BJU International (2002), 89, 955–960

Intracavernosal injection of vascular endothelial growth factor induces nitric oxide synthase isoforms C . - S . L I N , H. - C . H O , K . - C . C H E N , G . L I N , L . NU N E S and T . F . L U E Knuppe Molecular Urology Laboratory, Department of Urology, School of Medicine, University of California, San Francisco, CA, USA

Objective To identify genes that are affected by vascular endothelial growth factor (VEGF), as an intracavernosal injection with VEGF improved the recovery of erectile function in a rat model of arteriogenic impotence, specifically examining the three nitric oxide synthase (NOS) genes, nNOS, eNOS, and iNOS. Materials and methods Male rats had their pudendal arteries ligated or underwent a sham operation. They were then treated by an intracavernosal injection with 4 mg of VEGF in phosphate-buffered saline (PBS) or PBS alone. At 6 and 24 h after treatment electrostimulation was applied to the cavernosal nerve and the intracorporal pressure measured. The erectile tissue was then harvested for RNA isolation and cryo-sectioning. The isolated RNA was used for microarray and reverse transcription-polymerase

Introduction Penile arterial insufficiency is one of the most common causes of erectile dysfunction. To simulate such a condition, we established a rat model of arteriogenic impotence, by ligating the internal iliac or pudendal arteries [1–3]. Electron microscopic and histological examination of the corpus cavernosum of these rats showed degeneration of the cavernosal smooth muscle and nerves [3]. In contrast, rats treated by an intracavernosal injection with vascular endothelial growth factor A (VEGF-A), had essentially normal muscle and nerve morphology in the presence of an active endothelial response (endothelial cell hypertrophy and hyperplasia) [3]. While VEGF-A has been extensively documented for its mitogenic effects on the endothelium, in recent years it has become increasingly clear that VEGF-A also has musculotrophic and neurotrophic properties [4,5]. For example, we recently showed that VEGF-A increases the proliferation of cultured cavernosal smooth muscle cells, Accepted for publication 19 February 2002 #

2002 BJU International

chain reaction (RT-PCR) analyses, and the tissue sections for immunohistochemical analysis. Results Microarray analysis detected nNOS, eNOS and iNOS at very low expression levels in PBS-treated rats; expression levels were higher for eNOS and iNOS in all VEGF-treated rats. These results were further confirmed by RT-PCR analysis. Immunohistochemical analysis identified the cavernosal endothelium and smooth muscle as the tissue types where eNOS and iNOS were up-regulated, respectively. Conclusions This is the first report of the induction of both eNOS and iNOS in the penis after intracavernosal VEGF. These events may help support a significant recovery of erectile function after interrupting the blood supply to the penis. Keywords VEGF, nitric oxide synthase, penis, microarray, endothelium, smooth muscle

which express the VEGFR1 receptor [6]. We also made a preliminary observation that VEGF-A induced axonal growth of pelvic ganglia (in preparation). We therefore consider that it is through these endotheliotrophic, musculotrophic and neurotrophic pathways that VEGF-A exerts its protective effects on the cavernosal tissue. At the molecular level, VEGF-A can induce the endothelial and inducible forms of nitric oxide synthase (NOS), i.e. eNOS and iNOS, respectively, in cultured endothelial cells [7–9]. NOSs are responsible for the production of NO, a gaseous molecule that initiates a cascade of biochemical events resulting in vascular smooth muscle relaxation and penile erection [10,11]. In the penis, the neuronal form of NOS (nNOS) is principally responsible for the production of NO leading to the sexually stimulated erection. On the other hand, while the contribution of eNOS to penile erection is considered auxiliary [12,13], whether iNOS has any physiological role in penile erection is unknown. The primary expression sites for nNOS, eNOS, and iNOS in the penis are nerves, endothelium, and leukocytes, respectively [13,14]. However, all three 955

956

C.-S. LIN et al.

forms have also been detected in cavernosal smooth muscle [15–17]. In a recent report we described the use of microarray analysis to identify differentially expressed genes in the corpus cavernosum of rats with and without ligation of the pudendal arteries [2]. In the present study we again used microarray analysis to identify differentially expressed genes in the erectile tissue of rats treated with intracavernosal VEGF-A. Many such genes were detected as a result, most of which are still being assessed further. Herein we report the identification of eNOS and iNOS as two of the VEGF-induced genes in the corpus cavernosum.

Materials and methods The experimental protocol and animal care were approved by our institutional Committee on Animal Research. Male Sprague-Dawley rats (6 months old) were used in all experiments. As previously described [2,3], longitudinal incisions were made on the gluteal area on both sides of the tail of the rats. Under a r16 operative microscope, the internal pudendal arteries were isolated and looped (sham-operated). For ligated rats, their pudendal arteries were ligated with 7–0 Nylon at both the main trunk and the penile branches. A separate incision was then made in the perineum and a 23 G scalp vein needle inserted to one of the crura for the monitoring of intracavernosal pressure (ICP). An intracavernosal injection with 4 mg of VEGF in PBS with 0.1% BSA, or PBS solution with 0.1% BSA only, was then administered through the same needle to the rats, followed by closure of wound. Four groups of rats (six per group) were established, i.e. sham+PBS, sham+VEGF, ligation+PBS and ligation+VEGF. Three rats in each group were treated with PBS or VEGF and killed 6 h later; the remaining three rats in each group were treated similarly and killed after 24 h. The cavernosal nerve was electrostimulated and the ICP measured before sacrifice. All sham-operated rats had a normal ICP of <100 cmH2O and all ligated rats (with or without VEGF treatment) had an ICP of < 30 cmH2O. The erectile tissue was then processed for RNA isolation and immunohistochemical analysis. RNAs of cavernosal tissues were isolated by the TriReagent RNA extraction method (Molecular Research Center, Cincinnati, OH). Despite the manufacturer’s claim, RNAs prepared by this method are usually contaminated by trace amounts of DNA, as assessed by PCR with b-actin primers (data not shown). To remove the contaminating DNA, each RNA sample (20–50 mg) was treated with 10 U of RNase-free DNase I (Roche Molecular Biochemicals, Pleasanton, CA) at

37uC for 30 min. The RNA was then purified by phenol/chloroform extraction and ethanol precipitation. The quantity and purity of RNAs were measured by spectrophotometry with ultraviolet adsorption at wavelengths of 260 and 280 nm. Their integrity was visualized by the sharpness of the 28S and 18S ribosomal RNA bands in agarose gels. Microarray analysis Tissue RNA was converted into a 32P-labelled cDNA probe, which was then hybridized to cDNA fragments of 1176 rat genes that were immobilized on a Nylon membrane (Atlas Rat 1.2 Array, Clontech Inc, Palo Alto, CA). The detail of this procedure was described previously [2]. RT-PCR analysis Primer pairs for RT-PCR analysis of eNOS, iNOS, nNOS and b-actin genes are listed in Table 1. RT-PCR was performed in an RT step and a PCR step, as described previously [2]. Briefly, 2.5 mg of each RNA was reverse transcribed in a reaction volume of 20 mL. This RT product was then diluted 5–100-fold with Tris-EDTA buffer (10 mmol/L Tris-HCl, pH 8, 1 mmol/L EDTA); 1 mL of each dilution was used in a 10-mL PCR to identify the optimal input within the linear amplification range. PCR was performed in DNA Engine thermocycler (MJ Research, Inc., Watertown, MA) under calculated temperature control. The cycling programme was set for 35 cycles of 94uC, 10 s; 55uC, 10 s; 72uC, 10 s, followed by one cycle of 72uC, 5 min. The PCR products were electrophoresed in 1.5% agarose gels in the presence of ethidium bromide, visualized by ultraviolet fluorescence, and recorded by a digital camera connected to a computer. Immunohistochemical staining Freshly dissected rat penis was fixed for 4 h in 2% formaldehyde, 0.002% picric acid in 0.1 mol/L Table 1 Oligonucleotide primers

Gene b-actin eNOS iNOS nNOS

Primer name

Sequence

b-actin-s b-actin-a eNOS-s eNOS-a iNOS-s iNOS-a nNOS-s nNOS-a

TCTACAATGAGCTGCGTGTG ATCTCCTTCTGCATCCTGTC AGTAACACAGACAGTGCAGG TGTAGCCTGGAACATCTTCC ACCTACTTCCTGGACATCAC ACCCAAACACCAAGGTCATG AGCACCTTTGGCAATGGAGA ATCACAGGCTGCCTTGAAGA

#

Size of PCR product 682 bp 388 bp 560 bp 504 bp

2002 BJU International 89, 955–960

VEGF INDUCES NOS EXPRESSION IN THE PENIS

phosphate buffer, pH 8.0. After a 24-h incubation in cold 30% sucrose, 0.1 mol/L phosphate buffer, pH 8.0, tissues were embedded in OCT Compound (Sakura Finetek USA, Inc., Torrance, CA), frozen in liquid nitrogen, and stored at x70uC until use. Tissue sections were cut at 10 mm, mounted on charged slides (Superfrost Plus, Fisher Scientific, Pittsburgh, PA), and air-dried. Endogenous peroxidase activity was eliminated by incubating sections for 10 min in 3% hydrogen peroxide/methanol. Sections were incubated for 30 min with 3% horse serum in PBS+0.3% Triton X-100 followed by anti-eNOS or anti-iNOS antibody (1 : 200 and 1 : 500, respectively, Transduction Laboratories, Inc., Lexington, KY) for 60 min. After rinses, an avidin-biotin-enzyme complex staining kit (Vectastain, Vector Laboratories, Burlingame, CA) was used, with diaminobenzidine as the chromogen. Sections were counterstained with haematoxylin (bluish staining of all cell nuclei), while positive (antigen-expressing) cells were stained brown.

6h P S

P L

957

24 h V S

V L

P S

P L

V S

V L

nNOS

eNOS

Results The microarray analysis identified several genes that showed either higher or lower expression levels among the different groups of rats. In the present report, only the three NOS genes (nNOS, eNOS, and iNOS), will be assessed, whose expression in normal rats is very low [2]. Their low expression levels were confirmed with rats treated with intracavernosal PBS (sham or ligated, 6 or 24 h) but the levels of expression of eNOS and iNOS, but not nNOS, were higher in rats treated with VEGF. To verify the microarray analysis results, the rat tissue RNAs were further analysed by RT-PCR. As shown in Fig. 1, nNOS expression remained essentially unchanged in all tested samples, while there was a moderate up-regulation of eNOS and a much higher up-regulation of iNOS in VEGF-treated samples. Neither the ligation nor the length of treatment (6 vs 24 h) appeared to affect the expression of any of the three NOS genes. To confirm that the up-regulation of eNOS and iNOS also occurred at the protein level, and to identify which cell types were involved in the up-regulation, penile tissue sections were assessed immunohistochemically. As shown in Fig. 2, eNOS and iNOS were up-regulated, respectively, in the endothelium and in the smooth muscle.

Discussion All three NOS forms have previously been identified in the corpus cavernosum; nNOS is primarily expressed #

2002 BJU International 89, 955–960

iNOS

b-actin

Fig. 1. Penile expression of NOS forms. Rats were subjected to sham-operation (S) or pudendal arterial ligation (L), and treated with an intracavernosal injection of PBS (P) or VEGF (V). After 6 h or 24 h their erectile tissues were subjected to RT-PCR analysis for nNOS, eNOS, iNOS, and b-actin expression.

in the cavernosal nerve, and is principally responsible for the production of NO that enters cavernosal smooth muscle cells and initiates the biochemical cascade leading to sexually induced erection. eNOS synthesizes NO that plays an indirect and auxiliary role in erection, and iNOS is probably not involved in erection. Based on this current understanding of the roles of the NOS forms in the penis, it appears unlikely that the increased expression of eNOS and iNOS after intracavernosal injection with VEGF could be directly involved in erection. Rather, increased expression of eNOS and

958

C.-S. LIN et al. Fig. 2. Localization of NOS forms. Rats were treated as in Fig. 1 and their erectile tissues subjected to immunohistochemical analysis for eNOS and iNOS. These sections are from sham-operated, 6-h treated samples (with PBS or VEGF). r400.

iNOS may mediate the angiogenic and protective effects of VEGF, as discussed below. VEGF was originally termed vascular permeability factor, because of its effect in increasing endothelial permeability. Although the mechanism is not fully understood, several authors have shown that NO released from the endothelium in response to VEGF is responsible for the increased endothelial permeability [18–20]. By using a homozygous eNOS-knockout mouse model, Murohara et al. [21] reported that angiogenesis in the ischaemic hind-limb was significantly impaired in the knockout mice compared with wild-type controls. They also reported that the impaired angiogenesis in the eNOS-knockout mice was not improved by giving VEGF, suggesting that eNOS is an essential mediator of the angiogenic property of VEGF. Thus, it appears that the VEGF-induced up-regulation of eNOS expression in the penis is an integral component of the VEGF-mediated angiogenic pathway. More importantly, it might have supported a significant recovery of the erectile function in the present VEGF-treated rats with arteriogenic impotence [3].

The importance of eNOS in the VEGF-mediated angiogenic pathway has been confirmed in a recent study by Fukumura et al. [22]. In that study, both eNOS and iNOS knockout mice were used and, in contrast to the eNOS-knockout mice, the iNOS-knockout mice were able to respond to VEGF and had only slightly slower angiogenesis than wild-type mice. Thus, the induction of iNOS by VEGF, as in the present study, is probably unrelated to the angiogenic pathway. Rather, because the induction of iNOS occurred in the cavernosal smooth muscle cells, its role is probably similar to that reported in vascular smooth muscle cells, in which cytokine-induced iNOS expression is thought to play a compensatory role for the lack of endothelial NO synthesis during vascular injuries [23]. Unlike eNOS or iNOS, nNOS is not known to be inducible by VEGF, and this lack of nNOS induction by VEGF was also apparent in the present study. While nNOS is important in mediating penile erection and other neuro-signalling events, it is not involved in angiogenic pathways (as eNOS is) or inflammatory responses (as iNOS is). Intracavernosal injection with VEGF is #

2002 BJU International 89, 955–960

VEGF INDUCES NOS EXPRESSION IN THE PENIS

probably sensed through VEGF receptors in endothelial and smooth muscle cells as a stress signal that then triggers up-regulated transcription from eNOS and iNOS genes. On the other hand, the VEGF-triggered biochemical events probably have no targets in the nNOS gene, and which continues to produce nNOS transcripts at a steady level. In conclusion, this is the first report of the induction of both eNOS and iNOS in the penis after intracavernosal VEGF. While eNOS was expressed in the endothelium and probably mediates the angiogenic process, iNOS was expressed in smooth muscle and may provide protection against ischaemic injury. Both events may help to support a significant recovery in erectile function after interruption of the blood supply to the penis. The lack of nNOS induction is consistent with other studies and indicates that nNOS has little or no role in angiogenic or injury responses.

Acknowledgements This work was supported in part by grants from the California Urology Foundation and NIH (2R01-DK-45370).

References 1 El-Sakka A, Yen TS, Lin CS, Lue TF. Traumatic arteriogenic erectile dysfunction: a rat model. Int J Impot Res 2001; 13: 162–71 2 Lin CS, Ho HC, Gholami S, Chen KC, Jad A, Lue TF. Gene expression profiling of an arteriogenic impotence model. Biochem Biophys Res Commun 2001; 285: 565–9 3 Lee M-C, El-Sakka AI, Graziottin TM, Ho H-C, Lin C-S, Lue TF. The effect of vascular endothelial growth factor on a rat model of traumatic arteriogenic erectile dysfunction. J Urol 2002; 167: 761–9 4 Brown LF, Detmar M, Tognazzi K, Abu-Jawdeh G, IruelaArispe ML. Uterine smooth muscle cells express functional receptors (flt-1 and KDR) for vascular permeability factor/ vascular endothelial growth factor. Lab Invest 1997; 76: 245–55 5 Sondell M, Sundler F, Kanje M. Vascular endothelial growth factor is a neurotrophic factor which stimulates axonal outgrowth through the flk-1 receptor. Eur J Neurosci 2000; 12: 4243–54 6 Liu X, Lin CS, Graziottin T, Resplande J, Lue TF. Vascular endothelial growth factor promotes proliferation and migration of cavernous smooth muscle cells. J Urol 2001; 166: 354–60 7 Bouloumi E`A, Schini-Kerth VB, Busse R. Vascular endothelial growth factor up-regulates nitric oxide synthase expression in endothelial cells. Cardiovasc Res 1999; 41: 773–80 #

2002 BJU International 89, 955–960

959

8 Kroll J, Waltenberger J. VEGF-A induces expression of eNOS and iNOS in endothelial cells via VEGF receptor-2 (KDR). Biochem Biophys Res Commun 1998; 252: 743–6 9 Shen BQ, Lee DY, Zioncheck TF. Vascular endothelial growth factor governs endothelial nitric-oxide synthase expression via a KDR/Flk-1 receptor and a protein kinase C signaling pathway. J Biol Chem 1999; 274: 33057–63 10 Ignarro LJ, Bush PA, Buga GM, Wood KS, Fukuto JM, Rajfer J. Nitric oxide and cyclic GMP formation upon electrical field stimulation cause relaxation of corpus cavernosum smooth muscle. Biochem Biophys Res Commun 1990; 170: 843–50 11 Burnett AL, Lowenstein CJ, Bredt DS, Chang TS, Snyder SH. Nitric oxide. a physiologic mediator of penile erection. Science 1992; 257: 401–3 12 Burnett AL. Nitric oxide control of lower genitourinary tract functions: a review. Urology 1995; 45: 1071–83 13 Sullivan ME, Thompson CS, Dashwood MR et al. Nitric oxide and penile erection: is erectile dysfunction another manifestation of vascular disease? Cardiovasc Res 1999; 43: 658–65 14 Burnett AL, Tillman SL, Chang TS et al. Immunohistochemical localization of nitric oxide synthase in the autonomic innervation of the human penis. J Urol 1993; 150: 73–6 15 Rajasekaran M, Mondal D, Agrawal K, Chen IL, Hellstrom W, Sikka S. Ex vivo expression of nitric oxide synthase isoforms (eNOS/iNOS) and calmodulin in human penile cavernosal cells. J Urol 1998; 160: 2210–5 16 Bloch W, Klotz T, Sedlaczek P, Zumb E`J, Engelmann U, Addicks K. Evidence for the involvement of endothelial nitric oxide synthase from smooth muscle cells in the erectile function of the human corpus cavernosum. Urol Res 1998; 26: 129–35 17 Lin C-S, Lau A, Bakircioglu ME et al. Analysis of neuronal nitric oxide synthase isoform expression and identification of human nNOS-m. Biochem Biophys Res Commun 1998; 253: 388–94 18 Feng Y, Venema VJ, Venema RC, Tsai N, Behzadian MA, Caldwell RB. VEGF-induced permeability increase is mediated by caveolae. Invest Ophthalmol Vis Sci 1999; 40: 157–67 19 Tilton RG, Chang KC, LeJeune WS, Stephan CC, Brock TA, Williamson JR. Role for nitric oxide in the hyperpermeability and hemodynamic changes induced by intravenous VEGF. Invest Ophthalmol Vis Sci 1999; 40: 689–96 20 Chang YS, Munn LL, Hillsley MV et al. Effect of vascular endothelial growth factor on cultured endothelial cell monolayer transport properties. Microvasc Res 2000; 59: 265–77 21 Murohara T, Asahara T, Silver M et al. Nitric oxide synthase modulates angiogenesis in response to tissue ischemia. J Clin Invest 1998; 101: 2567–78 22 Fukumura D, Gohongi T, Kadambi A et al. Predominant role of endothelial nitric oxide synthase in vascular endothelial growth factor-induced angiogenesis and vascular permeability. Proc Natl Acad Sci USA 2001; 98: 2604–9

960

C.-S. LIN et al.

23 Hecker M, Cattaruzza M, Wagner AH. Regulation of inducible nitric oxide synthase gene expression in vascular smooth muscle cells. General Pharmacol 1999; 32: 9–16

Authors

L. Nunes, Research Associate. T.F. Lue, Professor. Correspondence: C.-S. Lin, Knuppe Molecular Urology Laboratory, Department of Urology, School of Medicine, University of California, San Francisco, CA 94143–1695, USA. e-mail: [email protected]

C.-S. Lin, Associate Professor. H.-C. Ho, Postdoctoral Fellow. K.-C. Chen, Postdoctoral Fellow. G. Lin, Postdoctoral Fellow.

Abbreviations: VEGF, vascular endothelial growth factor; NOS, nitric oxide synthase; ICP, intracavernosal pressure

#

2002 BJU International 89, 955–960