Topology in Biology Ralph Heiner Buchholz April 1985 - SMJ 29 The sequence of letters in Figure 1 represents the sequence of bases (which are the opposite of acids) in the DNA of a bacteriophage (a virus which only attacks bacteria) called φX174. It is the first complete genome (chromosomal or genetic information) ever decoded for any organism. Each letter stands for one of four cyclic (meaning circular) bases - adenine, guanine, thymine and cytosine (see Figure 2). There are nine known genes (eight of which are marked in Figure 1) in φX174 - the single underline lettering represents genes A, D, J, F, G and H. Interestingly, genes B and E (doubly underlined) lie entirely inside genes A and D respectively. The bases are not directly connected to each other as they are written, rather they lie in a mesh connected by sugar, “D”, and phosphate, “P”, molecules (see Figure 3). The bases are always chemically paired cytosine with guanine and thymine with adenine. Next the sugar molecules are attached either side of the so-called “base-pairs”. This forms the “rungs” of a “ladder” structure which is held together by phosphate molecules (see Figure 4). This means that one only needs to specify one side of the base pair sequence as the complementary side can be determined from the pairing rules above. If, for example, one side of the base pair sequence begins cgttaca .... then the other side of the strand must be gcaatgt .... The DNA “ladder” is actually twisted in three dimensions around the lengthwise axis to form the well known “double stranded helix”. There are ten base pairs for one complete 360◦ twist of the ladder and the distance covered is only 3.46 nanometers (where 1 nanometer = 10−9 meters). For almost all living creatures (including humans) the genetic material has the form described above - but due to the simplicity of viruses they usually only contain “single stranded” rather than double stranded DNA. However during one phase of reproduction the DNA of φX174 is actually double stranded and furthermore the DNA helix for this and most other viruses is circular i.e. the two ends of the ladder actually meet and are chemically joined.

1

ccgtcaggattgacaccctcccaattgtatgttttcatgcctccaaatcttggaggcttttttatggttcgttcttattacccttctgaatgtcacgctg attattttgactttgagcgtatcgaggctcttaaacctgctattgaggcttgtggcatttctactctttctcaatccccaatgcttggcttccataagca gatggataaccgcatcaagctcttggaagagattctgtcttttcgtatgcagcccgttgagttcgataatggtgatatgtatgttgacggccataaggct gcttctgacgttcgtgatgagtttgtatctgttactgagaagttaatggatgaattggcacaatgctacaatgtgctcccccaacttgatattaataaca ctatagaccaccgccccgaaggggacgaaaaatggtttttagagaacgagaagacggttacgcagttttgccgcaagctggctgctgaacgccctcttaa ggatattcgcgatgagtataataaccccaaaaagaaaggtattaaggatgagtgttcaagattgctggaggcctccactaagatatcgcgtagaggcttt gctattcagcgtttgatgaatgcaatgcgacaggctcatgctgatggttggtttatcgtttttgacactctcacgttggctgacgaccgattagaggcgt tttatgataatcccaatgctttgcgtgactattttcgtgatattggtcgtatggttcttgctgccgagggtcgcaaggctaatgattcacacgccgactc ctatcagtatttttgtgtgcctgagtatggtacagctaatggccgtcttcatttccatgcggtgcactttatgcggacacttcctacaggtagcgttgac cctaattttggtcgtcggatacgcaatcgccgccagttaaatagcttgcaaaatacgtggccttatggttacagtatgcccatcccagttcgctacacgc aggacgctttttcaccttctggttggttgtggcctgttgatgctaaaggtgagccgcttaaagctaccagttatatggctgttggtttctatgtgcctaa atacgttaacaaaaagtcagatatggaccttgctgctaaaggtctaggagctaaagaatggaacaactcactaaaaaccaagctgtcgctacttcccaag aagctgttcagaatcagaatgagccgcaacttcgggatgaaaatgctcacaatgacaaatctgtccacggagtgcttaatccaacttaccaagctgggtt acgacgcgacgccgttcaaccagatattgaagcagaacgcaaaaagagagatgagattgaggctgggaaaagttactgtagccgacgttttggcggcgca acctgtgacgacaaatctgctcaaatttatgcgcgcttcgataaaaatgattggcgtatccaacctgcagagttttatcgcttccatgacgcagaagtta acactttcggatatttctgatgagtcgaaaaattatcttgataaagcaggaattactactgcttgtttacgaattaaatcgaagtggactgctggcggaa aatgagaaaattcgacctatccttgcgcagctcgagaagctcttactttgcgacctttcgccatcaactaacgattctgtcaaaaactgacgcgttggat gaggagaagtggcttaatatgcttggcacgttcgtcaaggactggtttagatatgagtcacattttgttcatggtagagattctcttgttgacattttaa aagagcgtggattactatctgagtccgatgctgttcaaccactaataggtaagaaatcatgagtcaagttaccgaacaatccgtacgtttccagaccgct ttggcctctattaagctcattcagggttctgccgttttggatttaaccgaagatgatttcgattttctgacgagtaacaaagtttggattgctactgacc gctctcgtgctcgtcgctgcgttgaggcttgcgtttatggtacgctggactttgtaggataccctcgctttcctgctcctgttgagtttattgctgccgt cattgcttattatgttcatcccgtcaacattcaaacggcctgtctcatcatggaaggcgctgaatttacggaaaacattattaatggcgtcgagcgtccg gttaaagccgctgaattgttcgcgtttaccttgcgtgtacgcgcaggaaacactgacgttcttactgacgcagaagaaaacgtgcgtcaaaaattacgtg cggaaggagtgatgtaatgtctaaaggtaaaaaacgttctggcgctcgccctggtcgtccgcagccgttgcgaggtactaaaggcaagcgtaaaggcgct cgtctttggtatgtaggtggtcaacaattttaattgcaggggcttcggccccttacttgaggataaattatgtctaatattcaaactggcgccgagcgta tgccgcatgacctttcccatcttggcttccttgctggtcagattggtcgtcttattaccatttcaactactccggttatcgctggcgactccttcgagat ggacgccgttggcgctctccgtctttctccattgcgtcgtggccttgctattgactctactgtagacatttttactttttatgtccctcatcgtcacgtt tatggtgaacagtggattaagttcatgaaggatggtgttaatgccactcctctcccgactgttaacactactggttatattgaccatgccgcttttcttg gcacgattaaccctgataccaataaaatccctaagcatttgtttcagggttatttgaatatctataacaactattttaaagcgccgtggatgcctgaccg taccgaggctaaccctaatgagcttaatcaagatgatgctcgttatggtttccgttgctgccatctcaaaaacatttggactgctccgcttcctcctgag actgagctttctcgccaaatgacgacttctaccacatctattgacattatgggtctgcaagctgcttatgctaatttgcatactgaccaagaacgtgatt acttcatgcagcgttaccatgatgttatttcttcatttggaggtaaaacctcatatgacgctgacaaccgtcctttacttgtcatgcgctctaatctctg ggcatctggctatgatgttgatggaactgaccaaacgtcgttaggccagttttctggtcgtgttcaacagacctataaacattctgtgccgcgtttcttt gttcctgagcatggcactatgtttactcttgcgcttgttcgttttccgcctactgcgactaaagagattcagtaccttaacgctaaaggtgctttgactt ataccgatattgctggcgaccctgttttgtatggcaacttgccgccgcgtgaaatttctatgaaggatgttttccgttctggtgattcgtctaagaagtt taagattgctgagggtcagtggtatcgttatgcgccttcgtatgtttctcctgcttatcaccttcttgaaggcttcccattcattcaggaaccgccttct ggtgatttgcaagaacgcgtacttattcgcaaccatgattatgaccagtgtttcagtcgttcagttgttgcagtggatagtcttacctcatgtgacgttt atcgcaatctgccgaccactcgcgattcaatcatgacttcgtgataaaagattgagtgtgaggttataaccgaagcggtaaaaattttaatttttgccgc tgaggggttgaccaagcgaagcgcggtaggttttctgcttaggagtttaatcatgtttcagacttttatttctcgccacaattcaaactttttttctgat aagctggttctcacttctgttactccagcttcttcggcacctgttttacagacacctaaagctacatcgtcaacgttatattttgatagtttgacggtta atgctggtaatggtggttttcttcattgcattcagatggatacatctgtcaacgccgctaatcaggttgtttcagttggtgctgatattgcttttgatgc cgaccctaaattttttgcctgtttggttcgctttgagtcttcttcggttccgactaccctcccgactgcctatgatgtttatcctttggatggtcgccat gatggtggttattataccgtcaaggactgtgtgactattgacgtccttccccgtacgcccggcaataacgtctacgttggtttcatggtttggtctaact ttaccgctactaaatgccgcggattggtttcgctgaatcaggttattaaagagattatttgtctccagccacttaagtgaggtgatttatgtttggtgct attgctggcggtattgcttctgctcttgctggtggcgccatgtctaaattgtttggaggcggtcaaaaagccgcctccggtggcattcaaggtgatgtgc ttgctaccgataacaatactgtaggcatgggtgatgctggtattaaatctgccattcaaggctctaatgttcctaaccctgatgaggccgcccctagttt tgtttctggtgctatggctaaagctggtaaaggacttcttgaaggtacgttgcaggctggcacttctgccgtttctgataagttgcttgatttggttgga cttggtggcaagtctgccgctgataaaggaaaggatactcgtgattatcttgctgctgcatttcctgagcttaatgcttgggagcgtgctggtgctgatg cttcctctgctggtatggttgacgccggatttgagaatcaaaaagagcttactaaaatgcaactggacaatcagaaagagattgccgagatgcaaaatga gactcaaaaagagattgctgccattcagtcggcgacttcacgccagaatacgaaagaccaggtatatgcacaaaatgagatgcttgcttatcaacagaag gagtctactgctcgcgttgcgtctattatggaaaacaccaatctttccaagcaacagcaggtttccgagattatgcgccaaatgcttactcaagctcaaa cggctggtcagtattttaccaatgaccaaatcaaagaaatgactcgcaaggttagtgctgaggttgacttagttcatcagcaaacgcagaatcagcggta tggctcttctcatattggcgctactgcaaaggatatttctaatgtcgtcactgatgctgcttctggtgtggttgatatttttcatggtattgataaagct gttgccgatacttggaacaatttctggaaagacggtaaagctgatggtattggctctaatttgtctaggaaataa

Figure 1: φX174 base sequence

2



 





     

 



 



  

 

 

   

 "!# $

%'& (  % 

Figure 2: The bases of life

 

 

    

  



"!# $"!#%'&(*)+ -,./





 

 

 



Figure 3: Sugar and phosphate molecules

3





 





 





 

 



  



 





  

 

Figure 4: Ladder and Helix This raises an interesting question. Is the DNA ring of φX174, during reproduction, topologically equivalent to a cylinder or a M¨ obius band? Now the number of letters in Figure 1 is easily found to be 5375 and so the number of base pairs in the reproductive phase DNA of φX174 is 5375. Recalling that the helix has ten base pairs for every 360◦ twist or equivalently five base pairs for every 180◦ twist (or half-turn) we see that there must be 1075 half-turns before the ends of the ladder are joined. If we give a strip of paper an even number (including zero) of half-turns and then glue the ends together the resulting object will be “cylinder-like” i.e. have two sides. However, if we give it an odd number of half-turns and glue the ends it will be “M¨obius-like” i.e. have only one side. So from the above we can say that the DNA ring of reproductive φX174 is in fact M¨ obius-like.

References 1. Principles of Genetics Irwin h. Herskowitz Pub. Macmillan 2. G¨ odel, Escher, Bach : An Eternal Golden Braid Douglas R. Hofstadter Pub. Harvester Press

4

Topology in Biology

Topology in Biology. Ralph Heiner Buchholz ... Each letter stands for one of four cyclic (meaning circular) bases - adenine, guanine, thymine and cytosine (see ...

98KB Sizes 18 Downloads 220 Views

Recommend Documents

Network topology and parameter estimation - BMC Systems Biology
Feb 7, 2014 - using fluorescent data from protein time courses is a key ..... time course predictions. Score Bayesian Decompose network". Selection of data. Sampling. Orangeballs. 0.0229. 3.25E-03. 0.002438361. 1.21E - 25. 27.4 no yes ...... TC EB PM

Network topology and parameter estimation - BMC Systems Biology
Feb 7, 2014 - lution of the system. It is hence necessary to determine the identity and number of perturbations and whether to generate data from individual or combined .... different metrics used for challenge scoring described in Additional file 3:

Topology-induced coarsening in language games
Jan 18, 2006 - sis of the dynamical evolution. Figure 3 reports a typical evolution of agents on a one- dimensional lattice, by displaying one below the other a ...

Femap Topology Optimization.pdf
boundary conditions from the NX Nastran finite element model are taken ... Model setup is very simple using Femap, and existing NX Nastran input data.

Topology Control of Dynamic Networks in the ... - Semantic Scholar
planets outside our own solar system, will rely on FF to achieve ... energy consumption in the network. .... the consumption of fuel and energy is also crucial for.

Topology and correlations in structured scale-free ...
Apr 21, 2003 - natural systems that can be described as networks 1,2. Sys- tems such ... values of active nodes m low average connectivity. In ad- dition ... tible to several details of the construction algorithm. By ..... algebraic manipulations.

Graph topology plays a determinant role in the ...
Oct 4, 2005 - the opponent's decision, which in turns makes cooperators unable to resist invasion by ..... NJ: Princeton University Press. Hammerstein, P. (ed) ...

Topology Organize In Mobile Ad Hoc Networks with ...
Instant conferences between notebook PC users, military applications, emergency ... links and how the links work in wireless networks to form a good network ...

Graph topology plays a determinant role in the ...
Oct 4, 2005 - As a result, in a single round of the PD it is best to defect, regardless of ... single-peak shape for the degree distribution d(k), defined for a graph ...

Topology Control in Unreliable Ad hoc Networks
Topology control is a basic subroutine in many wireless networking problems and is, in general, a multi-criteria optimization problem involving (contradictory) objectives of connectivity, interfer- ence, and power minimization. Wireless devices are o

Interplay between topology and dynamics in the World ...
May 16, 2007 - theoretical models relating network topology to the presence of a 'hidden' variable (or fitness). On the other hand, the topology is .... 3 GDP: definition and empirical properties. The Gross Domestic Product wi of a .... agreement bet

Topology Control in Multi-channel Cognitive Radio Networks with Non ...
achieving efficient power control. Index Terms—Multi-channel Cognitive Radio networks, Dis- tributed Topology Control, Non-uniform node arrangements,.

Topology Control of Dynamic Networks in the ... - Semantic Scholar
enabling technology for future NASA space missions such ... In mobile sensor networks, there ... preserving connectivity of mobile networks [5], [9], [14],. [15], [20] ...

Femap Topology Optimization.pdf
supports the complete optimization workflow including smoothing for results. transfer back to the CAD system. A complete optimization process can be. adopted ...

SPACE-OPEN TOPOLOGY
We continue our study of space-open topology as in [2]. We inves- tigate the behaviour of space-open topology with respect to connect- edness, countability and the separation axioms. As usual we use X, Y for topological spaces and U, V for open subse

Using Topology Optimization
Nov 16, 2016 - Weiyang Lin, James C. Newman III, W. Kyle Anderson. Design of Broadband Acoustic Cloak. Using Topology Optimization. IMECE2016-68135 ...

CORTICAL MAPS AS TOPOLOGY-REPRESENTING NEURAL ...
latter are particularly well suited for the processing of high-dimensional "spatial" variables and solving complex problems of motor control that involve sensorimotor information. In particular, we apply the methods to the case of speech motor contro

types of network topology pdf
Download. Connect more apps... Try one of the apps below to open or edit this item. types of network topology pdf. types of network topology pdf. Open. Extract.

distances in biology
DISTANCES IN BIOLOGY. Michel Deza. Ecole Normale ... (symmetry) holds for all x, y in X. A similarity is a symmetric function defined on X × X such that s(x, ...