BBRC Biochemical and Biophysical Research Communications 347 (2006) 1067–1073 www.elsevier.com/locate/ybbrc

Human Dectin-1 isoform E is a cytoplasmic protein and interacts with RanBPM Jianhui Xie, Maoyun Sun, Liang Guo, Weicheng Liu, Jianhai Jiang, Xiaoning Chen, Lei Zhou, Jianxin Gu * State Key Laboratory of Genetic Engineering and Gene Research Center, Shanghai Medical College of Fudan University, Shanghai 200032, PR China Received 27 June 2006 Available online 14 July 2006

Abstract Human Dectin-1, a type II transmembrane receptor, is alternatively spliced, generating eight isoforms. Of these isoforms, the isoform E (hDectin-1E) is structurally unique, containing a complete C-type lectin-like domain as well as an ITAM-like sequence. So far, little is known about its function. In the present study, we demonstrated that hDectin-1E was not secreted and it mainly resided in the cytoplasm. Using yeast two-hybrid screening, we identified a Ran-binding protein, RanBPM, as an interacting partner of hDectin-1E. GST pull-down assays showed that RanBPM interacted directly with hDectin-1E and the region containing SPRY domain was sufficient for the interaction. The binding of hDectin-1E and RanBPM was further confirmed in vivo by co-immunoprecipitation assay and confocal microscopic analysis. Taken together, our data provide a clue to the understanding of the function about hDectin-1E.  2006 Elsevier Inc. All rights reserved. Keywords: hDectin-1E; RanBPM; C-type lectin-like domain; Yeast two-hybrid

Dectin-1 is a type II transmembrane receptor with high homology to type II lectin receptors expressed by natural killer (NK) cells [1]. It possesses a single extracellular C-type lectin-like domain (CTLD) connected to transmembrane region by a stalk and an immunoreceptor tyrosine activation-like motif (ITAM) within the cytoplasmic domain [2]. Dectin-1 was identified as a pattern recognition receptor for b-1, 3/b-1, 6-linked glucans [3], and predominantly expressed on the surface of monocyte/macrophages and neutrophil lineages [4]. Dectin-1, in collaboration with TLR2, mediates a variety of cellular responses to zymosan, intact yeast [5], and Candida albican [6], including phagocytosis, endocytosis, and the oxidative burst; Dectin-1 can also induce the production of proinflammatory cytokines and chemokines, including TNF-a, IL-12, and MIP-2. These responses are triggered through the cytoplasmic ITAM-like sequence of this receptor via novel signaling

*

Corresponding author. Fax: +86 21 64164489. E-mail address: [email protected] (J. Gu).

0006-291X/$ - see front matter  2006 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2006.07.021

pathways [7]. Recently, Rogers and Underhill et al. have showed that binding of a ligand, zymosan, to Dectin-1 leads to recruitment and activation of the protein tyrosine kinase Syk, which in turn induces cytokine production [8] and reactive oxygen production [9]. In addition to recognizing b-glucans, Dectin-1 also recognizes an unidentified endogenous ligand on T cells, acting as a co-stimulatory molecule in inducing the proliferation of both CD4+ and CD8+ T cells in vitro [10]. Mouse Dectin-1 is alternatively spliced, generating at least two isoforms by the different usage of exon 3 [11]. Human Dectin-1 differs from its mouse counterpart in that it is alternatively spliced in cell specific manner [12]. Its mRNA is alternatively spliced, resulting in two major (A and B) and six minor (C–H) isoforms. The two major isoforms are the major receptors for b-glucans. The function of the six minor isoforms, however, remains poorly understood. Among these six isoforms, isoform E (hDectin-1E) is structurally unique, containing a complete C-type lectin-like domain as well as an ITAM-like sequence. Compared with the isoform A (hDectin-1A), hDectin-1E lacks

1068

J. Xie et al. / Biochemical and Biophysical Research Communications 347 (2006) 1067–1073

part of putative cytoplasmic domain, transmembrane region, and the stalk, encoded by exon 3 and 4 of human Dectin-1 [1,12]. In this study, we demonstrated that hDectin-1E was not secreted and it mainly resided in the cytoplasm of cells. To further investigate the functions of hDectin-1E, we performed a yeast two-hybrid screening of a human thymus cDNA library, using its complete C-type lectin-like domain as bait. We identified a Ran-binding protein, RanBPM, as an interacting partner with hDectin-1E in vitro and in vivo. Moreover, we indicated that the region containing SPRY domain was sufficient for this interaction. Experimental procedures Cell culture and transfection. HEK293T cell line was cultured in Dulbecco’s modified of Eagle’s medium (Sigma) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, and streptomycin at 37 C with 5% CO2. All transfections were carried out using LipofectAMINE2000 (Invitrogen) according to the manufacturer’s instructions. RT-PCR analysis. Total RNA from HEK293T cell line was prepared using TRIzol reagent (Gibco-BRL) according to the manufacturer’s protocol. First strand cDNA synthesis was performed using an oligo(dT) primer and the Advantage RT-for-PCR kit (Clontech) as described by the manufacturer’s protocol. An aliquot of the first strand cDNA was then subjected to PCR using the AdvanTaq kit (Clontech) with 5 0 -ATGGAA TATCATCCTGATTTAC-3 0 sense and 5 0 -TTACATTGAAAACTTCT TCTC-3 0 antisense primers. The RT-PCR fragments were purified from 1.5% agarose gel for sequencing. Purification of soluble Dectin-1. The cDNA coding region for the Cterminal extracellular domain of mouse Dectin-1 (amino acids 69–244) was amplified using 5 0 -TGTGAATTCATGGAGACAGACACACTCCT GCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGA CCGACACAATTCAGGGAGAAATCCAGAG-3 0 sense and 5 0 -GGGG GATCCTTACATTGAAAACTTCTTCTC-3 0 antisense primers. Herein, the sense primer encodes for an amino-terminal Igj chain signal peptide for producing soluble mouse Dectin-1. The resulting cDNA fragment was cloned into an expression vector pcDNA3.1/Myc-His (Invitrogen). This plasmid was transiently transfected into HEK293T cells and culture supernatant was harvested 2 days post-transfection. The soluble mouse Dectin-1 containing Myc and His6 tags at the C-terminus was purified using Ni–NTA resin (Qiagen) according to the manufacturer’s instructions. Plasmid construction. The cDNA encoding hDectin-1E was amplified by PCR and cloned into pcDNA3.1/Myc-His vector to generate Myctagged construct of hDectin-1E. GST fusion vector of hDectin-1E (GSThDectin-1E) or C-type lectin-like domain (GST-CTLD) was, respectively, generated by PCR and then cloned into pcDNA3-GST vector (Amersham Biosciences). Full-length RanBPM and RanBPM deletion mutants were generated by PCR and cloned into pcDNA3 vector (Clontech) with pEGFP-C2-RanBPM (a gift from Dr. Takeharu Nishimoto, Department of Molecular Biology, Kyushu University, Japan) as the template. Yeast two-hybrid assay. Matchmaker GAL4 two-hybrid system 3 (Clontech) was used to perform yeast two-hybrid screening according to the manufacturer’s instructions. The complete C-type lectin-like domain (aa 35–167) of hDectin-1E was cloned into the pGBKT7 vector as the bait. A total of 2 · 106 transformants from a human thymus cDNA library (Clontech) were screened in the yeast strain AH109. The plasmids from positive clones were isolated and introduced into Escherichia coli strain DH5a according to the manufacturer’s instructions. Finally, the clones, harboring target cDNA, were isolated and cDNA sequences were determined. In vitro binding assay. The indicated proteins were generated with the TNT Coupled Reticulocyte Lysate System (Promega) according to the manufacturer’s instructions. A GST pull-down assay was performed as

described previously [13]. In brief, the indicated proteins were mixed with 25 ll of glutathione–Sepharose beads in the binding buffer (20 mM Tris, pH 7.5, 140 mM NaCl, 10 mM NaF, 0.1% Nonidet P-40, 1 mM NaVO4, 10 lg/ml aprotinin, 10 lg/ml leupeptin, and 1 mM phenylmethylsulfonyl fluoride) for 2 h at 4 C. Then the beads were washed three times with the binding buffer and subsequently boiled in SDS sample buffer. The gel was dried and visualized with phosphoimaging (Fujifilm) after they were resolved by 10% SDS–PAGE. Immunoblot analysis. Total cell lysates were prepared on ice by direct lysis in Laemmli sample buffer. Protein content was standardized as determined by Lorry assay. Equal amounts of protein were separated by SDS–PAGE. Then, the proteins were transferred onto PVDF membranes, blocked overnight in 5% skim milk in Tris-buffered saline (TBS) containing 0.05% Tween 20 and incubated with primary antibody for 2 h at room temperature, followed by HRP-conjugated secondary antibody for 1 h. Blotted proteins were visualized using an enhanced chemiluminescence (ECL) kit. Immunoprecipitation. Two days after transfection, cells were harvested and resuspended in lysis buffer (50 mM Tris, pH7.5, 140 mM NaCl, 0.5% Nonidet P-40, 5 mM EDTA, 60 mM b-glycerophosphate, 1 mM sodium orthovanadate, 10 mM NaF, 10 lg/ml aprotinin, 10 lg/ml leupeptin, and 1 mM PMSF) for 30 min on ice. Lysates were clarified by centrifugation and precleared with protein G-agarose beads. Lysates were incubated with the indicated antibodies for 2 h at 4 C with rotation and the immunocomplexes were then mixed with 30 ll of 1:1 slurry of protein G-agarose pre-equilibrated in lysis buffer at 4 C overnight. After centrifugation, the pellets were washed three times in lysis buffer. The beads, as well as initial lysates, were then resuspended in SDS sample buffer, boiled for 5 min, and subjected to Western blot analysis. Immunofluorescence and confocal assay. HEK293T cells were plated onto coverslips the day before transfection. Two days after transfection, cells were washed twice with ice-cold PBS and then fixed with 4% freshly prepared paraformaldehyde for 30 min at room temperature. After rinsed three times with PBS, the non-permeabilized cells were detected for cell surface molecules and permeabilized cells were detected for intracellular molecules with 0.1% Triton X-100/PBS for 10 min, then blocked in 1% bovine serum albumin for 1 h at room temperature. For visualization of the expression of hDectin-1E and hDectin-1A, coverslips were sequentially incubated with 100 ll of mouse anti-Myc antibody (Invitrogen, 1:100 dilution) for 1 h at room temperature followed by incubation with FITC-conjugated or Rhodamine-conjugated anti-mouse antibody (Invitrogen, 1:100 dilution). Thereafter, coverslips were mounted on glass slides using Vectashield mounting medium (Vector Laboratories) and observed under a confocal laser scanning microscope (Zeiss LSM 410). Ectopically GFP-tagged RanBPM was directly visualized by the microscope. Image acquirement and confocal analysis were preformed using Zeiss AIM software.

Results hDectin-1E is not secreted and resides in the cytoplasm A previous publication has demonstrated distinct transcripts of human Dectin-1 via RT-PCR on HEK293T cell RNA. However, the transcripts have not been determined [12]. To further analyze the transcripts, we performed RTPCR on RNA from HEK293T cells. One transcript of about 500 bp with a high level of expression and another two of about 600 and 700 bp, respectively, with a low level of expression were detected (Fig. 1B). The PCR products were isolated, cloned, and sequenced. The cDNA sequences were identified as hDectin-1E, hDectin-1B, and hDectin-1A, respectively. Among these transcripts, hDectin-1E lacks the putative transmembrane region and part of cytoplasmic domain as well as a stalk region (Fig. 1A).

J. Xie et al. / Biochemical and Biophysical Research Communications 347 (2006) 1067–1073

1069

Fig. 1. hDectin-1E is not secreted and mainly localizes to the cytoplasm of cells. (A) Schematic representation of hDectin-1E compared with hDectin-1A. Apart from lacking part of cytoplasmic domain, transmembrane region, and a stalk region, hDectin-1E is identical with hDectin-1A. (B) Detection of hDectin-1 transcripts in HEK293T cells by RT-PCR analysis. The size of PCR productions was determined by comparison with the marker. (C) Western blot analysis for hDectin-1E in the lysate and supernatant of the transfected HEK293T cells. The soluble mouse Dectin-1 was employed as a positive control. (D–F) HEK293T cells were transfected with hDectin-1A (D) and hDectin-1E (E), respectively, followed by immunofluorescence analysis for detecting their expression on the cell surface. The expression of hDectin-1E inside the cells was revealed in permeabilized hDectin-1E-transfected HEK293T cells (F).

Furthermore, by immunoblotting of HEK293T cells transfected with Myc-tagged hDectin-1E, we clearly detected a single band of approximately 21 kDa with anti-myc antibody, which corresponded to the estimated molecular weight of about 19.5 kDa for Myc-tagged hDectin-1E (Fig. 1C). Due to a lack of transmembrane region, hDectin-1E could not be expressed on the cell surface. To address this question we performed immunofluorescence analysis. hDectin-1A and hDectin-1E were expressed in HEK293T cells and the comparison of hDectin-1A and hDectin-1E protein expression demonstrated that hDectin1E was not expressed on the cell surface (Fig. 1D and E). Further, anti-Myc antibodies were able to stain permeabilized hDectin-1E-transfected HEK293T cells, which showed that hDectin-1E was mainly distributed into the cytoplasm of cells (Fig. 1F). Subsequently, we tested whether it was secreted as a soluble protein into the culture medium. Supernatant from culture of HEK293T cells transiently transfected with hDectin-1E was purified using Ni–NTA resin (QIAGEN) according to the manufacturer’s instructions and then was tested for the presence of hDectin-1E by Western blot. No hDectin-1E was detected in the supernatant (Fig. 1C). This could not be due to a lack of protein

expression since hDectin-1E could be readily detected as described above. Nor could this be caused by the inability of HEK293T cells to secrete soluble factors since transiently transfected HEK293T cells with soluble Dectin-1 secreted sDectin-1. Taken together, these data suggest that hDectin-1E was a soluble but non-secreted form of Dectin-1 and mainly localized to the cytoplasm. Identification of RanBPM as an hDectin-1E-interacting protein by yeast two-hybrid screening To identify the possible cellular protein(s) interacting with hDectin-1E, yeast two-hybrid analysis was carried out with the complete C-type lectin-like domain of hDectin-1E (aa 35–167) as bait. The bait did not exhibit any intrinsic activity of transcriptional activation for the three reporters (HIS3, ADE2, and MEL1). Sixteen independent positive cDNA clones were isolated. Subsequent sequence analysis revealed that four out of the positive clones encoded partial sequences of RanBPM. The sequence of all the four library clones encoded amino acids 133–729 of RanBPM (Fig. 3A). Independent cotransformation of the bait construct pGBKT7-CTLD and the candidate clones into yeast,

1070

J. Xie et al. / Biochemical and Biophysical Research Communications 347 (2006) 1067–1073

followed by growth and color selection, confirmed the interaction. To further confirm the interaction between hDectin1E and RanBPM, two cloning vectors were exchanged by moving RanBPM from the activation domain (pGADT7) to the DNA-BD vector (pGBKT7) and C-type lectin-like domain of Dectin-1E from the pGBKT7 to pGADT7. The repeated two-hybrid assay also demonstrated their interaction by the activation of all the three reporters (Fig. 2). RanBPM binds directly to hDectin-1E in vitro To verify the protein interactions revealed via the yeast two-hybrid assay, we performed GST pull-down assays with in vitro translated, [35S]-labeled proteins. Full-length RanBPM was incubated with GST-CTLD, GST-hDectin1E, or GST alone employed as a negative control. As shown in Fig. 3B, RanBPM could bind significantly to GST-CTLD and GST-hDectin-1E, but not to GST. RanBPM contains a SPRY domain followed by a LisH-CTLH domain which is possessed by proteins that are involved in microtubule dynamics, cell migration, nucleokinesis, and chromosome segregation [14]. The function of the SPRY domain is still unclear but several studies have shown that it is a protein– protein interaction domain [15]. We, therefore, speculated that the SPRY domain might be involved in the interaction with hDectin-1E. To test our hypothesis, we constructed three RanBPM deletion constructs (Fig. 3A): one obtained from two-hybrid screening (aa 133–729), another containing the SPRY domain (aa 133–402), and the third lacking the N-terminal region and the SPRY domains (aa 403–729). The GST pull-down assays demonstrated that hDectin-1E bound to the first and second constructs, but not to the third one. The data indicate that the SPRY domain-containing region of RanBPM was sufficient for direct interaction with hDectin-1E.

Fig. 3. RanBPM interacts with hDectin-1E directly in vitro. (A) Schematic representation of RanBPM and RanBPM deletion mutants, GST-CTLD, GST-hDectin-1E is shown. The SPRY, LisH-CTLH, and CTLD domains are indicated. (B) In vitro interaction between GSTCTLD, GST-hDectin-1E, and RanBPM or RanBPM deletion mutants. GST, GST-CTLD, GST-hDectin-1E, and RanBPM, and its deletion mutants protein were [35S]-methionine labeled and used for GST pulldown assay. Bound proteins were analyzed by SDS–PAGE followed by autoradiography. Individual proteins are indicated.

Fig. 2. C-type lectin-like domain of hDectin-1E interacts with RanBPM in yeast two-hybrid system. Yeast AH109 cells were co-transformed with pGBKT7 and pACT2 that contains the indicated cDNA and selected on a SD/-Trp/-Leu/-His/-ADE/X-a-gal. Transformation of PACT2 with pGBKT7CTLD or pGBKT7-RanBPM tests autonomous activation. Co-transformation of pGBKT7-p53 and pGADT7-T serves as a positive control and cotransformation of pGBKT7-Lam C and pGADT7-T as a negative control.

J. Xie et al. / Biochemical and Biophysical Research Communications 347 (2006) 1067–1073

1071

Fig. 4. RanBPM associates with hDectin-1E in vivo. (A) Extracts from HEK293T cells co-transfected with pcDNA3-RanBPM and pCDNA3.1/MychDectin-1E or pCDNA3.1/Myc vector were subjected to immunoprecipitation with anti-Myc antibody, followed by Western blot with anti-RanBPM antibody. Expression of RanBPM and hDectin-1E was detected by Western blot with anti-Myc antibody or anti-RanBPM, respectively. (B) Colocalization of hDectin-1E and RanBPM in human cells. hDectin-1E was transfected into cells with pEGFP/RanBPM and a confocal immunofluorescence microscopy assay was performed using anti-Myc antibody. The subcellular localization of hDectin-1E (red) and RanBPM (green) and their co-localization (yellow) are shown. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this paper.)

RanBPM interacts with hDectin-1E in vivo To further demonstrate whether RanBPM and hDectin1E interact in mammalian cells, co-immunoprecipitation assays were performed. Myc-tagged hDectin-1E and RanBPM were cotransfected into HEK293T cells and the expression was confirmed by Western blotting with antiMyc and anti-RanBPM antibodies. Whole cell extracts were immunoprecipitated with anti-Myc antibody, followed by immunoblot analysis with anti-RanBPM antibody. As shown in Fig. 4A, RanBPM was co-immunoprecipitated with hDectin-1E. This suggests that RanBPM associated with hDectin-1E in human cells when both proteins were overexpressed. To further demonstrate this interaction, the subcellular localization of RanBPM and hDectin-1E was determined by confocal microscopy analysis. HEK293T cells were transiently cotransfected with Myc-tagged hDectin-1E and GFP-tagged RanBPM. Immunofluorescence analysis revealed that RanBPM (green image) was localized in the cytoplasm and nucleus. hDectin-1E (red image) was localized predominantly in the cytoplasm. Merging of the two images demonstrated that RanBPM co-localized with Dectin-1E in the cytoplasm (Fig. 4B, yellow image). Discussion In this study, we characterized hDectin-1E, which was obtained on PCR amplification from HEK293T. hDectin-1E was not secreted into culture medium and it

mainly resided in the cytoplasm. Since, we do not have an anti-hDectin-1E antibody, we could not detect the localization of endogenous hDectin-1E. We detected hDectin-1E as a single protein of approximately 21 kDa. We also identified RanBPM as hDectin-1E binding partner with its C-type lectin-like domain. The interaction between hDectin-1E and RanBPM was confirmed both in vitro and in vivo. Furthermore, we showed the SPRY domain-containing region of RanBPM was sufficient for this interaction. hDectin-1 mRNA is alternatively spliced, resulting in two major (A and B) and six minor isoforms. Actually, the alternative splicing of the precursor for mRNA is a powerful and versatile regulatory mechanism utilized by higher eukaryotes for generating functionally different proteins from the same gene and accounts for a considerable proportion of proteomic complexity [16]. There are examples that mRNAs and proteins produced from a single gene are functionally distinct and antagonize or cross-regulate the biological activities of the other isoforms. For example, there is functional difference between two mouse Dectin-1 isoforms in recognizing zymosan and producing TNF-a [11]. For another example, an alternatively spliced isoform of CD40 influences the function of the prototypic fulllength CD40 isoform and however, the exact mechanism is unclear [17]. Whether hDectin-1E regulates the function of other Dectin-1 isoforms remains elusive. However, so far the counterpart of hDectin-1E in mouse cell has not been detected. It is likely that the function of Dectin-1 is regulated by different mechanisms in human and mouse cells.

1072

J. Xie et al. / Biochemical and Biophysical Research Communications 347 (2006) 1067–1073

Furthermore, the skipping of the transmembrane-coding exon is observed in other several type II membrane proteins that belong to the C-type animal lectin family, suggesting that this is an evolutionarily conserved property [16]. The proteins lack a leader sequence and it is unclear whether loss of the hydrophobic transmembrane-encoding region would limit the ability of these molecules to traverse across the endoplasmic reticulum membrane, resulting in their retention in the cytoplasm. In fact, previous studies suggest that the subcellular destination of some integral membrane proteins is signaled by their transmembrane regions [18]. Interestingly, sDC-SIGN, a TM-lacking DC-SIGN isoform, has been showed not to be secreted into culture medium and may function as intracellular molecules [19]. Here, our data also demonstrate that hDectin-1E was not secreted into culture medium and it mainly resided in the cytoplasm. Thus it is possible that the lack of transmembrane region impairs signal-anchor sequences and consequently influences the translocation of C-terminal portion of the polypeptide to the ER lumen. Further studies need to be done to shed light on this issue. Ran binding protein in microtubule organizing center (RanBPM/RanBP9) was first identified as one of a number of proteins interacting with the small GTPase Ran and localizes to both the cytoplasm and nucleus [15,20]. Subsequent studies show that RanBPM may function as a scaffold protein that coordinates signal inputs derived from cell surface receptors with intracellular signaling pathways [21]. Further, RanBPM was found in a large multiprotein complex by co-immunoprecipitation and gel filtration assays [22]. In fact a number of cytoplasmic molecules contain ITAM-like sequence [23]. ERM (Ezrin/Radixin/Moesin) proteins, which are involved in a number of cytoskeletal functions in a wide variety of tissues, have been shown to contain ITAM-like sequence and act as adaptor molecules to recruit Syk tyrosine kinase [24]. Tamalin, a metabotropic glutamate receptorassociated neuronal scaffolding protein, contains an ITAM sequence, which becomes phosphorylated by the Src-family kinases Src and Fyn, leading to the recruitment of the Syk tyrosine kinase [25]. Recent studies have demonstrated that the intracellular portion of mouse Dectin-1 can recruit Syk kinase upon tyrosine phosphorylation. The hDectin-1E contains ITAM-like sequence and a complete C-type lectin-like domain. Whether it also functions as an adaptor molecule remains elusive. Further studies to elucidate this question will enable us to gain more understanding about the functional significance. Acknowledgments We appreciate Dr. Nishimoto and Dr. Bianchi for kindly providing RanBPM plasmid. This work was supported by National Natural Scientific Foundation of China (30330320, 30470442, and 30570364) and the National Basic Research Program (973 Program, 2002CB512803).

References [1] K. Yokota, A. Takashima, P.R. Bergstresser, K. Ariizumi, Identification of a human homologue of the dendritic cell-associated C-type lectin-1, dectin-1, Gene 272 (2001) 51–60. [2] K. Ariizumi, G.L. Shen, S. Shikano, S. Xu, R. Ritter III, T. Kumamoto, D. Edelbaum, A. Morita, P.R. Bergstresser, A. Takashima, Identification of a novel, dendritic cell-associated molecule, dectin-1, by subtractive cDNA cloning, J. Biol. Chem. 275 (2000) 20157–20167. [3] G.D. Brown, S. Gordon, Immune recognition. A new receptor for b-glucans, Nature 413 (2001) 36–37. [4] J.A. Willment, A.S. Marshall, D.M. Reid, D.L. Williams, S.Y. Wong, S. Gordon, G.D. Brown, The human b-glucan receptor is widely expressed and functionally equivalent to murine Dectin-1 on primary cells, Eur. J. Immunol. 35 (2005) 1539–1547. [5] B.N. Gantner, R.M. Simmons, S.J. Canavera, S. Akira, D.M. Underhill, Collaborative induction of inflammatory responses by dectin-1 and Toll-like receptor 2, J. Exp. Med. 197 (2003) 1107–1117. [6] B.N. Gantner, R.M. Simmons, D.M. Underhill, Dectin-1 mediates macrophage recognition of Candida albicans yeast but not filaments, EMBO J. 24 (2005) 1277–1286. [7] J. Herre, A.S. Marshall, E. Caron, A.D. Edwards, D.L. Williams, E. Schweighoffer, V. Tybulewicz, Reis e Sousa, S. Gordon, G.D. Brown, Dectin-1 uses novel mechanisms for yeast phagocytosis in macrophages, Blood 104 (2004) 4038–4045. [8] N.C. Rogers, E.C. Slack, A.D. Edwards, M.A. Nolte, O. Schulz, E. Schweighoffer, D.L. Williams, S. Gordon, V.L. Tybulewicz, G.D. Brown, Reis e Sousa, Syk-dependent cytokine induction by Dectin-1 reveals a novel pattern recognition pathway for C type lectins, Immunity 22 (2005) 507–517. [9] D.M. Underhill, E. Rossnagle, C.A. Lowell, R.M. Simmons, Dectin-1 activates Syk tyrosine kinase in a dynamic subset of macrophages for reactive oxygen production, Blood 106 (2005) 2543–2550. [10] F. Grunebach, M.M. Weck, J. Reichert, P. Brossart, Molecular and functional characterization of human Dectin-1, Exp. Hematol. 30 (2002) 1309–1315. [11] S.E. Heinsbroek, P.R. Taylor, M. Rosas, J.A. Willment, D.L. Williams, S. Gordon, G.D. Brown, Expression of functionally different Dectin-1 isoforms by murine macrophages, J. Immunol. 176 (2006) 5513–5518. [12] J.A. Willment, S. Gordon, G.D. Brown, Characterization of the human beta -glucan receptor and its alternatively spliced isoforms, J. Biol. Chem. 276 (2001) 43818–43823. [13] M. Mikolajczyk, J. Shi, R.R. Vaillancourt, N.A. Sachs, M. Nelson, The cyclin-dependent kinase 11(p46) isoform interacts with RanBPM, Biochem. Biophys. Res. Commun. 310 (2003) 14–18. [14] D. Wang, Z. Li, E.M. Messing, G. Wu, Activation of Ras/Erk pathway by a novel MET-interacting protein RanBPM, J. Biol. Chem. 277 (2002) 36216–36222. [15] S. Kramer, T. Ozaki, K. Miyazaki, C. Kato, T. Hanamoto, A. Nakagawara, Protein stability and function of p73 are modulated by a physical interaction with RanBPM in mammalian cultured cells, Oncogene 24 (2005) 938–944. [16] S. Mummidi, G. Catano, L. Lam, A. Hoefle, V. Telles, K. Begum, F. Jimenez, S.S. Ahuja, S.K. Ahuja, Extensive repertoire of membranebound and soluble dendritic cell-specific ICAM-3-grabbing nonintegrin 1 (DC-SIGN1) and DC-SIGN2 isoforms. Inter-individual variation in expression of DC-SIGN transcripts, J. Biol. Chem. 276 (2001) 33196–33212. [17] M. Tone, Y. Tone, P.J. Fairchild, M. Wykes, H. Waldmann, Regulation of CD40 function by its isoforms generated through alternative splicing, Proc. Natl. Acad. Sci. USA 98 (2001) 1751–1756. [18] S.H. Wong, S.H. Low, W. Hong, The 17-residue transmembrane domain of b-galactoside a 2,6-sialyltransferase is sufficient for Golgi retention, J. Cell Biol. 117 (1992) 245–258.

J. Xie et al. / Biochemical and Biophysical Research Communications 347 (2006) 1067–1073 [19] O. Martinez, S. Brackenridge, M. El-Idrissi, B.S. Prabhakar, DCSIGN, but not sDC-SIGN, can modulate IL-2 production from PMA- and anti-CD3-stimulated primary human CD4 T cells, Int. Immunol. 17 (2005) 769–778. [20] M. Nakamura, H. Masuda, J. Horii, K. Kuma, N. Yokoyama, T. Ohba, H. Nishitani, T. Miyata, M. Tanaka, T. Nishimoto, When overexpressed, a novel centrosomal protein, RanBPM, causes ectopic microtubule nucleation similar to c-tubulin, J. Cell Biol. 143 (1998) 1041–1052. [21] S. Denti, A. Sirri, A. Cheli, L. Rogge, G. Innamorati, S. Putignano, M. Fabbri, R. Pardi, E. Bianchi, RanBPM is a phosphoprotein that associates with the plasma membrane and interacts with the integrin LFA-1, J. Biol. Chem. 279 (2004) 13027–13034. [22] H. Nishitani, E. Hirose, Y. Uchimura, M. Nakamura, M. Umeda, K. Nishii, N. Mori, T. Nishimoto, Full-sized RanBPM cDNA encodes a

1073

protein possessing a long stretch of proline and glutamine within the N-terminal region, comprising a large protein complex, Gene 272 (2001) 25–33. [23] S. Fodor, Z. Jakus, A. Mocsai, ITAM-based signaling beyond the adaptive immune response, Immunol. Lett. 104 (2006) 29–37. [24] A. Urzainqui, J.M. Serrador, F. Viedma, M. Yanez-Mo, A. Rodriguez, A.L. Corbi, J.L. onso-Lebrero, A. Luque, M. Deckert, J. Vazquez, F. Sanchez-Madrid, ITAM-based interaction of ERM proteins with Syk mediates signaling by the leukocyte adhesion receptor PSGL-1, Immunity 17 (2002) 401–412. [25] M. Hirose, J. Kitano, Y. Nakajima, K. Moriyoshi, S. Yanagi, H. Yamamura, T. Muto, H. Jingami, S. Nakanishi, Phosphorylation and recruitment of Syk by immunoreceptor tyrosine-based activation motif-based phosphorylation of tamalin, J. Biol. Chem. 279 (2004) 32308–32315.