ABSENCE OF Borrelia burgdorferi SENSU LATO IN Ixodes ricinus FROM WOODLANDS OF CADIZ AND HUELVA PROVINCES (SW SPAIN)

FRANCISCO J.

1

MARQUEZ I ,

I RODRIGUEZ I , PABLO GUERRERO , JOSE E. GRANADOS 2, RAMON C. SORIGUER3 & MIGUEL A. MUNIAIN 4

JOSE J.

Dpto. Biologia Animal, Biologia Vegetal y Ecologia, Area de Zoologta, Universidad de Jaen. Paraje Las Lagunillas sin, 23071 - Jaen, email: [email protected].

2

Parque Nacional de Sierra Nevada, Ctra. Antigua de Sierra Nevada, Km. 7, Pinos Genil, 18071-Granada. email: [email protected].

3

Estacion Biologica Donana, C.S.I. C., Pabellon del Peru, Av. Maria Luisa s/ n, 41080 - Sevilla, email: [email protected]. 4

Dpto. Medicina Interna. Hospital Universitario "Virgen Macarena"; Av. Dr. Fedriani, 3, 41071 - Sevilla, email: [email protected].

SUMMARY We investigated the presence of Borrelia burgdorferi sensu lato in Ixodes

ricinus ticks (Acarina: Ixodidae) from woodlands of Cadiz, Huelva and Sevilla Provinces (SW of Iberian Peninsula, Spain). A total of 377 adult ticks (144 males and 233 females) were collected at different locations of Cadiz and Huelva provinces, fixed on hunted red deer ( Cervus elaphus). A lot of 71 ticks (12 males and 59 females) were analyzed by IFA (indirect immunofluorescence assay). The other part, 306 ticks (132 males and 174 females), was studied by conventional polymerase chain reaction (PCR) on 16S rRNA and flagellin (fla)

Pag. 242

Francisco J. Marquez, Jose J. Rodriguez, Pablo Guerrero, Jose E. Granados, Ramon C...

genes, and by nested PCR using as target the ribosomal intergenic spacer region between 5S and 23S rRNA genes. All our effort results in no detection of B. burgdorferi s. 1. in I. ricinus. These results suggested that bioecological conditions registered in the sampled area, particularly the high temperature registered during the summer, red deer incompetence or both, may be responsible for the absence of zoonotic cycle of these bacteria in the studied area.

RESUMEN Estudiamos la presencia de Borrelia burgdorferi sensu lato en la garrapata Ixodes ricinus (Acarina: Ixodidae) procedente de zonas forestales de las provincias de Cadiz, Huelva y Sevilla (SW de la Peninsula Iberica, Espana). Un total de 377 garrapatas adultas (144 machos y 233 hembras) se recogieron en distintas localidades, fijadas sobre red deers ( Cervus elaphus) abatidos. Un lote de 71 garrapatas (12 machos y 59 hembras) fueron analizadas mediante IFA (ensayo de inmunofluorescencia indirecta). Las 306 garrapatas restantes (132 machos y 174 hembras), fueron estudiadas mediante reaccion en cadena de la polimerasa (PCR) convencional sobre los genes 16S rRNA y de la flagelina (fla), y PCR anidado utilizando como diana la secuencia del espaciador intergenico ribosomal entre los genes 5S y 23S rRNA. A pesar de todos nuestros esfuerzos, no conseguimos detectar Borrelia burgdorferi s. 1. en Ixodes ricinus. Estos resultados sugieren que las condiciones bioecologicas del area muestreada, particularmente las altas temperaturas que se registran durante el verano, y la posible incompetencia del red deer pudieran ser los responsables de la ausencia de un ciclo zoonotico de estas bacterias en el area estudiada.

INTRODUCTION Lyme borreliosis is a wordlwide disease caused by spirochetes of the complex Borrelia burgdorferi s. 1. and is transmitted to humans by several species of ticks of the genus Ixodes (Jaenson, 1991; Korenberg, 1994; Nuttal et al., 1994). B. burgdorferi s. 1. complex consists of 10 named genospecies and several yet to be named genomic groups. The genospecies are B. burgdorferi sensu stricto, B. garinii, B. afzelii, B. valaisiana, B. lusitaniae, B. andersonii, B. bissettii, B. japonica, B. turdii, and B. tanukii (Barbour, 1984; Baranton et al., 1992; Fukunaga et al., 1996a; Le Fleche et al., 1997; Postic et al., 1998). Six genospecies are known to be prevalent in Europe. Three of these species are

Absence of Borrelia burgdorferi sensu lato in Ixodes ricinus from woodlands...

Pag. 243

causative agents of Lyme disease in humans (B. burgdorferi s. s., B. garinii and B. afzelii) (Van Dam et al., 1993) and not epidemiological data are available for the three others recently described (particularly about B. valaisiana, B. lusitaniae and B. bissettii) with a pathogenic potential remaining unknown. All these genospecies may cocirculate in local tick populations, suggesting that the local diversity of B. burgdorferi s. 1. can be as high as the regional or continental diversity (Hubalek, & Halouzka, 1997; Kurtenbach et al., 2001). Individual ticks may be infected with multiple genospecies of B. burgdorferi s. 1., however, mixed infections seem to be more unusual than single infections (Hubalek, & Halouzka, 1997; Rijpkema et al., 1994, 1996). Geographic distribution, prevalence on ticks and vertebrate host range of different genospecies are variable, probably related to the structure of the vertebrate host biocoenosis and the postulated dependence of each genospecies to a particular group of vertebrate host (Nakao, Miyamoto & Fukunaga, 1994). Evidence indicates that different genospecies of B. burgdorferi s. 1. can be maintained in nature by distinct transmission cycles involving the same vector tick species (I. ricinus) but different vertebrate host species (Kurtenbach et al., 1998) in Western Europe. Small mammals, particularly rodents and insectivores mainly (Gern et al., 1998), and partially lagomorphs (Telford & Spielman, 1989a,b; Matuschka et al., 2000), are considered the principal hosts for immature stages of I. ricinus ( mainly larvae) and competent reservoir for B. burgdorferi s. 1. avian hosts have been proved to play a substantial role in its transmission dynamics of these bacterias (Gray et al., 2000) and long-distance tick dispersion (Scott et al., 2001). Large mammals like red deer ( Cervus elaphus) or roe deer ( Capreolus capreolus) or domestic (sheep, goat, cow) serve as host for the most part of nymphs and adults (Matuschka & Spielman, 1986; Matuschka et al., 1993). Most studies indicate that the genospecies of B. burgdorferi s. 1. are maintained in nature by different spectra of vertebrate hosts. For example, in Europe, B. afzelii is frequently found to be associated with mice and voles, whereas sea bird and songbird populations often maintain B. garinii but not B. afzelii. In a research project concerning tick-borne bacteria and the spatial risk linked to the distribution of the different tick-borne pathogenic bacteria species in Andalusie, we try to detect of B. burgdorferi s. 1. in I. ricinus ticks collected in different localities of Cadiz and Huelva Provinces. These represent the most southern point in the distribution area of this tick species in Europe.

Pag. 244

Francisco J. Marquez, Jose J. Rodriguez, Pablo Guerrero, Jose E. Granados, Ramon C...

MATERIALS AND METHODS

Ticks collection Adult I. ricinus were obtained from red deer hunted in woodland areas of Alcala de los Gazules, Jimena, Jerez, Medina Sidonia and Los Barrios (Cadiz Province) and Aroche (Huelva Province) (table 1) during the winter of 19951996 and 1996-1997, and classified by an entomologist (FJM). Low density of ticks on vegetation, mainly oak tree ( Quercus suber - Quercus rotundifolia) forest and the corresponding degradation series (Rivas Martinez, 1987), resulted in unsuccessful collection of I. ricinus tick stages using blanket dragging.

Detection of Borrelia spp. in ticks by immunofluorescence Ticks were screened for the presence of B. burgdorferi s. 1. by using an IFA as described previously (Marquez & Constan, 1990), using the murine monoclonal antibody H9724 against Borrelia flagelline (acquired to Dr. Alan G. Barbour, San Antonio, Texas) and a goat anti-murine IgG conjugate marked with fluorescein (Sigma).

Preparation of samples for PCR DNA extraction . I. ricinus ticks were processed for PCR using a conventional phenol-chloroform DNA extraction and ethanol precipitation. Adults I. ricinus were individually crushed in 340 µl of lysis buffer (100 mM Tris-HC1 pH 8.0; 100 mM NaCl; 10 mM EDTA, added to 40 µl of 10% sodium dodecyl sulfate and 20 µl of proteinase K (Promega, Madison, WI) (50 mg/ml), and maintained in a bath preset at 55°C for 1 hr. After incubation, samples were extracted with phenol-chlorophorm as described elsewhere (Sambrook et al., 1989). Nucleic acids were precipitated adding 0.1 volumes of potassium acetate solution (5 M based on acetate), 2.5 volumes of absolute ethanol and chilling to -20°C.

PCR detection of B. burgdorferi s. 1. DNA. Technical approach to DNA detection of Borrelia burgdorferi s.l. was reviewed in Schmidt (1997) and Sparagano et al. (1999). We used conventional

Absence of Borrelia burgdorferi sensu lato in Ixodes ricinus from woodlands...

PAg. 245

and nested PCR for detection of B. burgdorferi s. 1. DNA. DNA of three B. burgdorferi s. 1. strains was used as positive controls: B. burgdorferi sensu stricto (B31), B. garinii (20047) and B. afzelii (VS461). Negative controls were also included in each PCR. As internal control, to demonstrate the absence of unspecific inhibition during amplification, we used concomitant amplification of internal transcribed ribosomal spacers (ITS1 and ITS2) of ticks (McLain et al., 1995). For PCR amplification of a 622 base pairs (bp) of 5 ' end of 16S rRNA fragment we used the oligonucleotide sequence Atborlf (5'- GTCAAACGGGATGTAGCAATACATCT) as forward primer, and the sequences Atbor2bg (5 ' -CTAG CTA)andtbor2z(5'-CTAG TATAT) as reverse primers, for specific amplification of B. burgdorferi-B. garinii and B. afzelii, respectively (modified from Marconi & Garon, 1992). A fragment of 584 bp from flagellin gene (fla) (positions 280-863 in this sequence in B. burgdorferi B31 -GenBank accession X16933) was amplified using the primers 5'- GCAGTTCAATCAGGTAAC GG -3' (sense primer C) and 5 '- AGGTTTTCAATAGCATACTC-3 ' (antisense primer D) and conditions previously described (Fukunaga & Koreki, 1995; Fukunaga et al., 1996b). Each reaction (final volume of 100 µl) contained 1µl of sample, 56 µl of distilled water, 10 µl of 10x Taq polymerase buffer (Promega), 8 µl of 25 mM MgC12, 20 µl of 1mM dNTP's, and 0.5 U of Taq DNA polymerase (Promega). Thermocycling : 35 cycles of amplification consisted of denaturation at 95°C for 20 sec, annealing at 58°C (amplification of 16S fragment) or 50°C (amplification of flagellin fragment) for 30 sec, and sequence extension at 72°C for 2 min. Nested PCR of intergenic spacer region between 5S and 23S rRNA genes (the duplicated organization of these genes in B. burgdorferi s.l. is described elsewhere- Schwartz, Gazumyan & Schwartz, 1992; Schwartz et al., 1992; Fukunaga, Yanagihara & Sohnaka, 1992) was accomplised using primers 23SN1 (5'-ACCATAGAC TCTTATTACTTT GAC-3') and 23SC1 (5'-TAAGCTGACTAATACTAATTACCC-3') for first PCR round, and 23SN2 (5'-CCATAGACTCTTATTACTTTGACCA-3') and 5SCB (5'-GAGAGTAGGTTATTGCCAGGG) for second PCR round, as elsewhere described (Rijpkema et al., 1995). First and second amplications result in 380 and 225 bp fragments respectively. The assay conditions are similar to those described (Rijpkema et al., 1995) for identification of B. burgdorferi s. 1.: the first PCR was performed in a reaction volume of 25 containing 0.625 U of Taq DNA polymerase (Promega, lx reac-

0

Pag. 246

Francisco J. Marquez, Jose J. Rodriguez, Pablo Guerrero, Jose E. Granados,

Ramon C...

tion buffer (Promega) supplemented with 2.5 mM MgC1 2 , 200 µM (each) deoxynucleotide triphospate, 5 pM (each) of primers 23SN1 and 23SC. The program for the first PCR includes an initial denaturation (1 min at 94°C) and the 25 rounds of temperature cycling (94°C for 30 s, 52°C for 30 s, and 72°C for 1 min). For the second PCR, a mixture of 5 µl containing 0.625 U of Taq DNA polymerase (Promega), lx reaction buffer (Promega) supplemented with 2.5 mM MgC12, 1 mM (each) deoxynucleotide triphospate, 5 pM (each) of primers 5SCB and 23SN2. The program for the first PCR incorporates an initial denaturation (1 min 94°C) and the 40 rounds of temperature cycling (94°C for 30 s, 55°C for 30 s, and 72°C for 1 min). We verified that all used primers were B. burgdorferi s. 1. specific by using FASTA and FINDPATTERN algorithm (GCG Program, Wisconsin University). All amplification reactions were conducted in a DNA Thermocycler 9600 (Perkin Elmer, Foster City, CA, using thin-wall microamp® tubes (Perkin Elmer). After amplification, 7 µl of PCR reaction were electrophoresed for 1 hr. at 7 V/cm in a 4% Nusieve® GTG agarose (FMC), Rockland (ME) gel in lx TAE (0.04 M Tris-acetate, 0.001 M EDTA), using the molecular weight marker VI (MWM VI) (Boehringer Mannheim) as control, stained with ethidium bromide and observed under ultraviolet light illumination.

RESULTS A total of 377 adult I. ricinus (144 males and 233 females) were investigated, 71 ticks were estudied by IFA (12 males and 59 females) and 306 (132 males and 174 females) by conventional and nested PCR. In I. ricinus, Borrelia spp. specimens were not detected in IFA assay. Any amplification fragment, corresponding to spected B. burgdorferi s. 1. size, results from conventional or nested PCR. A subsample of ticks lysates which were negative for B. burgdorferi s. 1. by PCR (n= 10) were spiked with B31 strain DNA, and subsequently, Borrelia DNA was detected in all samples. This finding indicated that PCR was not strongly inhibited by tick components because approximately 20 copies of the Borrelia genome could be detected in these ticks samples (Rijpkema et al., 1995).

DISCUSSION Ixodes ricinus, the species of tick considered as the main vector of Lyme borreliosis in Western Europe, has a reduced distribution area in the South of

Absence

of Borrelia burgdorferi sensu lato in Ixodes ricinus from woodlands...

Pag. 247

the Iberian Peninsula, limited to the main wet mountainous forested areas. In our area, all I. ricinus ticks studied were Borrelia sp. free. As previously discussed (Gilot et al., 1996, the maintenance of a B. burgdorferi focus depends on the simultaneous presence of two types of hosts: reproduction hosts which feed the various stages of the ticks and competent reservoir hosts necessary to infect the population of ticks. The capacity of a tick to maintain transmission of Lyme disease spirochetes depends upon a complex set of properties, including competence as a host for the spirochete, a pattern of feeding that focuses on a particular reservoir favored by a pattern of tick activity, during each transmission season, only if nymphs feed before larvae. Similarly, the capacity of a vertebrate to maintain the infection requires long-term support of the spirochete in a tissue accessible to vector ticks, tolerance of repeated feeding by the vector ticks and a pattern of host activity that exposes the host to numerous bites. The intensity of infection depends upon a continuous pattern of transmission in which each generation is infected anew (Matuschka & Spielman, 1986). It has been suggested that extrinsic factors such as climate, vegetation, the questing height of ticks and the tick infestation rate determine the relative role of a vertebrate host population in the local ecology of B. burgdorferi s. 1. As reviwed in Kurtenbach et al. (2002), actual evidence indicates that the different strains of B. burgdorferi s. 1. differ intrinsically in transmissibility, suggesting a strong element of host specificity. For example, many rodent species are transmission- (reservoir) competent for strains of B. burgdorferi s. s., B. afzelii and B. japonica. In addition, rodents seem to be transmission-competent for diverse variants of B. garinii found in Asia. American woodrats and mice are now known to be reservoir-competent for B. bissettii. A variety of bird species have been found to be transmission-competent hosts for various OspA (outer surface protein) serotypes of B. garinii, B. valaisiana and B.burgdorferi s. s. In the Iberian Peninsula, these competent reservoir hosts may be a reduced number of rodents, insectivores and much less lagomorphs (wild rabbit, Oryctolagus cuniculus, and brown hare, Lepus granatensis) as detected in similar ecologic conditions in United States (Telford & Spielman, 1989a,b). The presence of the bacterium in a tick population in a given area is linked with the two types of host defined above. When adult I. scapularis ticks collected from deer were compared with those collected from vegetation at the same sites for the presence of B. burgdorferi s. 1., a reduction in infection rate was

Pag. 248

Francisco J. Marquez, Jose J. Rodriguez, Pablo Guerrero, Jose E. Granados, Ramon

C...

observed in fixed ticks, depending on sex and physiological condition. Thus among the females ticks from deer, the infection rate was higher in flat than in engorged ticks (Lacombe, Rand & Smith, 1993). In addition, red and roe deer have been proposed as incompetent host with prophylactic effect for the presence of Borrelia on ticks (Telford et al., 1988; Jaenson & Talleklint, 1992, Matuschka et al., 1993; Mather, 1993), as sika deer ( Cervus nippon) (Isogai et al., 1994). The complement probably could play an important role in killing borreliae (Nelson et al., 2000). However, specific local climatic conditions of the study area may be determinants to explain our results. Ambient temperature crucially determines the course of infection of a variety of vector-borne pathogens. Changes in ambient temperature affect tick-pathogen relationships in various ways, including release of developmental diapause in the pathogen (Young et al., 1984; Lewengrub et al., 1989), protein synthesis in pathogens (Cluss & Boothby., 1990), and stimulation of heat shock proteins in the vector (Nakayama et al., 1989). Previous studies determined the effect of environmental temperature on the competence of I. scapularis, the main North American vector tick, at different temperatures (Shih, Telford & Spielman, 1995). Nymphs of I. scapularis became virtually noninfectious for mice after incubation at temperatures higher than 27°C for 2 weeks or longer. In addition, Lyme disease spirochetes (B. burgdorferi) did not grow when cultured at temperatures in excess of 37 2C (Barbour, 1984). In fact, ambient temperature in excess of 27°C are not permissive for transmission of B. burgdorferi, and could explain the absence of B. burgdorferi s. 1. in I. ricinus in SW Spain. The effect of ambient temperature on the susceptibility of deer ticks to infection by Lyme disease spirochetes, as well as on their subsequent infectivity for vertebrate hosts, however, remains to be defined. It may be that environment temperature limits spirochetal vector competence of nymphal deer ticks by destroying Lyme disease spirochetes within the vector ticks (Shih et al., 1995). B. burgdorferi has been found in host seeking I. ricinus from all of a large number of populations in Europe (Hubalek & Halouzka, 1998), with a mean proportion of unfed adults of I. ricinus infected about 17.4% (range from 3% to 58%), varying the results according to the method used (cultivation in BSK medium, microscopic method, or PCR), nevertheless PCR detecting spirochetal DNA is probably the most sensitive method (29% of adults were found infected).

Absence of Borrelia burgdorferi sensu lato in Ixodes ricinus from woodlands...

Pag. 249

B. lusitaniae has been proposed as the only genospecies isolated from I. ricinus ticks collected in Portugal (De Michelis et al., 2000) and Tunisia (Zhioua et al., 1999; Younsi et al., 2001). This suggests that the genospecies diversity of B. burgdorferi s. 1. decreases toward the southwestern margin of its Old World subtropical range (including Madeira islands) (Matuschka et al., 1993, 1998), but posterior works demonstrated that in several European countries including other Portuguese (Kurtenbach et al., 2001) and Spanish localities (Escudero et al., 2000; Barral et al., 2002) a coexistence of several genoespecies was possible.

ACKNOWLEDGMENTS We thank E. Garcia-Marquez for his collaborative work in the collection of ticks used in this study. Financial support: This study was partly supported by a grant from the Fondo de Investigaciones Sanitarias (94/0493) from the Ministry of Health, Spain.

REFERENCES Baranton, G., Postic, D., Saint Girons, I., Boerlin, P., Piffaretti, J.C., Assous, M. & Grimont, P.A., 1992. Delineation of Borrelia burgdorferi sensu stricto, Borrelia garinii sp. nov., and group VS461 associated with Lyme borreliosis. Int. J. Syst. Bacteriol., 42:378-383. Barbour, A.G., 1984. Isolation and cultivation of Lyme disease spirochetes. Yale J. Biol. Med., 57:521-525. Barral, M., Garcia-Perez, A.L., Juste, R.A., Hurtado, A., Escudero, R., Sellek, R.E. & Anda, P., 2002. Distribution of Borrelia burgdorferi sensu lato in Ixodes ricinus (Acari: Ixodidae) ticks from the Basque Country, Spain. J. Med. Entomol., 39: 177-184. Cluss, R.G. & Boothby, J.T.. 1990. Thermoregulation of protein synthesis in Borrelia burgdorferi. Infect. Immun., 58:1038-1042. De Michelis, S., Sewell, H.S., Collares-Pereira, M., Santos-Reis, M., Schouls, L. M., Benes, V., Holmes, E. C., Kurtenbach, K., 2000. Genetic diversity of Borrelia burgdorferi sensu lato in ticks from mainland Portugal. J. Clin. Microbiol., 38: 2128-2133.

Pag. 250

Francisco J. Marquez, Jose J. Rodriguez, Pablo Guerrero, Jose E. Granados,

Ramon C...

Escudero, R., Barral, M., Perez, A., Vitutia, M.M., Garcia-Perez, A.L., Jimenez, S, Sellek, R.E. & Anda, P., 2000. Molecular and pathogenic characterization of Borrelia burgdorferi sensu lato isolates from Spain. J. Clin. Microbiol., 38:4026-4033. Fukunaga, M. & Koreki, Y., 1995. The flagellin gene of Borrelia miyamotoi sp. nov., and its phylogenetic relationship among Borrelia species. FEMS Microbiol. Lett., 134:255-258. Fukunaga, M., A. Hamase, K. Okada, and M. Nakao. 1996a. Borrelia tanukii sp. nov. and Borrelia turdae sp. nov. found from Ixodid ticks in Japan: rapid species identification by 16S rRNA gene-targeted PCR analysis. Microbiol. Immunol., 40:877-881 Fukunaga, M., Okada, K., Nakao, M., Konishi, T. & Sato, Y., 1996b. Phylogenetic analysis of Borrelia species based on flagellin gene sequences and its application for molecular typing of Lyme disease borreliae. Int. J. Syst. Bacteriol., 46:898-905. Fukunaga, M., Yanagihara, Y. & Sohnaka, M., 1992. The 23S/5S ribosomal RNA genes (rrl /rrf) are separate from the 16S ribosomal RNA gene (rrs) in Borrelia burgdorferi, the aetiological agent of Lyme disease. J. Gen. Microbiol., 138:871-877. Gern, L., Estrada-Pena, A., Frandsen, F., Gray, J.S., Jaenson, T.G., Jongejan, F., Kahl, O., Korenberg, E., Mehl, R. & Nuttall, P.A., 1998. European reservoir hosts of Borrelia burgdorferi sensu lato. Zentralbl. Bakteriol., 287: 196-204. Gilot, B., Degeilh, B., Pichot, J., Doche, B. & Guiguen, C., 1996. Prevalence of Borrelia burgdorferi (sensu lato) in Ixodes ricinus (L.) populations in France, according to a phytoecological zoning of the territory. Eur. J. Epidemiol., 12:395-401. Gray, J.S., Kahl, O., Janetzki, C., Stein, J. & Guy, E., 1995. The spatial distribution of Borrelia burgdorferi-infected Ixodes ricinus in the Connemara region of County Galway, Ireland. Exp. Appl. Acarol., 19:163-172. Gray, J.S., Robertson, J.N. & Key, S., 2000. Limited role of rodents as reservoirs of Borrelia burgdorferi sensu lato in Ireland. Eur. J. Epidemiol., 16: 101-103. Hubalek, Z., & Halouzka. J., 1997. Distribution of Borrelia burgdorferi sensu lato genomic groups in Europe, a review. Eur. J. Epidemiol., 13: 951-957.

Absence of Borrelia burgdorferi sensu lato in Ixodes ricinus from woodlands...

Pag. 251

Hubalek, Z. & Halouzka, J., 1998. Prevalence rates of Borrelia burgdorferi sensu lato in host-seeking Ixodes ricinus ticks in Europe. Parasitol. Res., 84:167-172. Isogai, E., Kamewaka, Y., Isogai, H., Kimura, K., Fujii, N. & Nishikawa, T., 1994. Complement-mediated killing of Borrelia garinii-bactericidal activity of wild deer serum. Microbiol Immunol., 38: 753-756. Jaenson, T.G.T., 1991. The epidemiology of Lyme borreliosis. Parasitol. Today, 7:39-45. Jaenson, T.G.T. & Talleklint, L., 1992. Incompetence of roe deer as reservoir of the Lyme borreliosis spirochete. J. Med. Entomol., 29:813-817. Korenberg, E.I., 1994. Comparative ecology and epidemiology of Lyme disease and tick-borne encephalitis in the former Soviet Union. Parasitol. Today, 10:105-112. Kurtenbach, K., De Michelis, S., Etti, S., Schafer, S.M., Sewell, H.S., Brade, V. & Kraiczy, P., 2002. Host association of Borrelia burgdorferi sensu latothe key role of host complement. Trends Microbiol., 10: 74-79. Kurtenbach, K., De Michelis, S., Sewell, H.S., Etti, S., Schafer, S. M., Hails, R., Collares-Pereira, M., Santos-Reis, M., Hanincova, K., Labuda, M., Bormane, A. & Donaghy, M., 2001. Distinct combinations of Borrelia burgdorferi sensu lato genospecies found in individual questing ticks from Europe. Appl. Environ. Microbiol., 67: 4926-4929. Kurtenbach, K., Peacey, M., Rijpkema, S.G.T., Hoodless, A.N., Nuttall, P.A. & Randolph, S.E., 1998. Differencial transmission of the genospecies of Borrelia burgdorferi sensu lato by game birds and small rodents in England. Appl. Environ. Microbiol., 64:1169-1174. Lacombe, E., Rand, P.W. & Smith, R.P. Jr., 1993. Disparity of Borrelia burgdorferi infection rates of adult Ixodes dammini on deer and vegetation. J. Infect. Dis., 167:1236-1238. Le Fleche, A., D. Postic, K. Girardet, O. Peter, and G. Baranton. 199.7. Characterization ofBorrelia lusitaniae sp. nov. by 16S ribosomal DNA sequence analysis. Int. J. Syst. Bacteriol., 47: 921-925. Lewengrub, S., Rudzinska, M.A., Piesman, J., Spielman, A. & Zung, J.L., 1989. The influence of heat on the development of Babesia microti in unfed nymphs of Ixodes dammini. Can. J. Zool., 66: 1342-1345.

Pag. 252

Francisco J. Marquez, Jose J. Rodriguez, Pablo Guerrero, Jose E. Granados, Ramon C...

Marconi, R.T. & Garon, C.F., 1992. Development of polymerase chain reaction primer sets for diagnosis of Lyme disease and for species-specific identification of Lyme disease isolates by 16S rRNA signature nucleotide analysis. J. Clin. Microbiol., 30: 2830-2834. Marquez, F.J. & Constan, M.C., 1990. Infection d 'Ixodes ricinus (L., 1758) et Haemaphysalis punctata Canestrini et Fanzago, 1877 (Acarina, Ixodidae) par Borrelia burgdorferi dans le nord de la Peninsule Iberique (Pays Basque espagnol et Navarre). Bull. Soc. Franc. Parasitol., 8:323-330. Mather, T.N., 1993. The dynamics of spirochete transmission between ticks and vertebrates. In: Ecology and environmental management of Lyme disease. Ginsberg, H.S. ed. Rutgers University Press, New Brunswick. Matuschka, F.R. & Spielman, A., 1986. The emergence of Lyme disease in a changing environment in North America and central Europe. Exp. Appl. Acarol., 2:337-353. Matuschka, F.R., Heiler, M., Eiffert, H., Fischer, P., Lotter, H. & Spielman, A., 1993. Diversionary role of hoofed game in the transmission of Lyme spirochetes. Am. J. Trop. Med. Hyg., 48:693-699. Matuschka, F.R., Mug, B., Schinkel, T.W., Spielman, A.& Richter, D., 1998. Diversity of European Lyme disease spirochetes at the southern margin of their range. Appl. Environ. Microbiol., 64:1980-1982. Matuschka, F.R., Schinkel, T.W., Mug, B., Spielman, A. & Richter, D., 2000. Relative incompetence of european rabbits for Lyme disease spirochaetes. Parasitology, 121: 297-302. McLain, D.K., Wesson, D.M., Collins, F.H. & Oliver, J.H. Jr, 1995. Evolution of the rDNA spacer, ITS2, in the ticks Ixodes scapularis and I. pacificus (Acari: Ixodidae). Heredity, 75:303-319. Nakao, M., Miyamoto, K. & Fukunaga, M., 1994. Lyme disease spirochetes in Japan: enzootic transmission cycles in birds, rodents, and Ixodes persulcatus ticks. J. Infect. Dis., 170: 878-882. Nakayama, Y., Spielman, A. & James, A.A., 1989. Protein synthesis induced by heat in an Ixodes tick. Insect Biochem., 19:731-736. Nelson, D.R., Rooney, S., Miller, N.J. & Mather, T.N., 2000. Complementmediated killing of Borrelia burgdorferi by nonimmune sera from sika deer. J. Parasitol., 86: 1232-1238.

Absence of Borrelia burgdorferi sensu lato in Ixodes ricinus from woodlands...

Pag. 253

Nuttal, P., Randolph, S., Carey, D., Craine, N., Livesley, A. & Gern, L., 1994. The ecology of Lyme borreliosis in the U.K.: Lyme borreliosis. In: Lyme borreliosis [NATO meeting]. Axford, J.S. & Rees, D.H.E. (eds.). Plenum Press, New York, 125-131. Postic, D., Ras, N. M., Lane, R. S., Hendson, M. & Baranton, G., 1998. Expanded diversity among Californian Borrelia isolates and description of Borrelia bissettii sp. nov. (formerly Borrelia group DN127). J. Clin. Microbiol., 36: 3497-3504. Rijpkema, S.G.T., Herbes, R.G., Verbeek-De Kruif, N. & Schellekens, J.F.P., 1996. Detection of four species of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks collected from roe deer (Capreolus capreolus) in The Netherlands. Epidemiol. Infect., 117:563-566. Rijpkema, S.G.T., Molkenboer, M.J.C.H., Schouls, L.M., Jongejan, F. & Schellekens, J.F.P., 1995. Simultaneous detection and genotyping of three genomic groups of Borrelia burgdorferi sensu lato in Dutch Ixodes ricinus ticks by characterizacion of the amplified intergenic spacer region between 5S and 23S rRNA genes. J. Clin. Microbiol., 33:3091-3095. . Rijpkema, S.G.T., Nieuwenhuijs, J., Franssen, F.F.J. & Jongejan, F., 1994. Infection rates of Borrelia burgdorferi in different instars of Ixodes ricinus ticks from the Dutch North Sea island of Ameland. Exp. Appl. Acarol., 18:531542. Rivas Martinez, S. (coord.) 1987. Memoria del mapa de series de vegetacibn de Espana (y mapas). Serie Tecnica, I.C.O.N.A. - Ministerio de Agricultura, Pesca y Alimentaci6n. Madrid. 268 pp. Sambrook, J., Fritsch, E.F. & Maniatis, T., 1989. Molecular cloning. A laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Schmidt, B.L., 1997. PCR in laboratory diagnosis of human Borrelia burgdorferi infections. Clin. Microbiol. Rev., 10:185-201. Schwartz, I., Wormser, G.P., Schwartz, J.J., Cooper, D., Wissensee, P., Gazumyan, A., Zinmmermann, E., Goldberg, N.S., Bittker, N.S., Campbell, G.L. & Paviaa, C.S., 1992. Diagnosis of early Lyme disease by polimerase chain reaction amplification and culture of skin biopsies from erythema migrans lesions. J. Clin. Microbiol., 30:3082-3088.

Pag. 254

Francisco J. Marquez, Jose J. Rodriguez, Pablo Guerrero, Jose E. Granados, Ramon C...

Schwartz, J.J., Gazumyan, A. & Schwartz, I., 1992. rRNA gene organization in the Lyme disease spirochete, Borrelia burgdorferi. J. Bacteriol., 174:3757-3765. Scott, J.D., Fernando, K., Banerjee, S.N., Durden, L.A., Byrne, S.K, Banerjee, M., Mann, R.B. & Morshed, M.G., 2001. Birds disperse ixodid (Acari: Ixodidae) and Borrelia burgdorferi-infected ticks in Canada. J. Med.Entomol., 38: 493-500. Shih, C.M., & Telford, S.R., 1995. Effect of ambient temperature on competence of deer ticks as hosts for Lyme disease spirochetes J. Clin Microbiol, 33: 958-961. Sparagano, O.A., Allsopp, M.T., Mank, R.A., Rijpkema, S.G., Figueroa, J.V. & Jongejan, F., 1999. Molecular detection of pathogen DNA in ticks (Acari: Ixodidae): a review. Exp. Appl. Acarol., 23: 929-960. Telford, S.R. III & Spielman, A., 1989a. Enzootic transmission of the agent of Lyme disease in rabbits. Am. J. Trop. Med. Hyg., 41:482-490. Telford, S.R. III & Spielman, A., 1989b. Competence of a rabbit-feeding Ixodes (Acari: Ixodidae) as a vector of the Lyme disease spirochete. J. Med. Entomol., 26:118-121. Telford, S.R. III, Mather, T.N., Moore, Si, Wilson, M.L. & Spielman, A., 1988. Incompetence of deer as reservoirs of the Lyme disease spirochete. Am. J. Trop. Med. Hyg., 39:105-109. Van Dam, A.P., Kuiper, H., Vos, K., Widjojokusumo, A., Dejongh, B.M., Spanjaard, L., Ramselaar, A.C.P., Kramer, M.D. & Dankert, J., 1993. Different genospecies of Borrelia burgdorferi are associated with distinct clinical manifestations of Lyme borreliosis. Clin. Infect. Dis., 17:708-717. Young, A.S., Leitch, B.L & Mutugi, J.J., 1984. Some factors controlling the stimulation of sporogony of Theileria parva in its tick vector Rhipicephalus appendiculatus. Int. J. Parasitol., 14:97-102. Younsi, H., Postic, D., Baranton, G. & Bouattour A. 2001. High prevalence of Borrelia lusitaniae in Ixodes ricinus ticks in Tunisia. Eur. J. Epidemiol., 17: 53-56. Zhioua, E., Bouattour, A., Hu, C.M., Gharbi, M., Aeschliman, A., Ginsberg, H.S. & Gern, L., 1999. Infection of Ixodes ricinus (Acari:Ixodidae) by Borrelia burgdorferi sensu lato in North Africa. J. Med. Entomol., 36:216-218.

Absence of Borrelia burgdorferi sensu lato in Ixodes ricinus from woodlands...

Pag. 255

Table 1.- Localities sampled during fall-winter of 1995-1996. M = males, f = females. Date

Hunting zone

Locality (Province)

Host

I. ricinus

26/11/95

Lote I/II/III

Alcala de los Gazules (CA)

Red deer

12 m, 22 f

28/11/95

Cardelas

Ubrique (CA)

Red deer, wild boar

12/01/96

Las Lomas

Medina Sidonia (CA)

Red deer

19/01/96 Zanona

Medina Sidonia (CA)

Red deer, wild boar

44 m, 54 f

20/01/96

Jimena (CA)

Red deer, mouflon

10 m, 23 f

03/02/96 Navas-S 5 Norte

Navas (SE)

Red deer

08/02/96 Jarda

Jimena (CA)

Red deer, wild boar

La Jarda

10/02/96

La Alcaria

Jerez de la Frontera (CA)

Red deer

11/02/96

Isla Verde

Alcala de los Gazules (CA)

Red deer

12/02/96

Garganta Milian

Jerez de la Frontera (CA)

Red deer

4 m, 52 f

24/02/96

San Carlos Tiradero Los Barrios (CA)

Red deer

4 m, 18 f

16/03/96

El Bujeo

Olvera (CA)

Wild boar

16/11/96

Los Rasos

Aroche (HU)

Red deer

17/11/96

La Jarilla

El Pedroso (SE)

Wild boar

23/11/96

El Revuelo

Constantina (SE)

Wild boar

23 m, 21 f