TCGTGGTTCGAGCATTTCGACCGGGTCG

Name: _____________________________________________________ Period: ____________

.

Electrophoresis Data

.

Place a check in the box to represent that there is a fragment of DNA of a particular length (based on the scale) for that lane. If a lane has more than one fragment of the same number of base pairs, only enter a single check for that size.

Electrophoresis Data # OF BASE PAIRS

Gum

Student 1

Student 2

Student 3

Negative End

10

9

8

7

6

5

4

3

2

1 Positive End

Conclusions:

Part D Simulation.pdf

Retrying... Download. Connect more apps... Try one of the apps below to open or edit this item. Part D Simulation.pdf. Part D Simulation.pdf. Open. Extract.
Missing:

538KB Sizes 0 Downloads 154 Views

Recommend Documents

MEDICARE PART D: PROTECTING AMERICA'S SENIORS AND ...
The program relies on market-based competition led by private health insurers that negotiate discounts and ... 2.0%. 4.0%. 6.0%. 8.0%. 10.0%. Source: Centers for Medicare and Medicaid Services (CMS); Morning Consult; CMS; Congressional Budget Office

MEDICARE PART D: PROTECTING AMERICA'S SENIORS AND ...
MYTH: Allowing the federal government to directly negotiate prices with drugmakers in the Medicare. Part D program will lower costs for seniors and taxpayers.

2016 Medicare Part D Notice.pdf
prescription drug coverage in your area. ... If you go 63 continuous days or longer without creditable prescription drug ... 2016 Medicare Part D Notice.pdf.

BMW 801C and D engine Part 2.pdf
Page 1. Whoops! There was a problem loading more pages. Retrying... BMW 801C and D engine Part 2.pdf. BMW 801C and D engine Part 2.pdf. Open. Extract.

World War 2, Part 3 D-Day D-Day End of the War in Europe
Germans lost 100,000. Germany lost because they ran out of !!!!!!!!!! * May 7, 1945: Germany surrendered. Known as. (Victory in Europe). * Hitler commits. (took a cyanide pill and then shot himself). War in the Pacific. * After Pearl Harbor, the. beg

man-34\medicare-part-d-deductibles.pdf
man-34\medicare-part-d-deductibles.pdf. man-34\medicare-part-d-deductibles.pdf. Open. Extract. Open with. Sign In. Main menu.

BMW 801C and D engine Part 3.pdf
There was a problem previewing this document. Retrying... Download. Connect more apps... Try one of the apps below to open or edit this item. BMW 801C and D engine Part 3.pdf. BMW 801C and D engine Part 3.pdf. Open. Extract. Open with. Sign In. Main

BMW 801C and D engine Part 3.pdf
Page 3 of 32. Page 3 of 32. BMW 801C and D engine Part 3.pdf. BMW 801C and D engine Part 3.pdf. Open. Extract. Open with. Sign In. Main menu. Displaying BMW 801C and D engine Part 3.pdf. Page 1 of 32.

Buchmueller Carey opioids Part D 20160426.pdf
well-meaning medical professionals were being diverted to street sale for non-medical use (Dart et al., 2015). In October 2015, President Obama and health ...

World War 2, Part 3 D-Day D-Day End of the War in Europe
(took a cyanide pill and then shot himself). War in the Pacific. * After Pearl Harbor, the. began. all of the. in the Pacific, including Guam, Wake Island, Hong Kong ...

LiS/D lVLS/D iVZS/D
Dec 20, 2007 - (Under 37 CFR 147). “Multiplexer” http://en.wikipedia.org/wiki/Multiplexer, ... G09G 5/36. (2006.01) more video overlay engines read graphics ...

d
... ​road,​ ​Kolhapur​ ​​ ​​ ​​ ​​ ​​ ​​ ​​ ​​ ​​ ​​ ​​ ​Contact​ .... ​be​​less​​than​​d/8​​from​​centre​​so​​as​​to​​avoid​​tensile.

D&D Supplement.pdf
Page 1 of 1. Lot # IMF REA Rib Fat. Rump. Fat. Back. Fat. Yearling. Weight. Scrotal. Measurement. Frame. Score. Angus Bulls. A71 3.55 14.5 0.34 0.33 1134 36 4.7. A72 4.66 14.7 0.15 0.09 1118 34 4.8. A74 5.55 13.4 0.4 0.25 1194 40 4.9. A75 3.63 13.3 0

" D D K ¡ K ¡ " D D K
S. ¡ dy lips and. Your. ¡ ¡ ¡ ¡ ¡ /nobr> bub - ble gum tongue. ¡. /nobr>. " D. D. 面. ¡ /nobr>. Cause if you want. K. ¡ love. We'll make. " D. D. K. ¡ it. Swim - ming a ...

D&D 4.0 - Demonomicon.pdf
V1S1T OUR WEBS1TE AT WWW.UUNGEONSANUURAGONS.COM. Page 3 of 161. D&D 4.0 - Demonomicon.pdf. D&D 4.0 - Demonomicon.pdf. Open. Extract.

Dept. Test- Code-D, Account Test - Higher Part-I and Paper-II ...
office expenses ... (A) Director of Treasuries (B) Currency Officer, RBI ... The report of the Comptroller and Auditor-General of India relating to the accounts of a State ... Higher Part-I and ... umes I and II and Kerala Budget Manual With Books.pd

D&D 4.0 - Vor Rukoth.pdf
Page 2 of 2. D&D 4.0 - Vor Rukoth.pdf. D&D 4.0 - Vor Rukoth.pdf. Open. Extract. Open with. Sign In. Main menu. Displaying D&D 4.0 - Vor Rukoth.pdf.

D&D 4.0 - Demonomicon.pdf
Peter Schaefer, Stephen Schubert. Additional ... Swekel, Matias Tapia, Franz Vohwinkel, Anthony S. Waters, Eva ..... D&D 4.0 - Demonomicon.pdf. D&D 4.0 ...

D&D 5e Monster Manual.pdf
Page 3 of 354. D&D 5e Monster Manual.pdf. D&D 5e Monster Manual.pdf. Open. Extract. Open with. Sign In. Main menu. Displaying D&D 5e Monster Manual.pdf ...

D&D 4.0 - Rules Compendium.pdf
Page 1 of 322. Page 1 of 322. Page 2 of 322. Page 2 of 322. Page 3 of 322. Page 3 of 322. D&D 4.0 - Rules Compendium.pdf. D&D 4.0 - Rules Compendium.pdf.