Blackwell Science, LtdOxford, UKEMIEnvironmental Microbiology 1462-2912Society for Applied Microbiology and Blackwell Publishing Ltd, 20057913391348Original ArticleAcinetobacter-based salicylate biosensorsW. E. Huang et al.

Environmental Microbiology (2005) 7(9), 1339–1348

doi:10.1111/j.1462-2920.2005.00821.x

Chromosomally located gene fusions constructed in Acinetobacter sp. ADP1 for the detection of salicylate Wei E. Huang,1,2 Hui Wang,3 Hongjun Zheng,3 Linfeng Huang,3 Andrew C. Singer,2 Ian Thompson2 and Andrew S. Whiteley1* 1 Molecular Microbial Ecology, 2Environmental Biotechnology and 3Plant Virology Sections, CEH-Oxford, Mansfield Road, Oxford OX1 3SR, UK. Summary Acinetobacter sp. ADP1 is a common soil-associated bacterium with high natural competency, allowing it to efficiently integrate foreign DNA fragments into its chromosome. This property was exploited to engineer salicylate-inducible luxCDABE and green fluorescent protein (GFP) variants of Acinetobacter sp. ADP1. Specifically, Acinetobacter sp. ADPWH_lux displayed the higher sensitivity when comparing the two variants (minimum detection c. 0.5–1 mM salicylate) and a faster turnover of the lux marker gene, making it suitable for whole-cell luminescence assays of salicylate concentration. In contrast, the longer maturation and turnover times of the GFP protein make the Acinetobacter sp. ADPWH_gfp variant more suited to applications involving whole-cell imaging of the presence of salicylate. The sensitivity of the luxCDABE variant was demonstrated by assaying salicylate production in naphthalene-degrading cultures. Assays using ADPWH_lux specifically mapped the kinetics of salicylate production from naphthalene and were similar to that observed by high-performance liquid chromatography (HPLC) data. However, ADPWH_lux exhibited the higher sensitivity, when compared with HPLC, for detecting salicylate production during the first 24 h of naphthalene metabolism. These data demonstrate that the engineered Acinetobacter variants have significant potential for salicylate detection strategies in laboratory and field studies, especially in scenarios where genetic stability of the construct is required for in situ monitoring.

Received 11 November, 2004; accepted 15 March, 2005. *For correspondence. E-mail [email protected]; Tel. (+44) 1865 281630; Fax (+44) 1865 281696.

© 2005 Society for Applied Microbiology and Blackwell Publishing Ltd

Introduction Naphthalene, phenanthrene and anthracene are members of the class of polycyclic aromatic hydrocarbons (PAHs), designated as priority pollutants, and which are frequently identified in contaminated sites. Their aerobic biodegradation pathways pass through salicylate (Yen and Serdar, 1988; Harwood and Parales, 1996; Johri et al., 1999), which in turn induces the degradation of the parent compound (Chen and Aitken, 1999; Loh and Yu, 2000). Previous studies suggest secondary plant metabolites such as salicylate may provide a range of compounds capable of inducing PAH pollutant-degrading pathways (Singer et al., 2003). Salicylate is also an important signalling compound in plants, inducing systemic acquired resistance (SAR) against pathogens (Malamy et al., 1990; Gaffney et al., 1993; Delaney et al., 1994). In this article, we present Acinetobacter-based biosensors that specifically respond to salicylate and demonstrate their sensitivity, specificity and application during naphthalene degradation. Bacterial-based biosensors with inducible reporter gene fusions have been demonstrated for the detection of specific chemicals and monitoring of bioavailability in natural environments (Errampalli et al., 1999; Daunert et al., 2000; Leveau and Lindow, 2002; Belkin, 2003; Jansson, 2003). The most commonly used reporter genes are green fluorescent protein (GFP), originally from the jellyfish Aequorea victoria (Tsien, 1998; Lippincott-Schwartz and Patterson, 2003), and bioluminescent genes (luxCDABE) from at least three bacterial genera (Photobacterium, Vibrio and Photorhabdus; Meighen, 1994; Wilson and Hastings, 1998). Many studies have utilized recombinant methods where reporter genes are fused to the promoters of degradation genes (Applegate et al., 1998; Willardson et al., 1998; Stiner and Halverson, 2002). This approach facilitates the identification of user-defined compounds for a variety of matrices, such as biofilms (Moller et al., 1998), contaminated water, plant and soil research (Belkin, 2003). King and colleagues (1990) constructed the first naphthalene and salicyclate responsive biosensor using a plasmid-based luxCDABE gene fusion derived from the NAH7 plasmid of Pseudomonas fluorescens. This sensing reagent subsequently found widespread use in laboratory and field detection systems indicating the utility of the

1340 W. E. Huang et al. plasmid-based reporter systems to provide good sensing capabilities. However, the realization of the need for genetic containment of recombinant constructs, especially in field monitoring scenarios of contaminated sites, has led to the increased interest in chromosomal engineering of gene fusions. However, chromosomal integration of gene fusions has been shown to be more technically demanding than plasmid-based constructs due to the requirement for homologous genetic modification systems (e.g. the Tn systems), which tend to be group specific and not applicable to all organisms. Moreover, appropriate intermediate hosts (e.g. Lambda PIR hosts for the Tn5 systems) for subcloning are required before transfer by bior triparental mating to specific hosts. In terms of rapid and simple chromosome engineering of gene fusions we selected Acinetobacter sp. ADP1 (also designated as BD413) as a potential host. Acinetobacter sp. ADP1 in naturally widespread in the environment and has an extremely high natural competency. It is capable of taking up and integrating diverse sources of DNA into the chromosome with little discrimination (Palmen et al., 1993; Dubnau, 1999). Specifically, Acinetobacter sp. ADP1 integrates foreign DNA into the chromosome with a high efficiency, requiring only a homologous region greater than 183 base pairs for recombination (de Vries and Wackernagel, 2002). Further, the presence of a salicylate-degrading operon (Jones et al., 2000) within the host enables Acinetobacter sp. ADP1 to grow on salicylate, while also providing the required homology for integration of recombinant gene fusions in order to generate salicylate responsive biosensor constructs. It must be noted, however, that the salicylate degradation pathway in ADP1 (Jones et al., 2000) is very different from that observed in other systems, such as the classical NAH7 system (Cebolla et al., 1997), and hence these sensors may also provide good comparative data for the operation of similar pathways which are regulated by different operon structures. In this article, we demonstrate the utility of Acinetobacter as a chromosomal engineering host through the rapid and simple construction of gene fusions which are specifically induced in the presence of salicylate. We engineered both luxCDABE and green fluorescent protein (GFP) into the inducible salicylate operon in the chromosome of Acinetobacter sp. ADP1, and characterize their sensitivity and specificity to the target compound.

Results and discussion Construction of chromosomal-based GFP and lux Acinetobacter sp. reporters for salicylate Promoterless GFP and luxCDABE were excised from pRMJ2 and pSB417, respectively, and were inserted as

an EcoR1 fragment into a recombinant partial salA/salR fragment harbouring an engineered EcoRI site (Fig. 1). Partial salA/salR fragments with EcoR1 sites were constructed using Acinetobacter strain ADP1 chromosomal DNA as the template and overlap extension polymerase chain reaction (PCR) protocols (Fig. 1) and cloned into pGEM-T vectors. Green fluorescent protein or luxCDABE were cloned into separate pGEM-T vectors harbouring these partial salA/salR constructs and the resulting plasmids were designated pSalAR_gfp and pSalAR_lux (Fig. 1) and transformed into Acinetobacter ADPW67 (Fig. 2). Acinetobacter strain ADPW67 harboured a kanamycin-disrupted salA copy and therefore the recombinant partial salA/salR fragment in the transfer plasmids allowed homologous recombination in a single step, utilizing the kanamycin-disrupted salA chromosomal copy as the cross-over region (Fig. 2). This single step produced two events: the restoration of salA in the parent chromosome and a concomitant insertion of non-homologous GFP or luxCDABE. Homologous recombination restored the parent strain’s ability to utilize salicylate and was used as the selection criteria for transformants. Simultaneously, GFP and luxCDABE fragments in plasmids pSalAR_gfp or pSalAR_lux were inserted between salA and salR (Fig. 2). The selected transformants were able to grow on salicylate and also expressed GFP or bioluminescence due to restored salA expression, and were designated ADPWH_gfp and ADPWH_lux, for GFP- and luxexpressing strains respectively. To confirm GFP and luxCDABE integration to the chromosome of Acinetobacter sp. ADP1, eight colonies were randomly chosen for each strain and PCR reactions were performed using a chromosomal flanking primer and an internal GFP or luxCDABE construct primer. Specifically, the chromosomal flanking primer salAR_rev_out was used in conjunction with either salAR_fwd (GFP transformants) or luxE_fwd (luxCDABE transformants) (Fig. 2 and Table 2). The presence of a PCR product from these reactions presumptively indicated a chromosomal integration for the constructs, which was subsequently confirmed by sequencing the PCR products to demonstrate the chromosomal/construct junction (data not shown). These data indicated the ease with which naked foreign DNA fragments could be inserted into the chromosome of Acinetobacter sp. ADP1 by homologous recombination events. The transfer frequency is dependent on the length of homologous DNA present in the construct and non-homologous insert length (de Vries and Wackernagel, 2002). In this study, the transfer efficiency was approximately 10-4 to insert GFP (about 900 bp) and 10-6 for luxCDABE (about 5800 bp) transformants, highlighting a lower efficiency for larger marker gene constructs.

© 2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 7, 1339–1348

Acinetobacter-based salicylate biosensors 1341

A

EcoR1/BamH1

salAR_BE_fwd salA_fwd_out

Partial salR

salA

Acinetobacter genomic DNA salAR_rev

salAR_BE_rev EcoR1/BamH1

B EcoR1/BamH1

salA_fwd_out

EcoR1/BamH1

salAR_rev

C A

A EcoR1/BamH1

Not l Pst l Sal l

D

Nde l

Sal l

E

Nde l

Pst l

Not l

Sac l

Sac l salA

pGEM-T 3000 bp

pSalAR_BE 5049 bp

Amp

Eco RI Bam HI partial salR

Amp

luxCDABE from pSB417 Nde l

Sal l

gfp from pRMJ2

Pst l Not l

Sac l

Nde l

Sal l

Pst l Not l

Sac l

F

EcoRl salA

G

Amp

salA EcoRI luxC BamHl

Amp

pSalAR_lux 10891 bp

pSalAR_gfp 5949 bp luxD

partial salR

Sal l Xba l promotless GFP Not l

Pst l luxE

Sal l EcoR l

luxA

partial salR

luxB

EcoRl

BamH l BamHl

Fig. 1. Construction of plasmids pSalAR_lux and pSalAR_gfp. A–C. Schematic diagram of the creation of the fused salAR fragment harbouring EcoRI and BamHI sites by overlap extension PCR. D and E. Creation of pSalAR_BE by insertion of salAR fragment into pGEM-T. F. Generation of pSalAR_lux by introducing luxCDABE into the EcoRI site of pSalAR_BE. G. Generation of pSalAR_gfp by introducing the GFP fragment into the EcoRI site of pSalAR_BE. Note the maps are not to scale.

© 2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 7, 1339–1348

1342 W. E. Huang et al. GFP or luxCDABE

salA

EcoRI

EcoRI

Km

salA

Partial salR

pSalAR_gfp or pSalAR_lux

BamHI

Fig. 2. Schematic representation of the integration of salAR carrying promoterless GFP or luxCDABE into the chromosome of Acinetobacter sp. ADPW67. SalA fragments from pSalAR_gfp or pSalAR_lux restored the disrupted salA gene in ADPW67 by homologous recombination with the kanamycin-disrupted salA copy in the parent chromosome.

Whole salR Acinetobacter sp. ADPW67

ClaI

GFP or luxCDABE

salA

EcoRI

salAR_fwd

Plasmid

whole salR

EcoRI

Acinetobacter sp. ADPWH_gfp or ADPWH_lux

BamHI

salAR_rev_out

luxE_fwd

Chromosome

Kinetics of salicylate induction for ADPWH_gfp and ADPWH_lux Acinetobacter strain ADPWH_lux growth curve data indicated that lux expression was not induced in standard Luria–Bertani (LB) growth media (Fig. 3A), but strong induction of luminescence was observed within the first few minutes of subculturing to LB containing 100 mM salicylate. Salicylate-induced lux expression peaked at 3 h during mid-exponential growth (Fig. 3B) and subsequently declined after 4 h of growth, demonstrating turnover of the lux protein and reduced salA induction as salicylate was degraded by the parent strain. In contrast, salicylateinduced GFP expression continued throughout the growth curve in LB containing 100 mM salicylate and peaked at 24 h (Fig. 3D), indicating a less sensitive response for the GFP variant, more than likely associated with the requirements for GFP maturation and long half-life once the protein is formed (Tsien, 1998; Errampalli et al., 1999). Uninduced controls for strain ADPWH_gfp exhibited a small amount of background GFP expression (approximately one-third of the induced cultures; Fig. 3C), suggesting again that the long half-life of GFP allows some of the protein to accumulate in the cell via background uninduced expression of salA. The rapid and sensitive

response of ADPWH_lux suggests it is suitable as a ‘realtime’ salicylate biosensor through whole-cell luminescence assay. In contrast, the GFP variant is better suited to in situ microscopic visualization of salicylate presence due to signal accumulation via longer turnover times of the GFP protein. Alternatively, more sensitive responses for salicylate-induced GFP expression and whole-cell imaging could be obtained by replacing the stable GFP with shorter half-life variants (Andersen et al., 1998).

Salicylate concentration and salA induction relationship for Acinetobacter sp. ADPWH_lux and ADPWH_gfp Salicylate concentration and salA expression relationships were derived for both lux- and GFP-based Acinetobacter biosensors (Fig. 4). In general, ADPWH_lux exhibited a linear increase in lux expression for concentrations of salicylate between 1 mM and 100 mM. Above 100 mM salicylate the salA promoter response was saturated and no concomitant increase in lux expression occurred. In contrast, accumulation of GFP through background expression for ADPWH_gfp caused little dynamic response of GFP induction between 1 mM and 10 mM salicylate, with concentrations between 10 mM and 100 mM

© 2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 7, 1339–1348

Acinetobacter-based salicylate biosensors 1343 SalA expression specificity for salicylate and its analogues

20000

The induction of bioluminescence in Acinetobacter sp. strains ADPWH_lux and ADPWH_gfp was assessed against salicylate and five structural analogues [4-hydroxybenzoic acid (4HBA); 3-hydroxybenzoic acid (3HBA); benzoate; catechol and acetylsalicylic acid (aspirin)] to test the specificity of salA induction (Fig. 5). The responses for both strains were identical, but for brevity, only these data for ADPWH_lux are discussed after a 2 h induction. For ADPWH_lux, inducer concentrations in the range of 50 pM to 50 mM were tested, a range that was found not to affect the growth of the strains (W.E. Huang, unpubl. obs.). Specifically, low levels of induction were found to occur at 0.5 mM salicylate, with a threefo ld in crease in expression being observed at 5 mM, reinforcing the lower range of operational sensitivity of around 1 mM, as observed above. Increasing the concentrations logarithmically for all analogues indicated strong induction only in the presence of salicylate up to 500 mM, and a subsequent decrease in response between 500 mM and 5 mM (Fig. 5). However, for the analogues two exceptions to this occurred. Acetylsalicyclic acid (aspirin) induced salA expression at a level approximately one-third of that observed for salicylate induction, and occurred between inducer concentrations of 5 mM and 5 mM (Fig. 5). Second, benzoate and catechol also induced bioluminescence, but only at a concentration of 5 mM (Fig. 5). For catechol, this result is at odds with the NAH7 system, where an absolute requirement for a carboxyl group exists (Cebolla et al., 1997). Significantly, 4HBA and 3HBA did not induce bioluminescence even though they are positional isomers of salicylic acid. Despite the structural similarities between salicylate, 3HBA and 4HBA, their degradation are regulated by different genes in Acinetobacter sp. ADP1 (Collier

0 1

2

4

6

8

0 10 25000

B

20000 15000

- -

0.1

5000

Luminescence cell–1 (AU)

ADPWH_lux

- -

10000

GFP fluorescence cell–1 (AU)

15000

10000

OD600nm (- -)

ADPWH_lux + salicylate 0.1 0

2

4

6

8

1

5000 0 10 1000

C

ADPWH_gfp

750 500 250

0.1 0

6

12

18

0 24 1000

1

D

750 500

ADPWH_gfp + salicylate 0.1 0

6

12 Time (h)

18

250 0 24

Fig. 3. Bioluminescence and green fluorescent protein (GFP) expression in Acinetobacter sp. ADPWH_lux and ADPWH_gfp induced by 100 mM salicylate in LB. Bioluminescence and OD600 of Acinetobacter ADPWH_lux in the absence (A) and in the presence (B) of salicylate. Green fluorescent protein expression and OD600 of Acinetobacter ADPWH_gfp in the absence (C) and in the presence (D) of salicylate. Error bars represent one standard deviation of the mean (n = 3).

40 000

900

35 000 30 000 600

25 000 20 000 15 000

300

10 000 5 000 0 1

10

100

0 1000

GFP fluorescence cell–1 (AU) - -

A

25000

Luminescence cell–1 (AU) - -

1

Salicylate concentration (µM)

causing an increase in expression of GFP (Fig. 4), reinforcing the conclusion that the lux-based sensor was the more sensitive strain for determining salicylate concentration in the range of 1–100 mM.

Fig. 4. Bioluminescence and GFP expression in Acinetobacter sp. ADPWH_lux and ADPWH_gfp induced by a range of salicylate concentrations in LB after 2 h of induction. Error bars represent one standard deviation of the mean (n = 3).

© 2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 7, 1339–1348

1344 W. E. Huang et al. Salicylic acid

4-HBA O C

O C ONa OH

Benzoate O

O C OH

OH

Acetylsalicylic acid

Catechol

C

ONa

O

OH OH

C OH

O CH3 C O

OH

OH

4000

Luminescence cell–1 (AU)

3-HBA

3500

Fig. 5. Bioluminescence expression in Acinetobacter sp. ADPWH_lux induced by salicylate and five structurally similar analogues. Luminescence measurements were taken after 2 h of induction in LB containing salicylate or its analogues at concentrations ranging between 50 pM and 50 mM. Error bars represent one standard deviation of the mean (n = 3).

3000 2500 2000 1500 1000 500 0 0.05

0.5

5

50

500

50 000

5000

Analogue concentration (mM)

As salicylate is a central metabolite of naphthalene degradation by Pseudonomas putida NCIB9816 an experiment was performed to detect salicylate by ADPWH_lux within a naphthalene-degrading culture of P. putida NCIB9816 (Yen and Serdar, 1988). Jones and colleagues (2000) indicated that the parent strain Acinetobacter sp. ADP1 cannot utilize naphthalene and to confirm this naphthalene concentrations between 1 and 200 mM were

2h

24 h

48 h

10000

10000 1000

-

1000

-

100 100 10 10

1

-

0h

-

Control

ADPWH_lux luminescence cell–1

Applications during naphthalene degradation to demonstrate intermediate metabolite production

exposed to ADPWH_lux and no induction of bioluminescence was observed (data not shown). For P. putida NCIB9816 cultures growing on naphthalene, both high-performance liquid chromatography (HPLC) and ADPWH_lux assays indicated that salicylate was produced during naphthalene degradation (Fig. 6). Over a 48 h period, the bioluminescence of ADPWH_lux whole-cell assays increased, with salicylate being

Salicylate concentration by HPLC (mM)

et al., 1998; Jones et al., 1999; Brzostowicz et al., 2003; Parke and Ornston, 2003). Hence, the salicylate operon should not be induced by 3HBA and 4HBA, and these data confirm this observation. It remains unclear as to the cause for the induction by aspirin, other than the presence of a carboxyl group, but this did not cause induction from many of the other analogue compounds containing it (e.g. 4HBA or 3HBA). However, true induction by acetylsalicyclic acid was observed for the NAH7 system (Cebolla et al., 1997) where intermediate metabolite production (e.g. salicylate) was blocked, suggesting that some common mechanisms may be acting with regard to this compound, despite different salicylate pathways. However, for future uses of the sensors, the presence of such compounds at the required concentration in samples where salicylate detection would be performed would more than likely be negligible, and hence should not interfere with the specificity of the developed sensors.

1

0.1 0

20

40

60

Time (h)

Fig. 6. Acinetobacter sp. ADPWH_lux detection of salicylate in cellfree extracts during Pseudomonas putida NCIB9816 degradation of naphthalene. Filled symbols represent the luminescence per cell (AU) produced after a 90 min incubation of the cell-free extracts with ADPWH_lux, and represented visually in the composite image. The open symbols represent the absolute concentration of salicylate as measured by HPLC. Error bars represent one standard deviation of the mean (n = 2).

© 2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 7, 1339–1348

Acinetobacter-based salicylate biosensors 1345 detected in the water phase by ADPWH_lux within 4 h. As we concentrated on salicylate induction of the gene fusions, and our previous data indicated napthalene degradation intermediates such as catechol did not induce the sensor unless at unrealistically high concentrations, we specifically measured only the key inducer, salicylate, in the degrading cultures by HPLC. While this may not fully map the degradation kinetics of naphthalene and its intermediates, we still observed discrepancies between the sensor induction and those measures by HPLC. Specifically, the HPLC data indicated only appreciable salicylate being formed after 20 h, indicating that the whole-cell assay was more sensitive to the production of salicylate than the HPLC method during the early stages of naphthalene degradation. Further, these data suggested an accumulation of salicylate in the water phase over 48 h, indicating that the salicylate production pathway from naphthalene is probably acting faster than the salicylate breakdown pathway (Yen and Serdar, 1988). As salicylate is an intermediate metabolite for many poly-ring hydrocarbon degradation pathways (Yen and Serdar, 1988; Harwood and Parales, 1996; Johri et al., 1999), these data suggest that rapid and specific salicylate detection using biosensors such as ADPWH_lux could be used as a good indicator of the activity of such degradation pathways in complex degrading systems. However, as with all gene fusion biosensors, rigorous calibration of the sensor’s response to more complex pollutant mixtures and intermediates is required before deploying such reagents to complex in situ sensing modes.

Experimental procedures Bacterial strains, plasmids and culture media The bacterial strains and plasmids used in this study are listed in Table 1. Unless otherwise stated all chemicals were Analar grade reagents. Luria–Bertani medium (Oxoid) was used for general cultivation of bacteria, induction and analogue studies. However, minimal medium (MM) was used for the selection of transformants. Minimal medium was prepared containing the following (l-1): Na2HPO4: 3.0 g; KH2PO4: 3.0 g; NH4Cl: 1.0 g; MgSO4·7H2O: 0.5 g; saturated CaCl2 and FeSO4 solution: 3–5 drops. Salicylate agar (SAA) medium was prepared using 2.5 mM salicylate (sodium salt) as a sole carbon source and solidified within 1.4% noble agar containing MM. Where appropriate, ampicillin and kanamycin were used at a final concentration of 100 and 50 mg ml-1, respectively, for Escherichia coli and kanamycin at 10 mg ml-1 for Acinetobacter sp.

General PCR amplification reagents Primers were purchased from MWG Biotech and are listed in Table 2. Polymerase chain reaction amplifications were carried out in 50 ml reactions containing 1¥ reaction buffer, 200 mM of each deoxynucleoside triphosphate (Bioline), 0.5 mM of each primer, 1–2 unit Taq DNA polymerase (Sigma).

Overlap extension PCR to create salAR fusions with required restriction sites EcoRI and BamHI restriction sites were created between salA and partial salR fragments by overlap extension PCR

Table 1. Bacterial strains and plasmids used in this study. Bacterial strains

Description

Reference

Acinetobacter ADP1(BD413)

Wild type

Acinetobacter ADPW67

SalA::Kmr, Km gene is inserted into ClaI site of salA

Juni and Janik (1969) Jones et al. (2000)

Acinetobacter ADPWH_lux

luxCDABE (~5.8 kb) gene inserted between salA and salR, obtained by transformation of ADPW67 with pSalAR_lux

This study

Acinetobacter ADPWH_gfp

GFP gene inserted between salA and salR, obtained by transformation of ADPW67 with pSalAR_gfp

This study

E. coli JM109

High-efficiency competent cells

Promega

Pseudonomas putida NCIB9816

Wild type

Cane and Williams (1982)

pGEM-T

Ampr, T7 and SP6 promoters, lacZ, vector

pRMJ2

Source plasmid for GFP gene. Promoterless GFP gene (~900 bp) was cloned in pRMJ1 and replaced sacB

Promega Jones and Williams (2003)

pSB417

luxCDABE source plasmid containing luxCDABE from Photorhabdus (Xenorhabdus) luminescens ATCC2999

Winson et al. (1998)

pSalAR_BE

Whole salA and partial salR fragment cloned into pGEM-T. EcoRI and BamHI sites located between salA and salR

This study

pSalAR_lux

luxCDABE (5846 bp) inserted into EcoRI site created between salA and salR of pSalAR_BE

This study

pSalAR_gfp

GFP inserted into EcoRI site created between salA and salR of pSalAR_BE

This study

Plasmids

© 2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 7, 1339–1348

1346 W. E. Huang et al. Table 2. Primers used in this study. Primers

Sequence (5¢ Æ 3¢)

salA_fwd_out salAR_BE_fwd salAR_BE_rev salAR_fwd salAR_rev luxE_fwd salAR_rev_out

CTCAAAGGAAATGAGTCGTGGGTA CGCTAAGAATTCGGATCCAGAGTGTTTTGA TCAAAACACTCTGGATCCGAATTCTTAGCG CAGGACTGGAGCGAAAGCTG GACCTGAGTATGCCCGGTAG TGGTTTACCAGTAGCGGCACG GCCCTCAGGTAATGGCGACTA

(Fig. 1) using a small amount of Acinetobacter sp. ADP1 bacterial colony (0.1–0.25 ml) as the template in the PCR reaction. Polymerase chain reaction amplifications were performed with initial denaturation at 95∞C for 5 min, followed by 35 cycles of 94∞C for 1 min, 50∞C for 1 min and 72∞C for 2 min, and a final additional 72∞C for 10 min extension. SalA and partial salR fragments were separately amplified by colony PCR using the primer pairs salA_fwd_out– salAR_BE_rev and salAR_BE_fwd–salAR_rev (Table 2). Polymerase chain reaction products were isolated from a 1% agarose gel and purified according to the manufacturer’s instructions using a QIAquick gel extraction kit (Qiagen). To fuse salA and salR fragments, a PCR amplification (using the same reaction conditions above) was carried out containing 1 ml of 1:100 diluted salA (1314 bp) and partial salR (735 bp) fragments and primers salA_fwd_out and salAR_rev.

Note Created EcoRI and BamHI sites Created EcoRI and BamHI sites

Internal to luxE gene Chromosomal flanking primer

Chromosomal integration of lux and GFP gene of Acinetobacter sp. Preparation of competent cells of Acinetobacter sp. ADP1 was performed as described previously (Palmen et al., 1993). Acinetobacter sp. strain ADPW67 served as the recipient and was grown in 5 ml of LB (containing 10 mg ml-1 kanamycin) at 30∞C overnight, with 200 r.p.m. shaking. Two hundred microlitres of culture were then diluted into 5 ml of fresh LB medium and incubated for 2 h to make the cells competent. For transformation, 5 ml of the plasmid pSalAR_gfp or pSalAR_lux was added to 0.5 ml of competent cells (109 cells ml-1) and the cells were incubated for 2 h. The cultures were subsequently plated onto SAA medium for selection of transformants which has restored the salicylate degradation function.

Polymerase chain reaction to test Acinetobacter sp. mutants

Plasmid construction Standard molecular techniques were performed as previously described (Sambrook et al., 1989). Fused salAR fragments containing EcoRI and BamHI restriction sites were ligated into pGEM-T (Promega), and subsequently transformed into E. coli JM109. After transformation, cells were selected on LB containing 100 mg ml-1 ampicillin and 2 mM salicylate. Plasmids containing salAR insertions displayed the salA phenotype, which encodes salicylate hydroxylase, turning salicylate into catechol, generating brown halos around the colonies. These colonies were subsequently selected and the salA/salR fusion containing plasmids designated as pSalAR_BE. Green fluorescent protein and luxCDABE fragments were excised from pRMJ2 (generously donated by Dr Rheinallt M. Jones) and pSB417 (generously donated by Dr Mike Winson) by EcoRI digestion and subsequently gel purified (Qiagen). The digested GFP and luxCDABE fragments were ligated into pSalAR_BE as an EcoR1 fragment. Ligated products were transformed into E. coli JM109 and plated onto LB containing 100 mg ml-1 ampicillin and 2 mM salicylate. Colonies expressing salicylate hydroxylase together with GFP or lux were chosen and their plasmids designated as pSalAR_gfp and pSalAR_lux respectively. To confirm the construction, plasmids pSalAR_BE, pSalAR_gfp and pSalAR_lux were purified (Qiagen), and were sequenced around the sites of insertion by SP6/T7 promoter primers and salAR_fwd/salAR_rev primers (Table 2).

To confirm the integration of GFP gene and luxCDABE genes to the chromosome of Acinetobacter sp. ADP1, PCR amplifications using salAR_fwd and salAR_rev_out for ADPWH_gfp and luxE_for and salAR_rev_out (Table 2) for ADPWH_lux were carried out (Fig. 2). Polymerase chain reaction amplifications were performed with initial denaturation at 95∞C for 5 min, following 35 cycles of 95∞C for 1 min, 60∞C for 1 min and 72∞C for 2 min 30 s, and then additional 72∞C for 10 min to finish extension. After amplification, PCR products were run on a 1% agarose gel, band purified (Qiagen) and sequenced.

Kinetic analysis GFP fluorescence and bioluminescence induced by salicylate Green fluorescent protein (GFP) fluorescence, bioluminescence and OD600 of Acinetobacter sp. strains ADPWH_gfp and ADPWH_lux were measured using a Synergy HT MultiDetection Microplate Reader (Bio-Tek). For growth curve, induction and analogue studies, overnight cultures for each strain were diluted in LB to 1:20 and incubated at 37∞C for 2 h with 150 r.p.m. shaking. Subsequently, triplicate cultures of ADPWH_gfp or ADPWH_lux were initiated containing a range of concentrations of salicylate or its analogues, at 37∞C with 150 r.p.m. shaking. At specific time points, 200 ml of each culture was placed in a 96-well microplate and samples were immediately measured. Relative fluorescence intensity of

© 2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 7, 1339–1348

Acinetobacter-based salicylate biosensors 1347 GFP and bioluminescence was obtained by dividing by the OD600, to allow normalization. For GFP fluorescence measurements, the Synergy HT Multi-Detection Microplate Reader was set at an excitation wavelength of 480 nm and an emission detection at 520 nm.

Acknowledgements We thank Dr Michael Winson for providing pSB417 and associated information, Professor Peter Williams and Dr Rheinallt M. Jones for providing plasmid pRMJ2, Acinetobacter sp. ADPW67 and P. putida NCIB9816.

Detection of analogues of salicylic acid References To test the specificity of the biosensors, Acinetobacter sp. strains ADPWH_gfp and ADPWH_lux were used to detect a series of concentrations of five analogues of salicylic acid. On the basis of their chemical structures and properties, 4hydroxybenzoic acid, 3-hydroxybenzoic acid, benzoate, catechol and acetylsalicylic acid (aspirin) were chosen for testing.

Nucleotide sequencing and sequence analysis All DNA samples (PCR products or plasmids) were sequenced using dye terminator sequencing on an Applied Biosystems 3730 DNA analyser according to the manufacturer’s instructions. DNA sequence analysis was carried out using BLASTN for confirmation of sequence homology and these data were aligned and edited using BIOEDIT to confirm correct insertions (Tom Hall, Department of Microbiology, North Carolina State University).

Acinetobacter sp. ADPWH_lux and HPLC determination of salicylate production in naphthalene-degrading samples To test the utility of the constructed biosensor in complexdegrading scenarios, the kinetics of salicylate production in the water phase of extracts from naphthalene-degrading cultures was tested. Pseudomonas putida NCIB9816 (kindly provided by Professor Peter Williams) was inoculated into replicate 30 ml universal tubes containing 5 ml of MM medium and 1 mg of naphthalene and incubated at 30∞C with 150 r.p.m. shaking. At discreet intervals over 48 h, 100 ml of each culture was removed and clarified by passing through a 0.2 mm filter. Acinetobacter sp. ADPWH_lux cells were diluted in fresh LB (1:20) after overnight growth at 37∞C with 150 r.p.m. shaking. The cells were then incubated for 2–3 h before performing the detection assays, with a final bacterial density in all cases of 109 ml-1. Fifty microlitres of Acinetobacter sp. ADPWH_lux were added to 50 ml of the clarified extract obtained above, and the amount of salicylate in the water phase was measured by the relative increase in bioluminescence, versus salicylate free controls, after 90 min at 37∞C. In tandem, absolute salicylate concentrations were monitored by HPLC. Cell-free supernatants obtained above were analysed on a Dionex liquid chromatograph (Camberley, UK) equipped with a diode array detector with a Phenomenex C18 column (250 mm ¥ 3.25 mm, particle diameter 5 mm) and appropriate standards for salicylate-specific calibration. An isocratic program was applied with a mobile phase containing 30% acetonitrile and 2% orthophosphate.

Andersen, J.B., Sternberg, C., Poulsen, L.K., Bjørn, S.P., Givskov, M., and Molin, S. (1998) New unstable variants of green fluorescent protein for studies of transient gene expression in bacteria. Appl Environ Microbiol 64: 2240– 2246. Applegate, B.M., Kehrmeyer, S.R., and Sayler, G.S. (1998) A chromosomally based tod-luxCDABE whole-cell reporter for benzene, toluene, ethybenzene, and xylene (BTEX) sensing. Appl Environ Microbiol 64: 2730–2735. Belkin, S. (2003) Microbial whole-cell sensing systems of environmental pollutants. Curr Opin Microbiol 6: 206– 212. Brzostowicz, P.C., Reams, A.B., Clark, T.J., and Neidle, E.L. (2003) Transcriptional cross-regulation of the catechol and protocatechuate branches of the beta-ketoadipate pathway contributes to carbon source-dependent expression of the Acinetobacter sp. strain ADP1 pobA gene. Appl Environ Microbiol 69: 1598–1606. Cane, P.A., and Williams, P.A. (1982) The plasmid-coded metabolism of naphthalene and 2-methylnaphthalene in Pseudomonas strains – phenotypic changes correlated with structural modification of the plasmid Pww60-1. J Gen Microbiol 128: 2281–2290. Cebolla, A., Sousa, C., and deLorenzo, V. (1997) Effector specificity mutants of the transcriptional activator NahR of naphthalene degrading Pseudomonas define protein sites involved in binding of aromatic inducers. J Biol Chem 272: 3986–3992. Chen, S.H., and Aitken, M.D. (1999) Salicylate stimulates the degradation of high molecular weight polycyclic aromatic hydrocarbons by Pseudomonas saccharophila P15. Environ Sci Technol 33: 435–439. Collier, L.S., Gaines, G.L., and Neidle, E.L. (1998) Regulation of benzoate degradation in Acinetobacter sp. strain ADP1 by BenM, a LysR-Type transcriptional activator. J Bacteriol 180: 2493–2501. Daunert, S., Barrett, G., Feliciano, J.S., Shetty, R.S., Shrestha, S., and Smith-Spencer, W. (2000) Genetically engineered whole-cell sensing systems: coupling biological recognition with reporter genes. Chem Rev 100: 2705– 2738. Delaney, T.P., Uknes, S., Vernooij, B., Friedrich, L., Weymann, K., Negrotto, D., et al. (1994) A central role of salicylic acid in plant disease resistance. Science 266: 1247–1250. Dubnau, D. (1999) DNA uptake in bacteria. Ann Rev Microbiol 53: 217–244. Errampalli, D., Leung, K., Cassidy, M.B., Kostrzynska, M., Blears, M., Lee, H., and Trevors, J.T. (1999) Applications of the green fluorescent protein as a molecular marker in environmental microorganisms. J Microbiol Methods 35: 187–199.

© 2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 7, 1339–1348

1348 W. E. Huang et al. Gaffney, T., Friedrich, L., Vernooij, B., Negrotto, D., Nye, G., Uknes, S., et al. (1993) Requirement of salicylic acid for the induction of systemic acquired resistance. Science 261: 754–756. Harwood, C.S., and Parales, R.E. (1996) The beta-ketoadipate pathway and the biology of self-identity. Ann Rev Microbiol 50: 553–590. Jansson, J.K. (2003) Marker and reporter genes: illuminating tools for environmental microbiologists. Curr Opin Microbiol 6: 310–316. Johri, A.K., Dua, M., Singh, A., Sethunathan, N., and Legge, R.L. (1999) Characterization and regulation of catabolic genes. Crit Rev Microbiol 25: 245–273. Jones, R.M., and Williams, P.A. (2003) Mutational analysis of the critical bases involved in activation of the AreRregulated sigma(54)-dependent promoter in Acinetobacter sp. strain ADP1. Appl Environ Microbiol 69: 5627–5635. Jones, R.M., Collier, L.S., Neidle, E.L., and Williams, P.A. (1999) areABC genes determine the catabolism of aryl esters in Acinetobacter sp. strain ADP1. J Bacteriol 181: 4568–4575. Jones, R.M., Pagmantidis, V., and Williams, P.A. (2000) sal genes determining the catabolism of salicylate esters are part of a supraoperonic cluster of catabolic genes in Acinetobacter sp. strain ADP1. J Bacteriol 182: 2018–2025. Juni, E., and Janik, A. (1969) Transformation of Acinetobacter calcoaceticus (Bacterium anitratum). J Bacteriol 98: 281– 288. King, J.M.H., Digrazia, P.M., Applegate, B., Burlage, R., Sanseverino, J., Dunbar, P., et al. (1990) Rapid, sensitive bioluminescent reporter technology for naphthalene exposure and biodegradation. Science 249: 778–781. Leveau, J.H.J., and Lindow, S.E. (2002) Bioreporters in microbial ecology. Curr Opin Microbiol 5: 259–265. Lippincott-Schwartz, J., and Patterson, G.H. (2003) Development and use of fluorescent protein markers in living cells. Science 300: 87–91. Loh, K.C., and Yu, Y.G. (2000) Kinetics of carbazole degradation by Pseudomonas putida in presence of sodium salicylate. Water Res 34: 4131–4138. Malamy, J., Carr, J.P., Klessig, D.F., and Raskin, I. (1990) Salicylic acid – a likely endogenous signal in the resistance response of tobacco to viral infection. Science 250: 1002– 1004. Meighen, E.A. (1994) Genetics of bacterial bioluminescence. Ann Rev Genet 28: 117–139.

Moller, S., Sternberg, C., Andersen, J.B., Christensen, B.B., Ramos, J.L., Givskov, M., and Molin, S. (1998) In situ gene expression in mixed-culture biofilms: evidence of metabolic interactions between community members. Appl Environ Microbiol 64: 721–732. Palmen, R., Vosman, B., Buijsman, P., Breek, C.K.D., and Hellingwerf, K.J. (1993) Physiological characterization of natural transformation in Acinetobacter calcoaceticus. J Gen Microbiol 139: 295–305. Parke, D., and Ornston, L.N. (2003) Hydroxycinnamate (hca) catabolic genes from Acinetobacter sp. strain ADP1 are repressed by HcaR and are induced by hydroxycinnamoylcoenzyme a thioesters. Appl Environ Microbiol 69: 5398– 5409. Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY USA: Cold Spring Harbor Laboratory. Singer, A.C., Crowley, D.E., and Thompson, I.P. (2003) Secondary plant metabolites in phytoremediation and biotransformation. Trends Biotechnol 21: 123–130. Stiner, L., and Halverson, L.J. (2002) Development and characterization of a green fluorescent protein-based bacterial biosensor for bioavailable toluene and related compounds. Appl Environ Microbiol 68: 1962–1971. Tsien, R.Y. (1998) The green fluorescent protein. Annu Rev Biochem 67: 509–544. de Vries, J., and Wackernagel, W. (2002) Integration of foreign DNA during natural transformation of Acinetobacter sp. by homology-facilitated illegitimate recombination. Proc Natl Acad Sci USA 99: 2094–2099. Willardson, B.M., Wilkins, J.F., Rand, T.A., Schupp, J.M., Hill, K.K., Keim, P., and Jackson, P.J. (1998) Development and testing of a bacterial biosensor for toluene based environmental contaminants. Appl Environ Microbiol 64: 1006– 1012. Wilson, T., and Hastings, J.W. (1998) Bioluminescence. Annu Rev Cell Dev Biol 14: 197–230. Winson, M.K., Swift, S., Hill, P.J., Sims, C.M., Griesmayr, G., Bycroft, B.W., et al. (1998) Engineering the luxCDABE genes from Photorhabdus luminescens to provide a bioluminescent reporter for constitutive and promoter probe plasmids and mini-Tn5 constructs. FEMS Microbiol Lett 163: 193–202. Yen, K.M., and Serdar, C.M. (1988) Genetics of naphthalene catabolism in Pseudomonads. Crit Rev Microbiol 15: 247– 268.

© 2005 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 7, 1339–1348